SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '1ocm'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1K6C_B_MK1B902_2 (POL POLYPROTEIN)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	6 / 12	GLY A 142 ALA A 141 GLY A 164 PRO A 128 THR A 118 VAL A 36	None	1.18A	1k6cB-1ocmA: undetectable	1k6cB-1ocmA: 15.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KIA_A_SAMA293_0 (GLYCINE N-METHYLTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ILE A 168 GLY A 203 ALA A 99 MET A 207 GLY A 194	None	1.07A	1kiaA-1ocmA: undetectable	1kiaA-1ocmA: 21.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KIA_B_SAMB1293_0 (GLYCINE N-METHYLTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ILE A 168 GLY A 203 ALA A 99 MET A 207 GLY A 194	None	1.06A	1kiaB-1ocmA: undetectable	1kiaB-1ocmA: 21.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KIA_C_SAMC2293_0 (GLYCINE N-METHYLTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ILE A 168 GLY A 203 ALA A 99 MET A 207 GLY A 194	None	1.07A	1kiaC-1ocmA: undetectable	1kiaC-1ocmA: 21.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NBH_B_SAMB1293_0 (GLYCINE N-METHYLTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ILE A 168 GLY A 203 ALA A 99 MET A 207 GLY A 194	None	1.04A	1nbhB-1ocmA: undetectable	1nbhB-1ocmA: 21.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_D_BEZD507_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 7	ALA A 38 ILE A 144 ILE A 29 GLU A 33	None	0.91A	1oniD-1ocmA: 0.0 1oniF-1ocmA: undetectable	1oniD-1ocmA: 16.63 1oniF-1ocmA: 16.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PK9_C_2FAC308_1 (PURINE NUCLEOSIDE PHOSPHORYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 155 GLY A 149 VAL A 190 SER A 132 ILE A 65	POP A1155 (-1.5A) None None None None	1.10A	1pk9C-1ocmA: undetectable	1pk9C-1ocmA: 22.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RV7_B_AB1B1001_1 (PROTEASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	ALA A 147 ILE A 168 PRO A 159 LEU A 94 VAL A 90	None	1.06A	1rv7A-1ocmA: 0.0 1rv7B-1ocmA: 0.0	1rv7A-1ocmA: 13.79 1rv7B-1ocmA: 13.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BTE_D_LEUD1893_0 (AMINOACYL-TRNA SYNTHETASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 8	ASP A 188 SER A 184 TYR A 183 HIS A 273	None	1.34A	2bteD-1ocmA: undetectable	2bteD-1ocmA: 19.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F16_H_BO2H1400_1 (PROTEASOME COMPONENT PUP1 PROTEASOME COMPONENT PUP3)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 25 ALA A 28 ALA A 48 GLY A 56 ALA A 58	None	1.11A	2f16H-1ocmA: undetectable 2f16I-1ocmA: undetectable	2f16H-1ocmA: 18.81 2f16I-1ocmA: 17.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F16_V_BO2V1401_1 (PROTEASOME COMPONENT PUP1 PROTEASOME COMPONENT PUP3)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 25 ALA A 28 ALA A 48 GLY A 56 ALA A 58	None	1.11A	2f16V-1ocmA: undetectable 2f16W-1ocmA: undetectable	2f16V-1ocmA: 18.81 2f16W-1ocmA: 17.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FJ1_A_CTCA222_0 (TETRACYCLINE REPRESSOR PROTEIN CLASS D)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	HIS A 42 PHE A 39 PRO A 145 LEU A 94 ILE A 101	None	1.39A	2fj1A-1ocmA: undetectable	2fj1A-1ocmA: 21.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2JB7_B_ACTB1169_0 (HYPOTHETICAL PROTEIN PAE2307)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	ARG A 319 ARG A 323 ARG A 320	None	1.18A	2jb7A-1ocmA: undetectable 2jb7B-1ocmA: undetectable 2jb7C-1ocmA: undetectable	2jb7A-1ocmA: 18.50 2jb7B-1ocmA: 18.50 2jb7C-1ocmA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2JB7_B_ACTB1169_0 (HYPOTHETICAL PROTEIN PAE2307)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	ARG A 320 ARG A 319 ARG A 323	None	1.21A	2jb7A-1ocmA: undetectable 2jb7B-1ocmA: undetectable 2jb7C-1ocmA: undetectable	2jb7A-1ocmA: 18.50 2jb7B-1ocmA: 18.50 2jb7C-1ocmA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2JB7_B_ACTB1169_0 (HYPOTHETICAL PROTEIN PAE2307)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	ARG A 323 ARG A 320 ARG A 319	None	1.14A	2jb7A-1ocmA: undetectable 2jb7B-1ocmA: undetectable 2jb7C-1ocmA: undetectable	2jb7A-1ocmA: 18.50 2jb7B-1ocmA: 18.50 2jb7C-1ocmA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VE3_A_REAA1445_1 (PUTATIVE CYTOCHROME P450 120)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	THR A 165 ALA A 147 ALA A 38 THR A 118 GLY A 130	None None None None POP A1155 ( 4.9A)	1.03A	2ve3A-1ocmA: 0.0	2ve3A-1ocmA: 21.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VE3_B_REAB1445_1 (PUTATIVE CYTOCHROME P450 120)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	THR A 165 ALA A 147 ALA A 38 THR A 118 GLY A 130	None None None None POP A1155 ( 4.9A)	1.01A	2ve3B-1ocmA: undetectable	2ve3B-1ocmA: 21.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VOU_A_ACTA1397_0 (2,6-DIHYDROXYPYRIDIN E HYDROXYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	PRO A 349 GLY A 357 TYR A 162	None	0.51A	2vouA-1ocmA: undetectable	2vouA-1ocmA: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VOU_B_ACTB1391_0 (2,6-DIHYDROXYPYRIDIN E HYDROXYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	PRO A 349 GLY A 357 TYR A 162	None	0.51A	2vouB-1ocmA: 0.0	2vouB-1ocmA: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VOU_C_ACTC1391_0 (2,6-DIHYDROXYPYRIDIN E HYDROXYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	PRO A 349 GLY A 357 TYR A 162	None	0.51A	2vouC-1ocmA: 0.0	2vouC-1ocmA: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2W98_B_P1ZB1359_1 (PROSTAGLANDIN REDUCTASE 2)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 6	THR A 105 MET A 70 LYS A 44 ILE A 101	None	1.35A	2w98B-1ocmA: undetectable	2w98B-1ocmA: 22.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XKW_B_P1BB1475_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	PHE A 39 HIS A 42 ALA A 48 LEU A 7 ILE A 144	None	1.27A	2xkwB-1ocmA: undetectable	2xkwB-1ocmA: 20.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ADS_A_IMNA1_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 10	GLU A 407 GLY A 194 LEU A 175 ILE A 168 MET A 207	None	1.39A	3adsA-1ocmA: undetectable	3adsA-1ocmA: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BSZ_F_RTLF178_0 (PLASMA RETINOL-BINDING PROTEIN)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	ALA A 167 PHE A 193 ALA A 136 TYR A 162 GLN A 151	None	1.30A	3bszF-1ocmA: 0.0	3bszF-1ocmA: 19.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IA4_B_MTXB164_2 (DIHYDROFOLATE REDUCTASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 4	PHE A 39 LYS A 104 ILE A 29 THR A 118	None	1.47A	3ia4B-1ocmA: undetectable	3ia4B-1ocmA: 17.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ID6_C_SAMC301_0 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	GLY A 215 PHE A 213 SER A 211 ALA A 201 ILE A 216	None	1.14A	3id6C-1ocmA: undetectable	3id6C-1ocmA: 22.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP6_A_SALA3002_1 (TRANSCRIPTIONAL REGULATOR TCAR)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 8	LEU A 146 VAL A 190 ILE A 65 VAL A 90 LEU A 94	None	1.39A	3kp6A-1ocmA: undetectable 3kp6B-1ocmA: undetectable	3kp6A-1ocmA: 15.00 3kp6B-1ocmA: 15.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP6_B_SALB3003_1 (TRANSCRIPTIONAL REGULATOR TCAR)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 6	ILE A 61 VAL A 59 LEU A 146 LEU A 192	None	0.85A	3kp6A-1ocmA: undetectable 3kp6B-1ocmA: undetectable	3kp6A-1ocmA: 15.00 3kp6B-1ocmA: 15.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KVR_A_URFA2001_1 (URIDINE PHOSPHORYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 10	GLY A 203 PHE A 213 LEU A 200 LEU A 192 ILE A 168	None	1.26A	3kvrA-1ocmA: undetectable	3kvrA-1ocmA: 22.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LW5_B_PQNB5002_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 10	ILE A 157 PHE A 213 ALA A 401 LEU A 400 ALA A 201	None	1.20A	3lw5B-1ocmA: 0.0	3lw5B-1ocmA: 20.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MG0_V_BO2V1401_1 (PROTEASOME COMPONENT PUP1 PROTEASOME COMPONENT PUP3)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 25 ALA A 28 ALA A 48 GLY A 56 ALA A 58	None	1.10A	3mg0V-1ocmA: undetectable 3mg0W-1ocmA: undetectable	3mg0V-1ocmA: 18.81 3mg0W-1ocmA: 17.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3R9V_B_DXCB1_0 (INVASIN IPAD)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 7	ILE A 57 LEU A 4 LEU A 200 VAL A 156 SER A 132	None	1.35A	3r9vA-1ocmA: undetectable 3r9vB-1ocmA: undetectable	3r9vA-1ocmA: 19.81 3r9vB-1ocmA: 19.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AWU_A_4CHA502_0 (OXIDOREDUCTASE, FMN-BINDING)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 7	THR A 165 HIS A 122 ASN A 120 PHE A 193	None	1.36A	4awuA-1ocmA: undetectable	4awuA-1ocmA: 24.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BLV_A_SAMA1281_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	LEU A 400 GLY A 194 GLY A 140 ASP A 199 GLY A 191	None	1.09A	4blvA-1ocmA: undetectable	4blvA-1ocmA: 21.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EJJ_C_NCTC501_1 (CYTOCHROME P450 2A6)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 5	PHE A 39 ILE A 102 GLY A 60 THR A 105	None	0.94A	4ejjC-1ocmA: undetectable	4ejjC-1ocmA: 21.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PB1_A_RBVA501_1 (NUPC FAMILY PROTEIN)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	GLY A 346 GLU A 236 ALA A 238 ASN A 123 ASN A 120	None	1.17A	4pb1A-1ocmA: undetectable	4pb1A-1ocmA: 23.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvmV-1ocmA: undetectable 4qvmb-1ocmA: undetectable	4qvmV-1ocmA: 19.76 4qvmb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvmH-1ocmA: undetectable 4qvmN-1ocmA: undetectable	4qvmH-1ocmA: 19.76 4qvmN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVP_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvpV-1ocmA: undetectable 4qvpb-1ocmA: undetectable	4qvpV-1ocmA: 19.76 4qvpb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVP_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	4qvpH-1ocmA: undetectable 4qvpN-1ocmA: undetectable	4qvpH-1ocmA: 19.76 4qvpN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVQ_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvqV-1ocmA: undetectable 4qvqb-1ocmA: undetectable	4qvqV-1ocmA: 19.76 4qvqb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVQ_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvqH-1ocmA: undetectable 4qvqN-1ocmA: undetectable	4qvqH-1ocmA: 19.76 4qvqN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVV_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 10	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	4qvvV-1ocmA: undetectable 4qvvb-1ocmA: undetectable	4qvvV-1ocmA: 19.76 4qvvb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVV_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 10	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qvvH-1ocmA: 0.0 4qvvN-1ocmA: undetectable	4qvvH-1ocmA: 19.76 4qvvN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVW_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	4qvwV-1ocmA: undetectable 4qvwb-1ocmA: undetectable	4qvwV-1ocmA: 19.76 4qvwb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVW_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	4qvwH-1ocmA: undetectable 4qvwN-1ocmA: undetectable	4qvwH-1ocmA: 19.76 4qvwN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.33A	4qvyV-1ocmA: 0.0 4qvyb-1ocmA: undetectable	4qvyV-1ocmA: 19.76 4qvyb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.34A	4qvyH-1ocmA: 0.0 4qvyN-1ocmA: undetectable	4qvyH-1ocmA: 19.76 4qvyN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	4qw0V-1ocmA: undetectable 4qw0b-1ocmA: undetectable	4qw0V-1ocmA: 19.76 4qw0b-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qw0H-1ocmA: undetectable 4qw0N-1ocmA: undetectable	4qw0H-1ocmA: 19.76 4qw0N-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW1_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	4qw1H-1ocmA: undetectable 4qw1N-1ocmA: undetectable	4qw1H-1ocmA: 19.76 4qw1N-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.37A	4qw3V-1ocmA: undetectable 4qw3b-1ocmA: undetectable	4qw3V-1ocmA: 19.76 4qw3b-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.37A	4qw3H-1ocmA: undetectable 4qw3N-1ocmA: undetectable	4qw3H-1ocmA: 19.76 4qw3N-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_F_377F402_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 8	ALA A 197 ALA A 201 ALA A 397 ALA A 399 ALA A 403	None	1.43A	4twdF-1ocmA: 0.0 4twdG-1ocmA: 0.0 4twdH-1ocmA: 0.0 4twdI-1ocmA: 0.0 4twdJ-1ocmA: 0.0	4twdF-1ocmA: 22.14 4twdG-1ocmA: 22.14 4twdH-1ocmA: 22.14 4twdI-1ocmA: 22.14 4twdJ-1ocmA: 22.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_G_377G401_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 6	TYR A 342 GLU A 230 LEU A 364 PHE A 231	None	1.29A	4twdF-1ocmA: 0.0 4twdG-1ocmA: 0.0	4twdF-1ocmA: 22.14 4twdG-1ocmA: 22.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_J_377J401_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 6	TYR A 342 GLU A 230 LEU A 364 PHE A 231	None	1.18A	4twdI-1ocmA: 0.0 4twdJ-1ocmA: 0.0	4twdI-1ocmA: 22.14 4twdJ-1ocmA: 22.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE0_A_VORA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 9	TYR A 183 THR A 152 GLY A 130 THR A 356 LEU A 300	None POP A1155 (-4.5A) POP A1155 ( 4.9A) None None	1.33A	4ze0A-1ocmA: undetectable	4ze0A-1ocmA: 21.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 7	ALA A 137 ASP A 63 ARG A 41 GLY A 103	None	0.91A	5bs8A-1ocmA: undetectable 5bs8C-1ocmA: undetectable 5bs8D-1ocmA: undetectable	5bs8A-1ocmA: 24.80 5bs8C-1ocmA: 24.80 5bs8D-1ocmA: 22.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CZ7_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 9	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.34A	5cz7V-1ocmA: 0.0 5cz7b-1ocmA: undetectable	5cz7V-1ocmA: 19.76 5cz7b-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CZ7_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	5cz7H-1ocmA: undetectable 5cz7N-1ocmA: undetectable	5cz7H-1ocmA: 19.76 5cz7N-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.35A	5d0xV-1ocmA: undetectable 5d0xb-1ocmA: undetectable	5d0xV-1ocmA: 19.76 5d0xb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.36A	5d0xH-1ocmA: undetectable 5d0xN-1ocmA: undetectable	5d0xH-1ocmA: 19.76 5d0xN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FSA_B_X2NB590_2 (CYP51 VARIANT1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	3 / 3	PRO A 115 LEU A 119 SER A 355	None	0.84A	5fsaB-1ocmA: undetectable	5fsaB-1ocmA: 19.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GWX_A_SAMA301_0 (GLYCINE SARCOSINE N-METHYLTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ALA A 136 GLY A 134 GLY A 149 GLY A 140 LEU A 200	None	1.10A	5gwxA-1ocmA: undetectable	5gwxA-1ocmA: 18.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I3C_C_AC2C301_1 (PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 155 GLY A 149 VAL A 190 SER A 132 ILE A 65	POP A1155 (-1.5A) None None None None	1.11A	5i3cC-1ocmA: undetectable	5i3cC-1ocmA: 22.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.37A	5l5fV-1ocmA: 0.0 5l5fb-1ocmA: 0.0	5l5fV-1ocmA: 19.76 5l5fb-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.38A	5l5fH-1ocmA: 0.0 5l5fN-1ocmA: undetectable	5l5fH-1ocmA: 19.76 5l5fN-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L66_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	SER A 127 THR A 108 THR A 107 THR A 106 ARG A 158	None None None None POP A1155 (-3.1A)	1.40A	5l66V-1ocmA: undetectable 5l66b-1ocmA: undetectable	5l66V-1ocmA: 19.76 5l66b-1ocmA: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OJ0_A_9WTA801_0 (PENICILLIN-BINDING PROTEIN 2X)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	SER A 135 GLN A 388 THR A 105 GLY A 149 THR A 150	None	1.26A	5oj0A-1ocmA: undetectable	5oj0A-1ocmA: 20.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SYF_B_TA1B502_1 (TUBULIN BETA CHAIN)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	VAL A 389 LEU A 204 ASP A 396 ALA A 403 PRO A 376	None	1.32A	5syfB-1ocmA: undetectable	5syfB-1ocmA: 20.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B3B_A_SAMA701_0 (APRA METHYLTRANSFERASE 1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	GLY A 322 GLY A 325 ALA A 265 ILE A 276 LEU A 367	None	1.17A	6b3bA-1ocmA: undetectable	6b3bA-1ocmA: 22.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C2M_D_SUED1202_0 (NS3 PROTEASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	VAL A 40 ILE A 157 GLY A 191 ALA A 136 ALA A 160	None	1.04A	6c2mD-1ocmA: undetectable	6c2mD-1ocmA: 10.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EF6_A_ACTA405_0 (AMINOGLYCOSIDE PHOSPHOTRANSFERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 6	ARG A 113 PRO A 274 GLN A 277 ARG A 363	POP A1155 (-4.0A) None POP A1155 ( 4.7A) None	1.45A	6ef6A-1ocmA: 0.0	6ef6A-1ocmA: 23.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HD6_B_STIB601_1 (TYROSINE-PROTEIN KINASE ABL1)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 7	VAL A 90 ILE A 101 GLY A 142 ALA A 147	None	0.90A	6hd6B-1ocmA: undetectable	6hd6B-1ocmA: 12.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HWD_H_BO2H301_0 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-3)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 12	ALA A 28 ALA A 48 GLY A 56 ALA A 58 THR A 100	None	1.02A	6hwdH-1ocmA: undetectable 6hwdI-1ocmA: undetectable	6hwdH-1ocmA: 10.00 6hwdI-1ocmA: 10.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HWD_V_BO2V301_0 (PROTEASOME SUBUNIT BETA TYPE-2)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	5 / 11	ALA A 28 ALA A 48 GLY A 56 ALA A 58 THR A 100	None	1.02A	6hwdV-1ocmA: undetectable	6hwdV-1ocmA: 10.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MKE_D_FK5D201_0 (PEPTIDYLPROLYL ISOMERASE)	1ocm	MALONAMIDASE E2 (Bradyrhizobium japonicum)	4 / 4	ASP A 6 ILE A 11 PRO A 18 LEU A 7	None	1.44A	6mkeA-1ocmA: 0.0	6mkeA-1ocmA: 14.84

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1K6C_B_MK1B902_2","POL POLYPROTEIN","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",6,"GLY A 142;ALA A 141;GLY A 164;PRO A 128;THR A 118;VAL A  36","None","1.18A","1k6cB-1ocmA:undetectable","1k6cB-1ocmA:15.72"],["1KIA_A_SAMA293_0","GLYCINE N-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A 168;GLY A 203;ALA A  99;MET A 207;GLY A 194","None","1.07A","1kiaA-1ocmA:undetectable","1kiaA-1ocmA:21.79"],["1KIA_B_SAMB1293_0","GLYCINE N-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A 168;GLY A 203;ALA A  99;MET A 207;GLY A 194","None","1.06A","1kiaB-1ocmA:undetectable","1kiaB-1ocmA:21.79"],["1KIA_C_SAMC2293_0","GLYCINE N-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A 168;GLY A 203;ALA A  99;MET A 207;GLY A 194","None","1.07A","1kiaC-1ocmA:undetectable","1kiaC-1ocmA:21.79"],["1NBH_B_SAMB1293_0","GLYCINE N-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A 168;GLY A 203;ALA A  99;MET A 207;GLY A 194","None","1.04A","1nbhB-1ocmA:undetectable","1nbhB-1ocmA:21.79"],["1ONI_D_BEZD507_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ALA A  38;ILE A 144;ILE A  29;GLU A  33","None","0.91A","1oniD-1ocmA:0.0;1oniF-1ocmA:undetectable","1oniD-1ocmA:16.63;1oniF-1ocmA:16.63"],["1PK9_C_2FAC308_1","PURINE NUCLEOSIDE PHOSPHORYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 155;GLY A 149;VAL A 190;SER A 132;ILE A  65","POP A1155 (-1.5A);None;None;None;None","1.10A","1pk9C-1ocmA:undetectable","1pk9C-1ocmA:22.56"],["1RV7_B_AB1B1001_1","PROTEASE;PROTEASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A 147;ILE A 168;PRO A 159;LEU A  94;VAL A  90","None","1.06A","1rv7A-1ocmA:0.0;1rv7B-1ocmA:0.0","1rv7A-1ocmA:13.79;1rv7B-1ocmA:13.79"],["2BTE_D_LEUD1893_0","AMINOACYL-TRNA SYNTHETASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ASP A 188;SER A 184;TYR A 183;HIS A 273","None","1.34A","2bteD-1ocmA:undetectable","2bteD-1ocmA:19.60"],["2F16_H_BO2H1400_1","PROTEASOME COMPONENT PUP1;PROTEASOME COMPONENT PUP3","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A  25;ALA A  28;ALA A  48;GLY A  56;ALA A  58","None","1.11A","2f16H-1ocmA:undetectable;2f16I-1ocmA:undetectable","2f16H-1ocmA:18.81;2f16I-1ocmA:17.73"],["2F16_V_BO2V1401_1","PROTEASOME COMPONENT PUP1;PROTEASOME COMPONENT PUP3","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A  25;ALA A  28;ALA A  48;GLY A  56;ALA A  58","None","1.11A","2f16V-1ocmA:undetectable;2f16W-1ocmA:undetectable","2f16V-1ocmA:18.81;2f16W-1ocmA:17.73"],["2FJ1_A_CTCA222_0","TETRACYCLINE REPRESSOR PROTEIN CLASS D","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"HIS A  42;PHE A  39;PRO A 145;LEU A  94;ILE A 101","None","1.39A","2fj1A-1ocmA:undetectable","2fj1A-1ocmA:21.66"],["2JB7_B_ACTB1169_0","HYPOTHETICAL PROTEIN PAE2307","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"ARG A 319;ARG A 323;ARG A 320","None","1.18A","2jb7A-1ocmA:undetectable;2jb7B-1ocmA:undetectable;2jb7C-1ocmA:undetectable","2jb7A-1ocmA:18.50;2jb7B-1ocmA:18.50;2jb7C-1ocmA:18.50"],["2JB7_B_ACTB1169_0","HYPOTHETICAL PROTEIN PAE2307","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"ARG A 320;ARG A 319;ARG A 323","None","1.21A","2jb7A-1ocmA:undetectable;2jb7B-1ocmA:undetectable;2jb7C-1ocmA:undetectable","2jb7A-1ocmA:18.50;2jb7B-1ocmA:18.50;2jb7C-1ocmA:18.50"],["2JB7_B_ACTB1169_0","HYPOTHETICAL PROTEIN PAE2307","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"ARG A 323;ARG A 320;ARG A 319","None","1.14A","2jb7A-1ocmA:undetectable;2jb7B-1ocmA:undetectable;2jb7C-1ocmA:undetectable","2jb7A-1ocmA:18.50;2jb7B-1ocmA:18.50;2jb7C-1ocmA:18.50"],["2VE3_A_REAA1445_1","PUTATIVE CYTOCHROME P450 120","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"THR A 165;ALA A 147;ALA A  38;THR A 118;GLY A 130","None;None;None;None;POP A1155 ( 4.9A)","1.03A","2ve3A-1ocmA:0.0","2ve3A-1ocmA:21.95"],["2VE3_B_REAB1445_1","PUTATIVE CYTOCHROME P450 120","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"THR A 165;ALA A 147;ALA A  38;THR A 118;GLY A 130","None;None;None;None;POP A1155 ( 4.9A)","1.01A","2ve3B-1ocmA:undetectable","2ve3B-1ocmA:21.95"],["2VOU_A_ACTA1397_0","2,6-DIHYDROXYPYRIDINE HYDROXYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"PRO A 349;GLY A 357;TYR A 162","None","0.51A","2vouA-1ocmA:undetectable","2vouA-1ocmA:23.03"],["2VOU_B_ACTB1391_0","2,6-DIHYDROXYPYRIDINE HYDROXYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"PRO A 349;GLY A 357;TYR A 162","None","0.51A","2vouB-1ocmA:0.0","2vouB-1ocmA:23.03"],["2VOU_C_ACTC1391_0","2,6-DIHYDROXYPYRIDINE HYDROXYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"PRO A 349;GLY A 357;TYR A 162","None","0.51A","2vouC-1ocmA:0.0","2vouC-1ocmA:23.03"],["2W98_B_P1ZB1359_1","PROSTAGLANDIN REDUCTASE 2","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"THR A 105;MET A  70;LYS A  44;ILE A 101","None","1.35A","2w98B-1ocmA:undetectable","2w98B-1ocmA:22.33"],["2XKW_B_P1BB1475_1","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"PHE A  39;HIS A  42;ALA A  48;LEU A   7;ILE A 144","None","1.27A","2xkwB-1ocmA:undetectable","2xkwB-1ocmA:20.91"],["3ADS_A_IMNA1_1","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"GLU A 407;GLY A 194;LEU A 175;ILE A 168;MET A 207","None","1.39A","3adsA-1ocmA:undetectable","3adsA-1ocmA:20.63"],["3BSZ_F_RTLF178_0","PLASMA RETINOL-BINDING PROTEIN","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A 167;PHE A 193;ALA A 136;TYR A 162;GLN A 151","None","1.30A","3bszF-1ocmA:0.0","3bszF-1ocmA:19.32"],["3IA4_B_MTXB164_2","DIHYDROFOLATE REDUCTASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"PHE A  39;LYS A 104;ILE A  29;THR A 118","None","1.47A","3ia4B-1ocmA:undetectable","3ia4B-1ocmA:17.72"],["3ID6_C_SAMC301_0","FIBRILLARIN-LIKE RRNA\/TRNA 2'-O-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"GLY A 215;PHE A 213;SER A 211;ALA A 201;ILE A 216","None","1.14A","3id6C-1ocmA:undetectable","3id6C-1ocmA:22.66"],["3KP6_A_SALA3002_1","TRANSCRIPTIONAL REGULATOR TCAR;TRANSCRIPTIONAL REGULATOR TCAR","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"LEU A 146;VAL A 190;ILE A  65;VAL A  90;LEU A  94","None","1.39A","3kp6A-1ocmA:undetectable;3kp6B-1ocmA:undetectable","3kp6A-1ocmA:15.00;3kp6B-1ocmA:15.00"],["3KP6_B_SALB3003_1","TRANSCRIPTIONAL REGULATOR TCAR;TRANSCRIPTIONAL REGULATOR TCAR","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ILE A  61;VAL A  59;LEU A 146;LEU A 192","None","0.85A","3kp6A-1ocmA:undetectable;3kp6B-1ocmA:undetectable","3kp6A-1ocmA:15.00;3kp6B-1ocmA:15.00"],["3KVR_A_URFA2001_1","URIDINE PHOSPHORYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"GLY A 203;PHE A 213;LEU A 200;LEU A 192;ILE A 168","None","1.26A","3kvrA-1ocmA:undetectable","3kvrA-1ocmA:22.17"],["3LW5_B_PQNB5002_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A 157;PHE A 213;ALA A 401;LEU A 400;ALA A 201","None","1.20A","3lw5B-1ocmA:0.0","3lw5B-1ocmA:20.92"],["3MG0_V_BO2V1401_1","PROTEASOME COMPONENT PUP1;PROTEASOME COMPONENT PUP3","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A  25;ALA A  28;ALA A  48;GLY A  56;ALA A  58","None","1.10A","3mg0V-1ocmA:undetectable;3mg0W-1ocmA:undetectable","3mg0V-1ocmA:18.81;3mg0W-1ocmA:17.73"],["3R9V_B_DXCB1_0","INVASIN IPAD","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ILE A  57;LEU A   4;LEU A 200;VAL A 156;SER A 132","None","1.35A","3r9vA-1ocmA:undetectable;3r9vB-1ocmA:undetectable","3r9vA-1ocmA:19.81;3r9vB-1ocmA:19.81"],["4AWU_A_4CHA502_0","OXIDOREDUCTASE, FMN-BINDING","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"THR A 165;HIS A 122;ASN A 120;PHE A 193","None","1.36A","4awuA-1ocmA:undetectable","4awuA-1ocmA:24.38"],["4BLV_A_SAMA1281_0","RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"LEU A 400;GLY A 194;GLY A 140;ASP A 199;GLY A 191","None","1.09A","4blvA-1ocmA:undetectable","4blvA-1ocmA:21.80"],["4EJJ_C_NCTC501_1","CYTOCHROME P450 2A6","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"PHE A  39;ILE A 102;GLY A  60;THR A 105","None","0.94A","4ejjC-1ocmA:undetectable","4ejjC-1ocmA:21.37"],["4PB1_A_RBVA501_1","NUPC FAMILY PROTEIN","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"GLY A 346;GLU A 236;ALA A 238;ASN A 123;ASN A 120","None","1.17A","4pb1A-1ocmA:undetectable","4pb1A-1ocmA:23.59"],["4QVM_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvmV-1ocmA:undetectable;4qvmb-1ocmA:undetectable","4qvmV-1ocmA:19.76;4qvmb-1ocmA:18.56"],["4QVM_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvmH-1ocmA:undetectable;4qvmN-1ocmA:undetectable","4qvmH-1ocmA:19.76;4qvmN-1ocmA:18.56"],["4QVP_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvpV-1ocmA:undetectable;4qvpb-1ocmA:undetectable","4qvpV-1ocmA:19.76;4qvpb-1ocmA:18.56"],["4QVP_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","4qvpH-1ocmA:undetectable;4qvpN-1ocmA:undetectable","4qvpH-1ocmA:19.76;4qvpN-1ocmA:18.56"],["4QVQ_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvqV-1ocmA:undetectable;4qvqb-1ocmA:undetectable","4qvqV-1ocmA:19.76;4qvqb-1ocmA:18.56"],["4QVQ_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvqH-1ocmA:undetectable;4qvqN-1ocmA:undetectable","4qvqH-1ocmA:19.76;4qvqN-1ocmA:18.56"],["4QVV_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","4qvvV-1ocmA:undetectable;4qvvb-1ocmA:undetectable","4qvvV-1ocmA:19.76;4qvvb-1ocmA:18.56"],["4QVV_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qvvH-1ocmA:0.0;4qvvN-1ocmA:undetectable","4qvvH-1ocmA:19.76;4qvvN-1ocmA:18.56"],["4QVW_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","4qvwV-1ocmA:undetectable;4qvwb-1ocmA:undetectable","4qvwV-1ocmA:19.76;4qvwb-1ocmA:18.56"],["4QVW_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","4qvwH-1ocmA:undetectable;4qvwN-1ocmA:undetectable","4qvwH-1ocmA:19.76;4qvwN-1ocmA:18.56"],["4QVY_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.33A","4qvyV-1ocmA:0.0;4qvyb-1ocmA:undetectable","4qvyV-1ocmA:19.76;4qvyb-1ocmA:18.56"],["4QVY_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.34A","4qvyH-1ocmA:0.0;4qvyN-1ocmA:undetectable","4qvyH-1ocmA:19.76;4qvyN-1ocmA:18.56"],["4QW0_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","4qw0V-1ocmA:undetectable;4qw0b-1ocmA:undetectable","4qw0V-1ocmA:19.76;4qw0b-1ocmA:18.56"],["4QW0_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qw0H-1ocmA:undetectable;4qw0N-1ocmA:undetectable","4qw0H-1ocmA:19.76;4qw0N-1ocmA:18.56"],["4QW1_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","4qw1H-1ocmA:undetectable;4qw1N-1ocmA:undetectable","4qw1H-1ocmA:19.76;4qw1N-1ocmA:18.56"],["4QW3_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.37A","4qw3V-1ocmA:undetectable;4qw3b-1ocmA:undetectable","4qw3V-1ocmA:19.76;4qw3b-1ocmA:18.56"],["4QW3_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.37A","4qw3H-1ocmA:undetectable;4qw3N-1ocmA:undetectable","4qw3H-1ocmA:19.76;4qw3N-1ocmA:18.56"],["4TWD_F_377F402_1","CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A 197;ALA A 201;ALA A 397;ALA A 399;ALA A 403","None","1.43A","4twdF-1ocmA:0.0;4twdG-1ocmA:0.0;4twdH-1ocmA:0.0;4twdI-1ocmA:0.0;4twdJ-1ocmA:0.0","4twdF-1ocmA:22.14;4twdG-1ocmA:22.14;4twdH-1ocmA:22.14;4twdI-1ocmA:22.14;4twdJ-1ocmA:22.14"],["4TWD_G_377G401_1","CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"TYR A 342;GLU A 230;LEU A 364;PHE A 231","None","1.29A","4twdF-1ocmA:0.0;4twdG-1ocmA:0.0","4twdF-1ocmA:22.14;4twdG-1ocmA:22.14"],["4TWD_J_377J401_1","CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"TYR A 342;GLU A 230;LEU A 364;PHE A 231","None","1.18A","4twdI-1ocmA:0.0;4twdJ-1ocmA:0.0","4twdI-1ocmA:22.14;4twdJ-1ocmA:22.14"],["4ZE0_A_VORA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"TYR A 183;THR A 152;GLY A 130;THR A 356;LEU A 300","None;POP A1155 (-4.5A);POP A1155 ( 4.9A);None;None","1.33A","4ze0A-1ocmA:undetectable","4ze0A-1ocmA:21.40"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ALA A 137;ASP A  63;ARG A  41;GLY A 103","None","0.91A","5bs8A-1ocmA:undetectable;5bs8C-1ocmA:undetectable;5bs8D-1ocmA:undetectable","5bs8A-1ocmA:24.80;5bs8C-1ocmA:24.80;5bs8D-1ocmA:22.01"],["5CZ7_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.34A","5cz7V-1ocmA:0.0;5cz7b-1ocmA:undetectable","5cz7V-1ocmA:19.76;5cz7b-1ocmA:18.56"],["5CZ7_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","5cz7H-1ocmA:undetectable;5cz7N-1ocmA:undetectable","5cz7H-1ocmA:19.76;5cz7N-1ocmA:18.56"],["5D0X_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.35A","5d0xV-1ocmA:undetectable;5d0xb-1ocmA:undetectable","5d0xV-1ocmA:19.76;5d0xb-1ocmA:18.56"],["5D0X_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.36A","5d0xH-1ocmA:undetectable;5d0xN-1ocmA:undetectable","5d0xH-1ocmA:19.76;5d0xN-1ocmA:18.56"],["5FSA_B_X2NB590_2","CYP51 VARIANT1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",3,"PRO A 115;LEU A 119;SER A 355","None","0.84A","5fsaB-1ocmA:undetectable","5fsaB-1ocmA:19.96"],["5GWX_A_SAMA301_0","GLYCINE SARCOSINE N-METHYLTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A 136;GLY A 134;GLY A 149;GLY A 140;LEU A 200","None","1.10A","5gwxA-1ocmA:undetectable","5gwxA-1ocmA:18.27"],["5I3C_C_AC2C301_1","PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 155;GLY A 149;VAL A 190;SER A 132;ILE A  65","POP A1155 (-1.5A);None;None;None;None","1.11A","5i3cC-1ocmA:undetectable","5i3cC-1ocmA:22.56"],["5L5F_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.37A","5l5fV-1ocmA:0.0;5l5fb-1ocmA:0.0","5l5fV-1ocmA:19.76;5l5fb-1ocmA:18.56"],["5L5F_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.38A","5l5fH-1ocmA:0.0;5l5fN-1ocmA:undetectable","5l5fH-1ocmA:19.76;5l5fN-1ocmA:18.56"],["5L66_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 127;THR A 108;THR A 107;THR A 106;ARG A 158","None;None;None;None;POP A1155 (-3.1A)","1.40A","5l66V-1ocmA:undetectable;5l66b-1ocmA:undetectable","5l66V-1ocmA:19.76;5l66b-1ocmA:18.56"],["5OJ0_A_9WTA801_0","PENICILLIN-BINDING PROTEIN 2X","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"SER A 135;GLN A 388;THR A 105;GLY A 149;THR A 150","None","1.26A","5oj0A-1ocmA:undetectable","5oj0A-1ocmA:20.81"],["5SYF_B_TA1B502_1","TUBULIN BETA CHAIN","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"VAL A 389;LEU A 204;ASP A 396;ALA A 403;PRO A 376","None","1.32A","5syfB-1ocmA:undetectable","5syfB-1ocmA:20.80"],["6B3B_A_SAMA701_0","APRA METHYLTRANSFERASE 1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"GLY A 322;GLY A 325;ALA A 265;ILE A 276;LEU A 367","None","1.17A","6b3bA-1ocmA:undetectable","6b3bA-1ocmA:22.90"],["6C2M_D_SUED1202_0","NS3 PROTEASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"VAL A  40;ILE A 157;GLY A 191;ALA A 136;ALA A 160","None","1.04A","6c2mD-1ocmA:undetectable","6c2mD-1ocmA:10.92"],["6EF6_A_ACTA405_0","AMINOGLYCOSIDE PHOSPHOTRANSFERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ARG A 113;PRO A 274;GLN A 277;ARG A 363","POP A1155 (-4.0A);None;POP A1155 ( 4.7A);None","1.45A","6ef6A-1ocmA:0.0","6ef6A-1ocmA:23.30"],["6HD6_B_STIB601_1","TYROSINE-PROTEIN KINASE ABL1","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"VAL A  90;ILE A 101;GLY A 142;ALA A 147","None","0.90A","6hd6B-1ocmA:undetectable","6hd6B-1ocmA:12.81"],["6HWD_H_BO2H301_0","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-3","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A  28;ALA A  48;GLY A  56;ALA A  58;THR A 100","None","1.02A","6hwdH-1ocmA:undetectable;6hwdI-1ocmA:undetectable","6hwdH-1ocmA:10.00;6hwdI-1ocmA:10.54"],["6HWD_V_BO2V301_0","PROTEASOME SUBUNIT BETA TYPE-2","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",5,"ALA A  28;ALA A  48;GLY A  56;ALA A  58;THR A 100","None","1.02A","6hwdV-1ocmA:undetectable","6hwdV-1ocmA:10.00"],["6MKE_D_FK5D201_0","PEPTIDYLPROLYL ISOMERASE","1ocm","MALONAMIDASE E2","Bradyrhizobium japonicum",4,"ASP A   6;ILE A  11;PRO A  18;LEU A   7","None","1.44A","6mkeA-1ocmA:0.0","6mkeA-1ocmA:14.84"]]