SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '1c7t'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CMA_B_SAMB105_0 (PROTEIN (MET REPRESSOR))	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	ARG A 454 LEU A 409 GLU A 405 HIS A 401 GLY A 416	SO4 A2001 (-3.8A) None None None None	1.18A	1cmaA-1c7tA: undetectable 1cmaB-1c7tA: undetectable	1cmaA-1c7tA: 8.93 1cmaB-1c7tA: 8.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FM6_D_BRLD503_1 (PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 682 SER A 738 HIS A 352 LEU A 170 LEU A 736	None	1.11A	1fm6D-1c7tA: undetectable	1fm6D-1c7tA: 16.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HRK_A_CHDA1503_0 (FERROCHELATASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 410 PRO A 411 LEU A 112	None	0.49A	1hrkA-1c7tA: undetectable	1hrkA-1c7tA: 17.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I7Z_C_COCC302_2 (CHIMERA OF IG KAPPA CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION CHIMERA OF IG GAMMA-1 CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	GLU A 692 TYR A 674 PRO A 673 ASP A 691	None	1.49A	1i7zD-1c7tA: 1.5	1i7zD-1c7tA: 13.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJL_B_SAMB400_0 (METHIONINE REPRESSOR PROTEIN METJ)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 9	ARG A 454 LEU A 409 GLU A 405 HIS A 401 GLY A 416	SO4 A2001 (-3.8A) None None None None	1.20A	1mjlA-1c7tA: undetectable 1mjlB-1c7tA: undetectable	1mjlA-1c7tA: 8.93 1mjlB-1c7tA: 8.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJQ_A_SAMA200_0 (METHIONINE REPRESSOR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	ARG A 454 LEU A 409 GLU A 405 HIS A 401 GLY A 416	SO4 A2001 (-3.8A) None None None None	1.19A	1mjqA-1c7tA: undetectable 1mjqB-1c7tA: undetectable	1mjqA-1c7tA: 8.93 1mjqB-1c7tA: 8.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJQ_C_SAMC199_0 (METHIONINE REPRESSOR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 10	ARG A 454 LEU A 409 GLU A 405 HIS A 401 GLY A 416	SO4 A2001 (-3.8A) None None None None	1.22A	1mjqC-1c7tA: undetectable 1mjqD-1c7tA: undetectable	1mjqC-1c7tA: 8.93 1mjqD-1c7tA: 8.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJQ_I_SAMI199_0 (METHIONINE REPRESSOR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	ARG A 454 LEU A 409 GLU A 405 HIS A 401 GLY A 416	SO4 A2001 (-3.8A) None None None None	1.23A	1mjqI-1c7tA: undetectable 1mjqJ-1c7tA: undetectable	1mjqI-1c7tA: 8.93 1mjqJ-1c7tA: 8.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N2X_B_SAMB402_0 (S-ADENOSYL-METHYLTRA NSFERASE MRAW)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 302 GLY A 307 GLY A 287 ASP A 273 GLY A 277	None	0.93A	1n2xB-1c7tA: undetectable	1n2xB-1c7tA: 15.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NW3_A_SAMA500_0 (HISTONE METHYLTRANSFERASE DOT1L)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	TYR A 501 ASP A 618 GLY A 538 ALA A 453 PHE A 536	None	1.29A	1nw3A-1c7tA: undetectable	1nw3A-1c7tA: 18.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PJ7_A_FFOA2887_1 (N,N-DIMETHYLGLYCINE OXIDASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	ASP A 111 THR A 109 GLU A 405	None SO4 A2001 (-3.4A) None	0.80A	1pj7A-1c7tA: 0.7	1pj7A-1c7tA: 22.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZQ_B_ACTB861_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 5	GLY A 598 GLN A 599 VAL A 634 SER A 602	None	1.26A	1zzqB-1c7tA: undetectable	1zzqB-1c7tA: 17.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_A_ACTA860_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 5	GLY A 598 GLN A 599 VAL A 634 SER A 602	None	1.22A	1zzuA-1c7tA: 0.1	1zzuA-1c7tA: 17.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AVV_E_MK1E902_2 (POL POLYPROTEIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	ASP A 346 ILE A 447 VAL A 443	None	0.71A	2avvD-1c7tA: 0.0	2avvD-1c7tA: 8.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2COI_A_GBNA420_1 (BRANCHED CHAIN AMINOTRANSFERASE 1, CYTOSOLIC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 10	ARG A 612 GLY A 537 ALA A 615 TYR A 340 VAL A 661	None	1.49A	2coiA-1c7tA: undetectable 2coiB-1c7tA: undetectable	2coiA-1c7tA: 17.54 2coiB-1c7tA: 17.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJF_B_ADNB2002_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ARG A 870 GLU A 883 PRO A 195 ALA A 824	None	1.44A	2ejfB-1c7tA: undetectable	2ejfB-1c7tA: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FL5_F_RBFF204_1 (IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN IMMUNOGLOBULIN IGG1 HEAVY CHAIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 8	ASN A 503 ARG A 480 GLU A 461 VAL A 577	None	1.09A	2fl5E-1c7tA: 2.2 2fl5F-1c7tA: 2.2	2fl5E-1c7tA: 12.94 2fl5F-1c7tA: 13.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRC_A_CHDA703_0 (FERROCHELATASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	LEU A 810 PRO A 753 LEU A 807 ARG A 805	None	1.41A	2hrcA-1c7tA: 0.3	2hrcA-1c7tA: 17.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ITZ_A_IREA2021_2 (EPIDERMAL GROWTH FACTOR RECEPTOR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 96 LEU A 45 MET A 44	None	0.76A	2itzA-1c7tA: undetectable	2itzA-1c7tA: 16.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PO5_B_CHDB503_0 (FERROCHELATASE, MITOCHONDRIAL)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 410 PRO A 411 LEU A 112	None	0.52A	2po5B-1c7tA: undetectable	2po5B-1c7tA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PO7_B_CHDB503_0 (FERROCHELATASE, MITOCHONDRIAL)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 410 PRO A 411 LEU A 112	None	0.57A	2po7B-1c7tA: undetectable	2po7B-1c7tA: 17.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZGW_B_ADNB1302_1 (BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	GLU A 883 ALA A 833 PRO A 195 ALA A 824	None	1.20A	2zgwB-1c7tA: undetectable	2zgwB-1c7tA: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZIA_A_CL9A401_2 (DEOXYCYTIDINE KINASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	VAL A 218 ASP A 794 LEU A 205 ARG A 805	None	1.48A	2ziaA-1c7tA: undetectable	2ziaA-1c7tA: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZZN_B_SAMB402_0 (UNCHARACTERIZED PROTEIN MJ0883)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	PHE A 597 LEU A 593 GLY A 538 PRO A 450 ASP A 640	None	1.33A	2zznB-1c7tA: undetectable	2zznB-1c7tA: 17.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3APX_A_Z80A190_1 (ALPHA-1-ACID GLYCOPROTEIN 2)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	PHE A 698 GLU A 769 LEU A 732 ARG A 337 ALA A 729	None	1.30A	3apxA-1c7tA: 0.0	3apxA-1c7tA: 11.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3C0Z_A_SHHA301_1 (HISTONE DEACETYLASE 7A)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 5	HIS A 375 ASP A 448 HIS A 452 ASP A 539	None None CBS A1001 (-4.2A) CBS A1001 (-3.9A)	1.21A	3c0zA-1c7tA: undetectable	3c0zA-1c7tA: 19.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DZY_D_BRLD478_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	ILE A 441 GLN A 363 ILE A 432 LEU A 756	None	1.33A	3dzyD-1c7tA: 0.0	3dzyD-1c7tA: 17.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKX_B_1UNB201_1 (PROTEASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	GLY A 537 ALA A 615 VAL A 634 GLY A 598 THR A 631	None	0.95A	3ekxA-1c7tA: undetectable	3ekxA-1c7tA: 8.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KU9_B_SPMB700_1 (POLYAMINE OXIDASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	GLU A 739 TYR A 669 PHE A 672 TYR A 683	CBS A1001 (-2.7A) CBS A1001 (-4.4A) CBS A1001 (-4.7A) CBS A1001 (-4.1A)	1.32A	3ku9B-1c7tA: undetectable	3ku9B-1c7tA: 20.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L2V_A_RLTA397_1 (INTEGRASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 448 ASP A 539 GLN A 614 GLU A 446	None CBS A1001 (-3.9A) None None	1.16A	3l2vA-1c7tA: undetectable	3l2vA-1c7tA: 18.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_A_CP6A562_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	8 / 12	ARG A 349 ASP A 378 HIS A 452 ASP A 540 TYR A 669 ASP A 671 TRP A 737 GLU A 739	CBS A1001 (-3.0A) CBS A1001 ( 4.8A) CBS A1001 (-4.2A) CBS A1001 ( 4.3A) CBS A1001 (-4.4A) CBS A1001 (-3.1A) CBS A1001 (-3.8A) CBS A1001 (-2.7A)	1.22A	3lmyA-1c7tA: 36.1	3lmyA-1c7tA: 21.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_A_CP6A562_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	11 / 12	ARG A 349 HIS A 375 ASP A 378 ASP A 448 HIS A 452 ASP A 539 TRP A 639 TYR A 669 ASP A 671 TRP A 737 GLU A 739	CBS A1001 (-3.0A) None CBS A1001 ( 4.8A) None CBS A1001 (-4.2A) CBS A1001 (-3.9A) CBS A1001 (-3.5A) CBS A1001 (-4.4A) CBS A1001 (-3.1A) CBS A1001 (-3.8A) CBS A1001 (-2.7A)	0.44A	3lmyA-1c7tA: 36.1	3lmyA-1c7tA: 21.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_B_CP6B563_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	7 / 12	ARG A 349 ASP A 378 HIS A 452 ASP A 540 TYR A 669 TRP A 737 GLU A 739	CBS A1001 (-3.0A) CBS A1001 ( 4.8A) CBS A1001 (-4.2A) CBS A1001 ( 4.3A) CBS A1001 (-4.4A) CBS A1001 (-3.8A) CBS A1001 (-2.7A)	1.28A	3lmyB-1c7tA: 36.1	3lmyB-1c7tA: 21.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_B_CP6B563_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	11 / 12	ARG A 349 HIS A 375 ASP A 378 ASP A 448 HIS A 452 ASP A 539 TRP A 616 TRP A 639 TYR A 669 TRP A 737 GLU A 739	CBS A1001 (-3.0A) None CBS A1001 ( 4.8A) None CBS A1001 (-4.2A) CBS A1001 (-3.9A) CBS A1001 (-3.6A) CBS A1001 (-3.5A) CBS A1001 (-4.4A) CBS A1001 (-3.8A) CBS A1001 (-2.7A)	0.44A	3lmyB-1c7tA: 36.1	3lmyB-1c7tA: 21.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_B_CP6B563_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	HIS A 375 ASP A 378 GLU A 739 TYR A 669 TRP A 737	None CBS A1001 ( 4.8A) CBS A1001 (-2.7A) CBS A1001 (-4.4A) CBS A1001 (-3.8A)	1.34A	3lmyB-1c7tA: 36.1	3lmyB-1c7tA: 21.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MTE_B_SAMB220_0 (16S RRNA METHYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 325 GLY A 323 ALA A 231 LEU A 259 LEU A 233	None	1.03A	3mteB-1c7tA: undetectable	3mteB-1c7tA: 14.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N23_C_OBNC1_1 (SODIUM/POTASSIUM-TRA NSPORTING ATPASE SUBUNIT ALPHA-1)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	GLN A 229 ASP A 232 LEU A 233 VAL A 237 ALA A 238	None	1.37A	3n23C-1c7tA: 0.1	3n23C-1c7tA: 22.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N2O_C_AG2C1002_1 (BIOSYNTHETIC ARGININE DECARBOXYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 8	SER A 697 ASP A 204 LEU A 205 ASP A 691	None	1.24A	3n2oC-1c7tA: 7.6 3n2oD-1c7tA: 6.2	3n2oC-1c7tA: 22.90 3n2oD-1c7tA: 22.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NVC_A_SALA370_1 (GENTISATE 1,2-DIOXYGENASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	GLN A 494 ARG A 349 HIS A 375 ASP A 379	CBS A1001 ( 4.2A) CBS A1001 (-3.0A) None None	0.92A	3nvcA-1c7tA: undetectable	3nvcA-1c7tA: 19.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_A_SAMA6735_0 (16S RRNA METHYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 325 GLY A 323 ALA A 231 LEU A 259 LEU A 233	None	1.04A	3p2kA-1c7tA: undetectable	3p2kA-1c7tA: 14.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_B_SAMB6735_0 (16S RRNA METHYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 325 GLY A 323 ALA A 231 LEU A 259 LEU A 233	None	1.07A	3p2kB-1c7tA: undetectable	3p2kB-1c7tA: 14.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_C_SAMC6735_0 (16S RRNA METHYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 325 GLY A 323 ALA A 231 LEU A 259 LEU A 233	None	1.04A	3p2kC-1c7tA: undetectable	3p2kC-1c7tA: 14.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_D_SAMD6735_0 (16S RRNA METHYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	GLY A 325 GLY A 323 ALA A 231 LEU A 259 LEU A 233	None	1.03A	3p2kD-1c7tA: undetectable	3p2kD-1c7tA: 14.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3R55_A_PZAA598_0 (LACTOPEROXIDASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	GLU A 290 PHE A 279 GLN A 275	None	0.89A	3r55A-1c7tA: 0.0	3r55A-1c7tA: 22.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S3O_A_DLUA399_1 (PFV INTEGRASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 448 ASP A 539 GLN A 614 GLU A 446	None CBS A1001 (-3.9A) None None	1.15A	3s3oA-1c7tA: undetectable	3s3oA-1c7tA: 18.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UY4_A_PAUA302_0 (PANTOTHENATE SYNTHETASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 8	VAL A 636 VAL A 661 ASP A 618 GLN A 617	None	1.03A	3uy4A-1c7tA: 2.6	3uy4A-1c7tA: 17.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W1W_B_CHDB503_0 (FERROCHELATASE, MITOCHONDRIAL)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 410 PRO A 411 LEU A 112	None	0.48A	3w1wB-1c7tA: undetectable	3w1wB-1c7tA: 17.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ZOA_A_ACRA1587_2 (TREHALOSE SYNTHASE/AMYLASE TRES)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	ARG A 337 PHE A 338 PRO A 339	None	0.81A	3zoaB-1c7tA: 10.2	3zoaB-1c7tA: 21.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A97_A_ZPCA1318_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	GLU A 380 GLU A 739 HIS A 373 VAL A 357	None CBS A1001 (-2.7A) None None	1.01A	4a97A-1c7tA: 3.1	4a97A-1c7tA: 16.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EYS_A_ACTA402_0 (MCCC FAMILY PROTEIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ASP A 648 SER A 722 ASP A 723 GLU A 777	None	1.14A	4eysA-1c7tA: undetectable	4eysA-1c7tA: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J7X_B_SASB804_1 (SEPIAPTERIN REDUCTASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	PHE A 798 TRP A 795 PRO A 753 GLY A 803 LEU A 837	None	1.11A	4j7xB-1c7tA: 2.0	4j7xB-1c7tA: 16.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JQ4_A_IMNA401_1 (ALDO-KETO REDUCTASE FAMILY 1 MEMBER C2)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 10	VAL A 237 TYR A 268 VAL A 263 LEU A 318 LEU A 316	None	1.38A	4jq4A-1c7tA: 11.2	4jq4A-1c7tA: 17.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KLR_B_CHDB504_0 (FERROCHELATASE, MITOCHONDRIAL)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 819 PRO A 820 ARG A 854	None	0.61A	4klrB-1c7tA: undetectable	4klrB-1c7tA: 17.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOE_F_TR6F101_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B E-SITE DNA2)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	SER A 500 GLY A 619 ASP A 618 GLY A 537	None	0.88A	4koeA-1c7tA: 0.0 4koeB-1c7tA: 0.0 4koeC-1c7tA: undetectable	4koeA-1c7tA: 20.55 4koeB-1c7tA: 20.55 4koeC-1c7tA: 16.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOE_H_TR6H101_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B E-SITE DNA4)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	SER A 500 GLY A 619 ASP A 618 GLY A 537	None	0.84A	4koeA-1c7tA: undetectable 4koeB-1c7tA: undetectable 4koeD-1c7tA: undetectable	4koeA-1c7tA: 20.55 4koeB-1c7tA: 20.55 4koeD-1c7tA: 16.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MI4_A_SPMA201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 6	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.27A	4mi4A-1c7tA: undetectable	4mi4A-1c7tA: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MI4_B_SPMB201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 7	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.27A	4mi4B-1c7tA: undetectable 4mi4C-1c7tA: 0.0	4mi4B-1c7tA: 11.32 4mi4C-1c7tA: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MI4_B_SPMB201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 7	ASN A 719 GLU A 782 TYR A 778 GLU A 777 ARG A 776	None	1.36A	4mi4B-1c7tA: undetectable 4mi4C-1c7tA: 0.0	4mi4B-1c7tA: 11.32 4mi4C-1c7tA: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MI4_C_SPMC201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 7	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.27A	4mi4A-1c7tA: undetectable 4mi4C-1c7tA: 0.0	4mi4A-1c7tA: 11.32 4mi4C-1c7tA: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MJ8_A_SPMA201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 8	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.27A	4mj8A-1c7tA: 0.1 4mj8C-1c7tA: undetectable	4mj8A-1c7tA: 11.10 4mj8C-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MJ8_B_SPMB201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 8	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.26A	4mj8B-1c7tA: undetectable 4mj8C-1c7tA: 0.0	4mj8B-1c7tA: 11.10 4mj8C-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MJ8_C_SPMC201_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 7	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.43A	4mj8C-1c7tA: 0.0	4mj8C-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODO_B_FK5B203_2 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	ALA A 196 GLN A 868 GLY A 848	None	0.63A	4odoC-1c7tA: 0.0	4odoC-1c7tA: 10.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6X_G_HCYG900_2 (GLUCOCORTICOID RECEPTOR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	LEU A 506 MET A 460 TYR A 501	None	0.87A	4p6xG-1c7tA: undetectable	4p6xG-1c7tA: 14.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QA0_B_SHHB404_2 (HISTONE DEACETYLASE 8)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 11	TYR A 683 HIS A 373 HIS A 375 ASP A 448 GLY A 537	CBS A1001 (-4.1A) None None None None	1.46A	4qa0B-1c7tA: undetectable	4qa0B-1c7tA: 16.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R87_E_SPME202_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 5	GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.13A	4r87E-1c7tA: 0.0	4r87E-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R87_G_SPMG202_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 9	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.32A	4r87E-1c7tA: 0.0 4r87G-1c7tA: 0.0	4r87E-1c7tA: 11.10 4r87G-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R87_H_SPMH202_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ASN A 719 GLU A 782 TYR A 778 GLU A 777	None	1.01A	4r87H-1c7tA: 0.0	4r87H-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R87_I_SPMI202_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 7	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.30A	4r87I-1c7tA: 0.0	4r87I-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R87_K_SPMK202_1 (SPERMIDINE N1-ACETYLTRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 9	ASN A 719 GLU A 782 GLU A 708 TYR A 778 GLU A 777	None	1.21A	4r87I-1c7tA: 0.0 4r87K-1c7tA: 0.0	4r87I-1c7tA: 11.10 4r87K-1c7tA: 11.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XDT_A_ACTA406_0 (FAD:PROTEIN FMN TRANSFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 5	SER A 697 LYS A 694 ARG A 693 LEU A 791	None	1.16A	4xdtA-1c7tA: 0.0	4xdtA-1c7tA: 17.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XP9_C_1WEC706_1 (TRANSPORTER)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	PHE A 423 ASP A 428 GLY A 422 SER A 425	None	1.30A	4xp9C-1c7tA: 0.0	4xp9C-1c7tA: 21.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YMG_B_SAMB1001_1 (PUTATIVE SAM-DEPENDENT O-METHYLTRANFERASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	SER A 488 GLU A 461 GLU A 473	None	0.74A	4ymgB-1c7tA: 0.7	4ymgB-1c7tA: 14.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YV5_A_SVRA205_2 (BASIC PHOSPHOLIPASE A2 HOMOLOG 2)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	LEU A 205 ASN A 800 PRO A 838 ARG A 825	None	1.37A	4yv5B-1c7tA: 0.0	4yv5B-1c7tA: 8.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YV5_B_SVRB207_1 (BASIC PHOSPHOLIPASE A2 HOMOLOG 2)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	LEU A 205 ASN A 800 PRO A 838 ARG A 825	None	1.36A	4yv5A-1c7tA: 0.0	4yv5A-1c7tA: 8.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z53_F_TR6F101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A E-SITE DNA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	GLY A 619 ASP A 618 GLY A 537 SER A 500	None	0.90A	4z53A-1c7tA: undetectable 4z53B-1c7tA: undetectable	4z53A-1c7tA: 22.48 4z53B-1c7tA: 22.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z53_H_TR6H101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A E-SITE DNA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	GLY A 619 ASP A 618 GLY A 537 SER A 500	None	0.84A	4z53A-1c7tA: undetectable 4z53B-1c7tA: undetectable	4z53A-1c7tA: 22.48 4z53B-1c7tA: 22.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.80A	5bs8A-1c7tA: 0.0 5bs8C-1c7tA: 0.0 5bs8D-1c7tA: undetectable	5bs8A-1c7tA: 21.29 5bs8C-1c7tA: 21.29 5bs8D-1c7tA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.81A	5bs8A-1c7tA: undetectable 5bs8B-1c7tA: undetectable 5bs8C-1c7tA: 0.0	5bs8A-1c7tA: 21.29 5bs8B-1c7tA: 15.47 5bs8C-1c7tA: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.83A	5btaA-1c7tA: 0.0 5btaC-1c7tA: 0.0 5btaD-1c7tA: undetectable	5btaA-1c7tA: 21.46 5btaC-1c7tA: 21.46 5btaD-1c7tA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.81A	5btdA-1c7tA: 0.0 5btdB-1c7tA: 0.0 5btdC-1c7tA: 0.0	5btdA-1c7tA: 21.29 5btdB-1c7tA: 15.47 5btdC-1c7tA: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.79A	5btdA-1c7tA: 0.0 5btdC-1c7tA: 0.0 5btdD-1c7tA: undetectable	5btdA-1c7tA: 21.29 5btdC-1c7tA: 21.29 5btdD-1c7tA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.81A	5btfA-1c7tA: 0.0 5btfB-1c7tA: undetectable 5btfC-1c7tA: 0.0	5btfA-1c7tA: 21.46 5btfB-1c7tA: 15.47 5btfC-1c7tA: 21.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.75A	5btfA-1c7tA: 0.0 5btfC-1c7tA: 0.0 5btfD-1c7tA: undetectable	5btfA-1c7tA: 21.46 5btfC-1c7tA: 21.46 5btfD-1c7tA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 7	ASP A 346 ARG A 349 GLY A 381 GLU A 380	None CBS A1001 (-3.0A) None None	0.90A	5btgA-1c7tA: undetectable 5btgC-1c7tA: 0.0 5btgD-1c7tA: undetectable	5btgA-1c7tA: 21.29 5btgC-1c7tA: 21.29 5btgD-1c7tA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C6P_A_4YHA601_1 (PROTEIN C)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ALA A 157 SER A 154 GLN A 34 SER A 36	None	1.19A	5c6pA-1c7tA: 0.0	5c6pA-1c7tA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DV4_A_NMYA601_2 (CCR4-NOT TRANSCRIPTION COMPLEX SUBUNIT 6-LIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	GLU A 769 TRP A 726 ASN A 706	None	1.15A	5dv4A-1c7tA: 1.3	5dv4A-1c7tA: 18.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSD_A_1GNA607_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.84A	5jsdA-1c7tA: 1.6	5jsdA-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSD_B_1GNB618_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.85A	5jsdB-1c7tA: 0.9	5jsdB-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSD_C_1GNC608_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.84A	5jsdC-1c7tA: 0.8	5jsdC-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSE_A_1GNA608_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.84A	5jseA-1c7tA: 1.6	5jseA-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSE_B_1GNB611_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.83A	5jseB-1c7tA: 1.2	5jseB-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JSE_C_1GNC611_1 (PHIAB6 TAILSPIKE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	3 / 3	THR A 846 SER A 845 TYR A 844	None	0.83A	5jseC-1c7tA: 1.2	5jseC-1c7tA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LRB_A_ACRA1003_1 (ALPHA-1,4 GLUCAN PHOSPHORYLASE)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	GLU A 380 THR A 740 TYR A 413 PHE A 496	None	1.23A	5lrbA-1c7tA: 1.5	5lrbA-1c7tA: 22.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5PHH_A_LDPA414_1 (LYSINE-SPECIFIC DEMETHYLASE 4D)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	GLU A 806 ALA A 808 LEU A 807 SER A 321	None	1.03A	5phhA-1c7tA: 0.0	5phhA-1c7tA: 17.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VLM_C_CVIC301_0 (REGULATORY PROTEIN TETR)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	ALA A 816 GLU A 692 LEU A 819 ARG A 881 ASP A 691	None	1.40A	5vlmC-1c7tA: 0.0	5vlmC-1c7tA: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B0I_B_TA1B502_1 (TUBULIN BETA CHAIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	5 / 12	LEU A 291 ASP A 331 LEU A 330 ALA A 328 LEU A 233	None	1.09A	6b0iB-1c7tA: undetectable	6b0iB-1c7tA: 7.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FK2_A_SORA302_0 (GALECTIN-3)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	ARG A 198 GLU A 675 GLU A 883 ARG A 881	None	1.02A	6fk2A-1c7tA: undetectable	6fk2A-1c7tA: 9.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FK2_A_SORA302_0 (GALECTIN-3)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	ARG A 881 GLU A 883 GLU A 675 ARG A 198	None	1.00A	6fk2A-1c7tA: undetectable	6fk2A-1c7tA: 9.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN5_A_LLLA301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ASP A 346 TYR A 413 GLU A 380 ASP A 379	None	1.41A	6mn5A-1c7tA: 0.0	6mn5A-1c7tA: 6.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN5_C_LLLC301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 6	ASP A 346 TYR A 413 GLU A 380 ASP A 379	None	1.40A	6mn5C-1c7tA: 0.0	6mn5C-1c7tA: 6.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN8_A_GLYA607_0 (UNCHARACTERIZED PROTEIN)	1c7t	BETA-N-ACETYLHEXOSAM INIDASE (Serratia marcescens)	4 / 4	GLU A 446 ASP A 346 ARG A 349 TRP A 737	None None CBS A1001 (-3.0A) CBS A1001 (-3.8A)	1.01A	6mn8A-1c7tA: 0.2	6mn8A-1c7tA: 19.19

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1CMA_B_SAMB105_0","PROTEIN (MET REPRESSOR)","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 454;LEU A 409;GLU A 405;HIS A 401;GLY A 416","SO4 A2001 (-3.8A);None;None;None;None","1.18A","1cmaA-1c7tA:undetectable;1cmaB-1c7tA:undetectable","1cmaA-1c7tA:8.93;1cmaB-1c7tA:8.93"],["1FM6_D_BRLD503_1","PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 682;SER A 738;HIS A 352;LEU A 170;LEU A 736","None","1.11A","1fm6D-1c7tA:undetectable","1fm6D-1c7tA:16.06"],["1HRK_A_CHDA1503_0","FERROCHELATASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 410;PRO A 411;LEU A 112","None","0.49A","1hrkA-1c7tA:undetectable","1hrkA-1c7tA:17.87"],["1I7Z_C_COCC302_2","CHIMERA OF IG KAPPA CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION;CHIMERA OF IG GAMMA-1 CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 692;TYR A 674;PRO A 673;ASP A 691","None","1.49A","1i7zD-1c7tA:1.5","1i7zD-1c7tA:13.47"],["1MJL_B_SAMB400_0","METHIONINE REPRESSOR PROTEIN METJ","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 454;LEU A 409;GLU A 405;HIS A 401;GLY A 416","SO4 A2001 (-3.8A);None;None;None;None","1.20A","1mjlA-1c7tA:undetectable;1mjlB-1c7tA:undetectable","1mjlA-1c7tA:8.93;1mjlB-1c7tA:8.93"],["1MJQ_A_SAMA200_0","METHIONINE REPRESSOR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 454;LEU A 409;GLU A 405;HIS A 401;GLY A 416","SO4 A2001 (-3.8A);None;None;None;None","1.19A","1mjqA-1c7tA:undetectable;1mjqB-1c7tA:undetectable","1mjqA-1c7tA:8.93;1mjqB-1c7tA:8.93"],["1MJQ_C_SAMC199_0","METHIONINE REPRESSOR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 454;LEU A 409;GLU A 405;HIS A 401;GLY A 416","SO4 A2001 (-3.8A);None;None;None;None","1.22A","1mjqC-1c7tA:undetectable;1mjqD-1c7tA:undetectable","1mjqC-1c7tA:8.93;1mjqD-1c7tA:8.93"],["1MJQ_I_SAMI199_0","METHIONINE REPRESSOR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 454;LEU A 409;GLU A 405;HIS A 401;GLY A 416","SO4 A2001 (-3.8A);None;None;None;None","1.23A","1mjqI-1c7tA:undetectable;1mjqJ-1c7tA:undetectable","1mjqI-1c7tA:8.93;1mjqJ-1c7tA:8.93"],["1N2X_B_SAMB402_0","S-ADENOSYL-METHYLTRANSFERASE MRAW","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 302;GLY A 307;GLY A 287;ASP A 273;GLY A 277","None","0.93A","1n2xB-1c7tA:undetectable","1n2xB-1c7tA:15.71"],["1NW3_A_SAMA500_0","HISTONE METHYLTRANSFERASE DOT1L","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"TYR A 501;ASP A 618;GLY A 538;ALA A 453;PHE A 536","None","1.29A","1nw3A-1c7tA:undetectable","1nw3A-1c7tA:18.82"],["1PJ7_A_FFOA2887_1","N,N-DIMETHYLGLYCINE OXIDASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"ASP A 111;THR A 109;GLU A 405","None;SO4 A2001 (-3.4A);None","0.80A","1pj7A-1c7tA:0.7","1pj7A-1c7tA:22.38"],["1ZZQ_B_ACTB861_0","NITRIC-OXIDE SYNTHASE, BRAIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLY A 598;GLN A 599;VAL A 634;SER A 602","None","1.26A","1zzqB-1c7tA:undetectable","1zzqB-1c7tA:17.96"],["1ZZU_A_ACTA860_0","NITRIC-OXIDE SYNTHASE, BRAIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLY A 598;GLN A 599;VAL A 634;SER A 602","None","1.22A","1zzuA-1c7tA:0.1","1zzuA-1c7tA:17.96"],["2AVV_E_MK1E902_2","POL POLYPROTEIN;POL POLYPROTEIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"ASP A 346;ILE A 447;VAL A 443","None","0.71A","2avvD-1c7tA:0.0","2avvD-1c7tA:8.69"],["2COI_A_GBNA420_1","BRANCHED CHAIN AMINOTRANSFERASE 1, CYTOSOLIC;BRANCHED CHAIN AMINOTRANSFERASE 1, CYTOSOLIC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ARG A 612;GLY A 537;ALA A 615;TYR A 340;VAL A 661","None","1.49A","2coiA-1c7tA:undetectable;2coiB-1c7tA:undetectable","2coiA-1c7tA:17.54;2coiB-1c7tA:17.54"],["2EJF_B_ADNB2002_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ARG A 870;GLU A 883;PRO A 195;ALA A 824","None","1.44A","2ejfB-1c7tA:undetectable","2ejfB-1c7tA:14.76"],["2FL5_F_RBFF204_1","IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN;IMMUNOGLOBULIN IGG1 HEAVY CHAIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASN A 503;ARG A 480;GLU A 461;VAL A 577","None","1.09A","2fl5E-1c7tA:2.2;2fl5F-1c7tA:2.2","2fl5E-1c7tA:12.94;2fl5F-1c7tA:13.34"],["2HRC_A_CHDA703_0","FERROCHELATASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"LEU A 810;PRO A 753;LEU A 807;ARG A 805","None","1.41A","2hrcA-1c7tA:0.3","2hrcA-1c7tA:17.87"],["2ITZ_A_IREA2021_2","EPIDERMAL GROWTH FACTOR RECEPTOR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A  96;LEU A  45;MET A  44","None","0.76A","2itzA-1c7tA:undetectable","2itzA-1c7tA:16.83"],["2PO5_B_CHDB503_0","FERROCHELATASE, MITOCHONDRIAL","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 410;PRO A 411;LEU A 112","None","0.52A","2po5B-1c7tA:undetectable","2po5B-1c7tA:17.88"],["2PO7_B_CHDB503_0","FERROCHELATASE, MITOCHONDRIAL","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 410;PRO A 411;LEU A 112","None","0.57A","2po7B-1c7tA:undetectable","2po7B-1c7tA:17.76"],["2ZGW_B_ADNB1302_1","BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 883;ALA A 833;PRO A 195;ALA A 824","None","1.20A","2zgwB-1c7tA:undetectable","2zgwB-1c7tA:14.76"],["2ZIA_A_CL9A401_2","DEOXYCYTIDINE KINASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"VAL A 218;ASP A 794;LEU A 205;ARG A 805","None","1.48A","2ziaA-1c7tA:undetectable","2ziaA-1c7tA:15.44"],["2ZZN_B_SAMB402_0","UNCHARACTERIZED PROTEIN MJ0883","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"PHE A 597;LEU A 593;GLY A 538;PRO A 450;ASP A 640","None","1.33A","2zznB-1c7tA:undetectable","2zznB-1c7tA:17.74"],["3APX_A_Z80A190_1","ALPHA-1-ACID GLYCOPROTEIN 2","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"PHE A 698;GLU A 769;LEU A 732;ARG A 337;ALA A 729","None","1.30A","3apxA-1c7tA:0.0","3apxA-1c7tA:11.21"],["3C0Z_A_SHHA301_1","HISTONE DEACETYLASE 7A","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"HIS A 375;ASP A 448;HIS A 452;ASP A 539","None;None;CBS A1001 (-4.2A);CBS A1001 (-3.9A)","1.21A","3c0zA-1c7tA:undetectable","3c0zA-1c7tA:19.61"],["3DZY_D_BRLD478_2","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ILE A 441;GLN A 363;ILE A 432;LEU A 756","None","1.33A","3dzyD-1c7tA:0.0","3dzyD-1c7tA:17.93"],["3EKX_B_1UNB201_1","PROTEASE;PROTEASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 537;ALA A 615;VAL A 634;GLY A 598;THR A 631","None","0.95A","3ekxA-1c7tA:undetectable","3ekxA-1c7tA:8.56"],["3KU9_B_SPMB700_1","POLYAMINE OXIDASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 739;TYR A 669;PHE A 672;TYR A 683","CBS A1001 (-2.7A);CBS A1001 (-4.4A);CBS A1001 (-4.7A);CBS A1001 (-4.1A)","1.32A","3ku9B-1c7tA:undetectable","3ku9B-1c7tA:20.67"],["3L2V_A_RLTA397_1","INTEGRASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 448;ASP A 539;GLN A 614;GLU A 446","None;CBS A1001 (-3.9A);None;None","1.16A","3l2vA-1c7tA:undetectable","3l2vA-1c7tA:18.34"],["3LMY_A_CP6A562_1","BETA-HEXOSAMINIDASE SUBUNIT BETA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",8,"ARG A 349;ASP A 378;HIS A 452;ASP A 540;TYR A 669;ASP A 671;TRP A 737;GLU A 739","CBS A1001 (-3.0A);CBS A1001 ( 4.8A);CBS A1001 (-4.2A);CBS A1001 ( 4.3A);CBS A1001 (-4.4A);CBS A1001 (-3.1A);CBS A1001 (-3.8A);CBS A1001 (-2.7A)","1.22A","3lmyA-1c7tA:36.1","3lmyA-1c7tA:21.71"],["3LMY_A_CP6A562_1","BETA-HEXOSAMINIDASE SUBUNIT BETA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",11,"ARG A 349;HIS A 375;ASP A 378;ASP A 448;HIS A 452;ASP A 539;TRP A 639;TYR A 669;ASP A 671;TRP A 737;GLU A 739","CBS A1001 (-3.0A);None;CBS A1001 ( 4.8A);None;CBS A1001 (-4.2A);CBS A1001 (-3.9A);CBS A1001 (-3.5A);CBS A1001 (-4.4A);CBS A1001 (-3.1A);CBS A1001 (-3.8A);CBS A1001 (-2.7A)","0.44A","3lmyA-1c7tA:36.1","3lmyA-1c7tA:21.71"],["3LMY_B_CP6B563_1","BETA-HEXOSAMINIDASE SUBUNIT BETA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",7,"ARG A 349;ASP A 378;HIS A 452;ASP A 540;TYR A 669;TRP A 737;GLU A 739","CBS A1001 (-3.0A);CBS A1001 ( 4.8A);CBS A1001 (-4.2A);CBS A1001 ( 4.3A);CBS A1001 (-4.4A);CBS A1001 (-3.8A);CBS A1001 (-2.7A)","1.28A","3lmyB-1c7tA:36.1","3lmyB-1c7tA:21.71"],["3LMY_B_CP6B563_1","BETA-HEXOSAMINIDASE SUBUNIT BETA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",11,"ARG A 349;HIS A 375;ASP A 378;ASP A 448;HIS A 452;ASP A 539;TRP A 616;TRP A 639;TYR A 669;TRP A 737;GLU A 739","CBS A1001 (-3.0A);None;CBS A1001 ( 4.8A);None;CBS A1001 (-4.2A);CBS A1001 (-3.9A);CBS A1001 (-3.6A);CBS A1001 (-3.5A);CBS A1001 (-4.4A);CBS A1001 (-3.8A);CBS A1001 (-2.7A)","0.44A","3lmyB-1c7tA:36.1","3lmyB-1c7tA:21.71"],["3LMY_B_CP6B563_1","BETA-HEXOSAMINIDASE SUBUNIT BETA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"HIS A 375;ASP A 378;GLU A 739;TYR A 669;TRP A 737","None;CBS A1001 ( 4.8A);CBS A1001 (-2.7A);CBS A1001 (-4.4A);CBS A1001 (-3.8A)","1.34A","3lmyB-1c7tA:36.1","3lmyB-1c7tA:21.71"],["3MTE_B_SAMB220_0","16S RRNA METHYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 325;GLY A 323;ALA A 231;LEU A 259;LEU A 233","None","1.03A","3mteB-1c7tA:undetectable","3mteB-1c7tA:14.12"],["3N23_C_OBNC1_1","SODIUM\/POTASSIUM-TRANSPORTING ATPASE SUBUNIT ALPHA-1","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLN A 229;ASP A 232;LEU A 233;VAL A 237;ALA A 238","None","1.37A","3n23C-1c7tA:0.1","3n23C-1c7tA:22.63"],["3N2O_C_AG2C1002_1","BIOSYNTHETIC ARGININE DECARBOXYLASE;BIOSYNTHETIC ARGININE DECARBOXYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"SER A 697;ASP A 204;LEU A 205;ASP A 691","None","1.24A","3n2oC-1c7tA:7.6;3n2oD-1c7tA:6.2","3n2oC-1c7tA:22.90;3n2oD-1c7tA:22.90"],["3NVC_A_SALA370_1","GENTISATE 1,2-DIOXYGENASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLN A 494;ARG A 349;HIS A 375;ASP A 379","CBS A1001 ( 4.2A);CBS A1001 (-3.0A);None;None","0.92A","3nvcA-1c7tA:undetectable","3nvcA-1c7tA:19.37"],["3P2K_A_SAMA6735_0","16S RRNA METHYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 325;GLY A 323;ALA A 231;LEU A 259;LEU A 233","None","1.04A","3p2kA-1c7tA:undetectable","3p2kA-1c7tA:14.02"],["3P2K_B_SAMB6735_0","16S RRNA METHYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 325;GLY A 323;ALA A 231;LEU A 259;LEU A 233","None","1.07A","3p2kB-1c7tA:undetectable","3p2kB-1c7tA:14.02"],["3P2K_C_SAMC6735_0","16S RRNA METHYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 325;GLY A 323;ALA A 231;LEU A 259;LEU A 233","None","1.04A","3p2kC-1c7tA:undetectable","3p2kC-1c7tA:14.02"],["3P2K_D_SAMD6735_0","16S RRNA METHYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"GLY A 325;GLY A 323;ALA A 231;LEU A 259;LEU A 233","None","1.03A","3p2kD-1c7tA:undetectable","3p2kD-1c7tA:14.02"],["3R55_A_PZAA598_0","LACTOPEROXIDASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"GLU A 290;PHE A 279;GLN A 275","None","0.89A","3r55A-1c7tA:0.0","3r55A-1c7tA:22.34"],["3S3O_A_DLUA399_1","PFV INTEGRASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 448;ASP A 539;GLN A 614;GLU A 446","None;CBS A1001 (-3.9A);None;None","1.15A","3s3oA-1c7tA:undetectable","3s3oA-1c7tA:18.34"],["3UY4_A_PAUA302_0","PANTOTHENATE SYNTHETASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"VAL A 636;VAL A 661;ASP A 618;GLN A 617","None","1.03A","3uy4A-1c7tA:2.6","3uy4A-1c7tA:17.63"],["3W1W_B_CHDB503_0","FERROCHELATASE, MITOCHONDRIAL","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 410;PRO A 411;LEU A 112","None","0.48A","3w1wB-1c7tA:undetectable","3w1wB-1c7tA:17.90"],["3ZOA_A_ACRA1587_2","TREHALOSE SYNTHASE\/AMYLASE TRES;TREHALOSE SYNTHASE\/AMYLASE TRES","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"ARG A 337;PHE A 338;PRO A 339","None","0.81A","3zoaB-1c7tA:10.2","3zoaB-1c7tA:21.44"],["4A97_A_ZPCA1318_1","CYS-LOOP LIGAND-GATED ION CHANNEL","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 380;GLU A 739;HIS A 373;VAL A 357","None;CBS A1001 (-2.7A);None;None","1.01A","4a97A-1c7tA:3.1","4a97A-1c7tA:16.61"],["4EYS_A_ACTA402_0","MCCC FAMILY PROTEIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 648;SER A 722;ASP A 723;GLU A 777","None","1.14A","4eysA-1c7tA:undetectable","4eysA-1c7tA:16.82"],["4J7X_B_SASB804_1","SEPIAPTERIN REDUCTASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"PHE A 798;TRP A 795;PRO A 753;GLY A 803;LEU A 837","None","1.11A","4j7xB-1c7tA:2.0","4j7xB-1c7tA:16.95"],["4JQ4_A_IMNA401_1","ALDO-KETO REDUCTASE FAMILY 1 MEMBER C2","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"VAL A 237;TYR A 268;VAL A 263;LEU A 318;LEU A 316","None","1.38A","4jq4A-1c7tA:11.2","4jq4A-1c7tA:17.85"],["4KLR_B_CHDB504_0","FERROCHELATASE, MITOCHONDRIAL","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 819;PRO A 820;ARG A 854","None","0.61A","4klrB-1c7tA:undetectable","4klrB-1c7tA:17.22"],["4KOE_F_TR6F101_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B;E-SITE DNA2","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"SER A 500;GLY A 619;ASP A 618;GLY A 537","None","0.88A","4koeA-1c7tA:0.0;4koeB-1c7tA:0.0;4koeC-1c7tA:undetectable","4koeA-1c7tA:20.55;4koeB-1c7tA:20.55;4koeC-1c7tA:16.00"],["4KOE_H_TR6H101_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B;E-SITE DNA4","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"SER A 500;GLY A 619;ASP A 618;GLY A 537","None","0.84A","4koeA-1c7tA:undetectable;4koeB-1c7tA:undetectable;4koeD-1c7tA:undetectable","4koeA-1c7tA:20.55;4koeB-1c7tA:20.55;4koeD-1c7tA:16.00"],["4MI4_A_SPMA201_1","SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.27A","4mi4A-1c7tA:undetectable","4mi4A-1c7tA:11.32"],["4MI4_B_SPMB201_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.27A","4mi4B-1c7tA:undetectable;4mi4C-1c7tA:0.0","4mi4B-1c7tA:11.32;4mi4C-1c7tA:11.32"],["4MI4_B_SPMB201_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;TYR A 778;GLU A 777;ARG A 776","None","1.36A","4mi4B-1c7tA:undetectable;4mi4C-1c7tA:0.0","4mi4B-1c7tA:11.32;4mi4C-1c7tA:11.32"],["4MI4_C_SPMC201_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.27A","4mi4A-1c7tA:undetectable;4mi4C-1c7tA:0.0","4mi4A-1c7tA:11.32;4mi4C-1c7tA:11.32"],["4MJ8_A_SPMA201_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.27A","4mj8A-1c7tA:0.1;4mj8C-1c7tA:undetectable","4mj8A-1c7tA:11.10;4mj8C-1c7tA:11.10"],["4MJ8_B_SPMB201_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.26A","4mj8B-1c7tA:undetectable;4mj8C-1c7tA:0.0","4mj8B-1c7tA:11.10;4mj8C-1c7tA:11.10"],["4MJ8_C_SPMC201_1","SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.43A","4mj8C-1c7tA:0.0","4mj8C-1c7tA:11.10"],["4ODO_B_FK5B203_2","PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD;PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"ALA A 196;GLN A 868;GLY A 848","None","0.63A","4odoC-1c7tA:0.0","4odoC-1c7tA:10.49"],["4P6X_G_HCYG900_2","GLUCOCORTICOID RECEPTOR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"LEU A 506;MET A 460;TYR A 501","None","0.87A","4p6xG-1c7tA:undetectable","4p6xG-1c7tA:14.48"],["4QA0_B_SHHB404_2","HISTONE DEACETYLASE 8","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"TYR A 683;HIS A 373;HIS A 375;ASP A 448;GLY A 537","CBS A1001 (-4.1A);None;None;None;None","1.46A","4qa0B-1c7tA:undetectable","4qa0B-1c7tA:16.77"],["4R87_E_SPME202_1","SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.13A","4r87E-1c7tA:0.0","4r87E-1c7tA:11.10"],["4R87_G_SPMG202_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.32A","4r87E-1c7tA:0.0;4r87G-1c7tA:0.0","4r87E-1c7tA:11.10;4r87G-1c7tA:11.10"],["4R87_H_SPMH202_1","SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASN A 719;GLU A 782;TYR A 778;GLU A 777","None","1.01A","4r87H-1c7tA:0.0","4r87H-1c7tA:11.10"],["4R87_I_SPMI202_1","SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.30A","4r87I-1c7tA:0.0","4r87I-1c7tA:11.10"],["4R87_K_SPMK202_1","SPERMIDINE N1-ACETYLTRANSFERASE;SPERMIDINE N1-ACETYLTRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ASN A 719;GLU A 782;GLU A 708;TYR A 778;GLU A 777","None","1.21A","4r87I-1c7tA:0.0;4r87K-1c7tA:0.0","4r87I-1c7tA:11.10;4r87K-1c7tA:11.10"],["4XDT_A_ACTA406_0","FAD:PROTEIN FMN TRANSFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"SER A 697;LYS A 694;ARG A 693;LEU A 791","None","1.16A","4xdtA-1c7tA:0.0","4xdtA-1c7tA:17.02"],["4XP9_C_1WEC706_1","TRANSPORTER","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"PHE A 423;ASP A 428;GLY A 422;SER A 425","None","1.30A","4xp9C-1c7tA:0.0","4xp9C-1c7tA:21.73"],["4YMG_B_SAMB1001_1","PUTATIVE SAM-DEPENDENT O-METHYLTRANFERASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"SER A 488;GLU A 461;GLU A 473","None","0.74A","4ymgB-1c7tA:0.7","4ymgB-1c7tA:14.59"],["4YV5_A_SVRA205_2","BASIC PHOSPHOLIPASE A2 HOMOLOG 2;BASIC PHOSPHOLIPASE A2 HOMOLOG 2","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"LEU A 205;ASN A 800;PRO A 838;ARG A 825","None","1.37A","4yv5B-1c7tA:0.0","4yv5B-1c7tA:8.71"],["4YV5_B_SVRB207_1","BASIC PHOSPHOLIPASE A2 HOMOLOG 2;BASIC PHOSPHOLIPASE A2 HOMOLOG 2","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"LEU A 205;ASN A 800;PRO A 838;ARG A 825","None","1.36A","4yv5A-1c7tA:0.0","4yv5A-1c7tA:8.71"],["4Z53_F_TR6F101_1","DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A;E-SITE DNA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLY A 619;ASP A 618;GLY A 537;SER A 500","None","0.90A","4z53A-1c7tA:undetectable;4z53B-1c7tA:undetectable","4z53A-1c7tA:22.48;4z53B-1c7tA:22.48"],["4Z53_H_TR6H101_1","DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A;E-SITE DNA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLY A 619;ASP A 618;GLY A 537;SER A 500","None","0.84A","4z53A-1c7tA:undetectable;4z53B-1c7tA:undetectable","4z53A-1c7tA:22.48;4z53B-1c7tA:22.48"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.80A","5bs8A-1c7tA:0.0;5bs8C-1c7tA:0.0;5bs8D-1c7tA:undetectable","5bs8A-1c7tA:21.29;5bs8C-1c7tA:21.29;5bs8D-1c7tA:15.47"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.81A","5bs8A-1c7tA:undetectable;5bs8B-1c7tA:undetectable;5bs8C-1c7tA:0.0","5bs8A-1c7tA:21.29;5bs8B-1c7tA:15.47;5bs8C-1c7tA:21.29"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.83A","5btaA-1c7tA:0.0;5btaC-1c7tA:0.0;5btaD-1c7tA:undetectable","5btaA-1c7tA:21.46;5btaC-1c7tA:21.46;5btaD-1c7tA:15.47"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.81A","5btdA-1c7tA:0.0;5btdB-1c7tA:0.0;5btdC-1c7tA:0.0","5btdA-1c7tA:21.29;5btdB-1c7tA:15.47;5btdC-1c7tA:21.29"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.79A","5btdA-1c7tA:0.0;5btdC-1c7tA:0.0;5btdD-1c7tA:undetectable","5btdA-1c7tA:21.29;5btdC-1c7tA:21.29;5btdD-1c7tA:15.47"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.81A","5btfA-1c7tA:0.0;5btfB-1c7tA:undetectable;5btfC-1c7tA:0.0","5btfA-1c7tA:21.46;5btfB-1c7tA:15.47;5btfC-1c7tA:21.46"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.75A","5btfA-1c7tA:0.0;5btfC-1c7tA:0.0;5btfD-1c7tA:undetectable","5btfA-1c7tA:21.46;5btfC-1c7tA:21.46;5btfD-1c7tA:15.47"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;ARG A 349;GLY A 381;GLU A 380","None;CBS A1001 (-3.0A);None;None","0.90A","5btgA-1c7tA:undetectable;5btgC-1c7tA:0.0;5btgD-1c7tA:undetectable","5btgA-1c7tA:21.29;5btgC-1c7tA:21.29;5btgD-1c7tA:15.47"],["5C6P_A_4YHA601_1","PROTEIN C","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ALA A 157;SER A 154;GLN A  34;SER A  36","None","1.19A","5c6pA-1c7tA:0.0","5c6pA-1c7tA:21.93"],["5DV4_A_NMYA601_2","CCR4-NOT TRANSCRIPTION COMPLEX SUBUNIT 6-LIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"GLU A 769;TRP A 726;ASN A 706","None","1.15A","5dv4A-1c7tA:1.3","5dv4A-1c7tA:18.31"],["5JSD_A_1GNA607_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.84A","5jsdA-1c7tA:1.6","5jsdA-1c7tA:21.31"],["5JSD_B_1GNB618_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.85A","5jsdB-1c7tA:0.9","5jsdB-1c7tA:21.31"],["5JSD_C_1GNC608_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.84A","5jsdC-1c7tA:0.8","5jsdC-1c7tA:21.31"],["5JSE_A_1GNA608_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.84A","5jseA-1c7tA:1.6","5jseA-1c7tA:21.31"],["5JSE_B_1GNB611_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.83A","5jseB-1c7tA:1.2","5jseB-1c7tA:21.31"],["5JSE_C_1GNC611_1","PHIAB6 TAILSPIKE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",3,"THR A 846;SER A 845;TYR A 844","None","0.83A","5jseC-1c7tA:1.2","5jseC-1c7tA:21.31"],["5LRB_A_ACRA1003_1","ALPHA-1,4 GLUCAN PHOSPHORYLASE","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 380;THR A 740;TYR A 413;PHE A 496","None","1.23A","5lrbA-1c7tA:1.5","5lrbA-1c7tA:22.73"],["5PHH_A_LDPA414_1","LYSINE-SPECIFIC DEMETHYLASE 4D","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 806;ALA A 808;LEU A 807;SER A 321","None","1.03A","5phhA-1c7tA:0.0","5phhA-1c7tA:17.36"],["5VLM_C_CVIC301_0","REGULATORY PROTEIN TETR","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"ALA A 816;GLU A 692;LEU A 819;ARG A 881;ASP A 691","None","1.40A","5vlmC-1c7tA:0.0","5vlmC-1c7tA:12.80"],["6B0I_B_TA1B502_1","TUBULIN BETA CHAIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",5,"LEU A 291;ASP A 331;LEU A 330;ALA A 328;LEU A 233","None","1.09A","6b0iB-1c7tA:undetectable","6b0iB-1c7tA:7.10"],["6FK2_A_SORA302_0","GALECTIN-3","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ARG A 198;GLU A 675;GLU A 883;ARG A 881","None","1.02A","6fk2A-1c7tA:undetectable","6fk2A-1c7tA:9.47"],["6FK2_A_SORA302_0","GALECTIN-3","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ARG A 881;GLU A 883;GLU A 675;ARG A 198","None","1.00A","6fk2A-1c7tA:undetectable","6fk2A-1c7tA:9.47"],["6MN5_A_LLLA301_0","AMINOGLYCOSIDE N(3)-ACETYLTRANSFERASE, AAC(3)-IVA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;TYR A 413;GLU A 380;ASP A 379","None","1.41A","6mn5A-1c7tA:0.0","6mn5A-1c7tA:6.45"],["6MN5_C_LLLC301_0","AMINOGLYCOSIDE N(3)-ACETYLTRANSFERASE, AAC(3)-IVA","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"ASP A 346;TYR A 413;GLU A 380;ASP A 379","None","1.40A","6mn5C-1c7tA:0.0","6mn5C-1c7tA:6.45"],["6MN8_A_GLYA607_0","UNCHARACTERIZED PROTEIN","1c7t","BETA-N-ACETYLHEXOSAMINIDASE","Serratia marcescens",4,"GLU A 446;ASP A 346;ARG A 349;TRP A 737","None;None;CBS A1001 (-3.0A);CBS A1001 (-3.8A)","1.01A","6mn8A-1c7tA:0.2","6mn8A-1c7tA:19.19"]]