SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '1xrc'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_F_ACTF3008_0 (BETA-CARBONIC ANHYDRASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 8	PHE A 262 ASP A 271 GLY A 259 GLY A 258	None CO A 411 (-3.1A) None None	0.89A	1ekjE-1xrcA: undetectable 1ekjF-1xrcA: undetectable	1ekjE-1xrcA: 18.44 1ekjF-1xrcA: 18.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQB_A_FFOA1293_1 (SERINE HYDROXYMETHYLTRANSFE RASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	GLU A 295 TYR A 125 PHE A 315	None	0.91A	1eqbB-1xrcA: undetectable	1eqbB-1xrcA: 22.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQB_B_FFOB2293_0 (SERINE HYDROXYMETHYLTRANSFE RASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	GLU A 295 TYR A 125 PHE A 315	None	0.91A	1eqbA-1xrcA: undetectable	1eqbA-1xrcA: 22.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQB_C_FFOC3293_2 (SERINE HYDROXYMETHYLTRANSFE RASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	GLU A 295 TYR A 125 PHE A 315	None	0.90A	1eqbD-1xrcA: undetectable	1eqbD-1xrcA: 22.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQB_D_FFOD4293_0 (SERINE HYDROXYMETHYLTRANSFE RASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	GLU A 295 TYR A 125 PHE A 315	None	0.91A	1eqbC-1xrcA: undetectable	1eqbC-1xrcA: 22.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LQT_B_ACTB1868_0 (FPRA)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	ALA A 141 HIS A 142 VAL A 145	None	0.43A	1lqtB-1xrcA: undetectable	1lqtB-1xrcA: 24.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LQU_B_ACTB1425_0 (FPRA)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	ALA A 141 HIS A 142 VAL A 145	None	0.45A	1lquB-1xrcA: undetectable	1lquB-1xrcA: 24.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OHR_A_1UNA201_1 (ASPARTYLPROTEASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 11	ALA A 25 ASP A 28 ASP A 24 THR A 43 VAL A 50 ILE A 22	None	1.35A	1ohrA-1xrcA: undetectable	1ohrA-1xrcA: 16.25
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1P7L_C_SAMC685_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.82A	1p7lC-1xrcA: 57.2	1p7lC-1xrcA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1P7L_C_SAMC885_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.81A	1p7lD-1xrcA: 57.2	1p7lD-1xrcA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1RG9_A_SAMA385_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.83A	1rg9A-1xrcA: 57.2	1rg9A-1xrcA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1RG9_B_SAMB485_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.83A	1rg9B-1xrcA: 57.3	1rg9B-1xrcA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1RG9_C_SAMC585_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.83A	1rg9C-1xrcA: 57.2	1rg9C-1xrcA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	1RG9_C_SAMC685_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.83A	1rg9D-1xrcA: 57.3	1rg9D-1xrcA: 100.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOH_C_FRDC305_2 (POL POLYPROTEIN PEPTIDE INHIBITOR)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 5	LEU A 31 GLY A 54 ALA A 37 ILE A 30	None	0.75A	2aohB-1xrcA: undetectable	2aohB-1xrcA: 14.60
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	2OBV_A_SAMA501_0 (S-ADENOSYLMETHIONINE SYNTHETASE ISOFORM TYPE-1)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.60A	2obvA-1xrcA: 54.4	2obvA-1xrcA: 56.74
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	2P02_A_SAMA2_0 (S-ADENOSYLMETHIONINE SYNTHETASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.62A	2p02A-1xrcA: 54.0	2p02A-1xrcA: 54.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q6H_A_CXXA801_1 (TRANSPORTER)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 11	LEU A 347 LEU A 346 LEU A 27 ASP A 24 ASP A 28	None	1.20A	2q6hA-1xrcA: 0.7	2q6hA-1xrcA: 22.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QEO_A_LNRA200_1 (D7R4 PROTEIN)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 12	ARG A 69 ILE A 22 VAL A 50 PHE A 84 ASP A 85	None	1.26A	2qeoA-1xrcA: 0.0	2qeoA-1xrcA: 16.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQZ_A_LQZA586_1 (SERUM ALBUMIN)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 6	ARG A 244 ASP A 16 LYS A 245 LYS A 165	None	1.49A	3jqzA-1xrcA: 0.0	3jqzA-1xrcA: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NXU_A_RITA600_2 (CYTOCHROME P450 3A4)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	ILE A 341 LEU A 31 THR A 354 THR A 57	None	1.18A	3nxuA-1xrcA: undetectable	3nxuA-1xrcA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_B_RTZB1_1 (CYTOCHROME P450 2D6)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 12	GLY A 53 GLU A 42 ALA A 19 ASP A 20 SER A 23	None K A 413 (-2.9A) None None None	1.03A	3tbgB-1xrcA: 0.0	3tbgB-1xrcA: 21.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_D_RTZD1_1 (CYTOCHROME P450 2D6)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 12	GLY A 53 GLU A 42 ALA A 19 ASP A 20 SER A 23	None K A 413 (-2.9A) None None None	1.03A	3tbgD-1xrcA: 0.0	3tbgD-1xrcA: 21.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TL9_A_ROCA401_4 (PROTEASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 4	ASP A 16 ASP A 20 GLY A 13 THR A 71	None	1.06A	3tl9B-1xrcA: undetectable	3tl9B-1xrcA: 14.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EMA_A_BRLA601_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	PHE A 332 VAL A 312 ILE A 310	None	0.62A	4emaA-1xrcA: undetectable	4emaA-1xrcA: 21.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EYS_A_ACTA402_0 (MCCC FAMILY PROTEIN)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 6	SER A 23 ASP A 20 SER A 263 GLU A 42	None None None K A 413 (-2.9A)	1.02A	4eysA-1xrcA: undetectable	4eysA-1xrcA: 22.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_1 (S-ADENOSYLMETHIONINE SYNTHASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 ASP A 238	None	0.57A	4k0bB-1xrcA: 27.4	4k0bB-1xrcA: 25.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KR3_A_GLYA701_0 (GLYCINE--TRNA LIGASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 6	ARG A 143 GLU A 363 ARG A 279 GLU A 368	None	1.39A	4kr3A-1xrcA: undetectable	4kr3A-1xrcA: 19.44
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4KTT_A_SAMA405_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.54A	4kttA-1xrcA: 52.0	4kttA-1xrcA: 54.70
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4KTT_C_SAMC404_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.58A	4kttC-1xrcA: 51.7	4kttC-1xrcA: 54.70
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4KTV_A_ADNA403_1 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 12	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230	None	0.33A	4ktvA-1xrcA: 52.1 4ktvB-1xrcA: 54.1	4ktvA-1xrcA: 54.70 4ktvB-1xrcA: 54.70
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4KTV_A_ADNA403_1 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 12	HIS A 14 PRO A 15 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.65A	4ktvA-1xrcA: 52.1 4ktvB-1xrcA: 54.1	4ktvA-1xrcA: 54.70 4ktvB-1xrcA: 54.70
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4KTV_C_ADNC403_1 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 11	HIS A 14 PRO A 15 ASP A 163 LYS A 165 PHE A 230 ASP A 238	None	0.53A	4ktvC-1xrcA: 51.8 4ktvD-1xrcA: 53.9	4ktvC-1xrcA: 54.70 4ktvD-1xrcA: 54.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L7I_B_SAMB501_1 (S-ADENOSYLMETHIONINE SYNTHASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 ASP A 238	None	0.48A	4l7iB-1xrcA: 27.1	4l7iB-1xrcA: 25.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MME_A_29QA603_1 (TRANSPORTER)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	5 / 9	ASP A 238 VAL A 10 ALA A 164 GLY A 240 GLY A 13	None	1.41A	4mmeA-1xrcA: 0.6	4mmeA-1xrcA: 21.42
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4NDN_A_SAMA407_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.59A	4ndnA-1xrcA: 52.6	4ndnA-1xrcA: 54.84
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4NDN_C_SAMC405_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 7	HIS A 14 PRO A 15 ASP A 163 LYS A 165 PHE A 230 ASP A 238	None	0.50A	4ndnC-1xrcA: 52.2	4ndnC-1xrcA: 54.84
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4ODJ_A_SAMA500_0 (S-ADENOSYLMETHIONINE SYNTHASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 7	HIS A 14 PRO A 15 ASP A 163 LYS A 165 PHE A 230 ASP A 238	None	0.43A	4odjA-1xrcA: 53.7	4odjA-1xrcA: 47.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QA0_A_SHHA404_2 (HISTONE DEACETYLASE 8)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	PRO A 135 MET A 134 TYR A 251	None	0.82A	4qa0B-1xrcA: undetectable	4qa0B-1xrcA: 22.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QA0_B_SHHB404_1 (HISTONE DEACETYLASE 8)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	PRO A 135 MET A 134 TYR A 251	None	0.81A	4qa0A-1xrcA: undetectable	4qa0A-1xrcA: 22.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QA2_A_SHHA404_2 (HISTONE DEACETYLASE 8)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	PRO A 135 MET A 134 TYR A 251	None	0.89A	4qa2B-1xrcA: undetectable	4qa2B-1xrcA: 22.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QZU_D_ACTD201_0 (RETINOL-BINDING PROTEIN 2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	ASP A 16 HIS A 14 LYS A 17	None	1.00A	4qzuD-1xrcA: 0.0	4qzuD-1xrcA: 15.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UCK_B_SAMB2409_1 (RNA-DIRECTED RNA POLYMERASE L)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 6	GLY A 264 GLU A 42 ASP A 20 ASP A 28	K A 413 ( 4.5A) K A 413 (-2.9A) None None	0.96A	4uckB-1xrcA: undetectable	4uckB-1xrcA: 20.93
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5A1I_A_ADNA407_1 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.59A	5a1iA-1xrcA: 54.0	5a1iA-1xrcA: 54.84
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5A1I_A_SAMA405_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 7	HIS A 14 PRO A 15 ASP A 163 LYS A 165 PHE A 230 ASP A 238	None	0.51A	5a1iA-1xrcA: 54.0	5a1iA-1xrcA: 54.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BMV_C_VLBC507_2 (TUBULIN ALPHA-1B CHAIN)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	VAL A 52 ILE A 95 VAL A 26 ILE A 22	None	0.80A	5bmvC-1xrcA: undetectable	5bmvC-1xrcA: 21.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	ALA A 60 GLY A 54 THR A 242 GLU A 42	None None K A 413 ( 4.7A) K A 413 (-2.9A)	0.92A	5bs8A-1xrcA: 1.3 5bs8C-1xrcA: 1.3 5bs8D-1xrcA: undetectable	5bs8A-1xrcA: 21.25 5bs8C-1xrcA: 21.25 5bs8D-1xrcA: 24.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 6	ALA A 60 GLY A 54 THR A 242 GLU A 42	None None K A 413 ( 4.7A) K A 413 (-2.9A)	0.93A	5btgA-1xrcA: 1.3 5btgB-1xrcA: undetectable 5btgC-1xrcA: 1.3	5btgA-1xrcA: 21.25 5btgB-1xrcA: 24.04 5btgC-1xrcA: 21.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	ALA A 60 GLY A 54 THR A 242 GLU A 42	None None K A 413 ( 4.7A) K A 413 (-2.9A)	0.93A	5btgA-1xrcA: 1.3 5btgC-1xrcA: 1.3 5btgD-1xrcA: undetectable	5btgA-1xrcA: 21.25 5btgC-1xrcA: 21.25 5btgD-1xrcA: 24.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N9X_A_THRA601_0 (ADENYLATION DOMAIN)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	PHE A 230 GLY A 234 GLY A 13 HIS A 14	None	1.05A	5n9xA-1xrcA: undetectable	5n9xA-1xrcA: 20.71
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5T8S_B_SAMB402_1 (S-ADENOSYLMETHIONINE SYNTHASE)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	8 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 THR A 227 PHE A 230 ASP A 238	None	0.73A	5t8sB-1xrcA: 58.3	5t8sB-1xrcA: 67.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UXD_A_ZITA501_1 (MACROLIDE 2'-PHOSPHOTRANSFERAS E MPHH)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	4 / 7	GLU A 368 ALA A 282 GLY A 124 TYR A 125	None	1.00A	5uxdA-1xrcA: undetectable	5uxdA-1xrcA: 23.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Y2T_A_8LXA501_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	3 / 3	SER A 263 HIS A 359 TYR A 276	None	1.05A	5y2tA-1xrcA: 0.0	5y2tA-1xrcA: undetectable
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6FBN_B_SAMB401_1 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.62A	6fbnB-1xrcA: 51.3	6fbnB-1xrcA: 54.59
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6FBO_A_ADNA406_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.58A	6fboA-1xrcA: 54.2	6fboA-1xrcA: 43.36
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6FBP_B_ADNB404_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 12	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.62A	6fbpA-1xrcA: 54.8 6fbpB-1xrcA: 52.9	6fbpA-1xrcA: 43.36 6fbpB-1xrcA: 43.36
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6FCB_A_SAMA405_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.61A	6fcbA-1xrcA: 54.4	6fcbA-1xrcA: 54.59
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6FCD_A_ADNA405_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	7 / 8	HIS A 14 PRO A 15 ASP A 163 LYS A 165 SER A 186 PHE A 230 ASP A 238	None	0.59A	6fcdA-1xrcA: 54.0	6fcdA-1xrcA: 43.36
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	6G6R_A_SAMA406_0 (S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2)	1xrc	S-ADENOSYLMETHIONINE SYNTHETASE (Escherichia coli)	6 / 7	HIS A 14 PRO A 15 ASP A 163 LYS A 165 PHE A 230 ASP A 238	None	0.52A	6g6rA-1xrcA: 54.1	6g6rA-1xrcA: 54.84

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1EKJ_F_ACTF3008_0","BETA-CARBONIC ANHYDRASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"PHE A 262;ASP A 271;GLY A 259;GLY A 258","None; CO A 411 (-3.1A);None;None","0.89A","1ekjE-1xrcA:undetectable;1ekjF-1xrcA:undetectable","1ekjE-1xrcA:18.44;1ekjF-1xrcA:18.44"],["1EQB_A_FFOA1293_1","SERINE HYDROXYMETHYLTRANSFERASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"GLU A 295;TYR A 125;PHE A 315","None","0.91A","1eqbB-1xrcA:undetectable","1eqbB-1xrcA:22.52"],["1EQB_B_FFOB2293_0","SERINE HYDROXYMETHYLTRANSFERASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"GLU A 295;TYR A 125;PHE A 315","None","0.91A","1eqbA-1xrcA:undetectable","1eqbA-1xrcA:22.52"],["1EQB_C_FFOC3293_2","SERINE HYDROXYMETHYLTRANSFERASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"GLU A 295;TYR A 125;PHE A 315","None","0.90A","1eqbD-1xrcA:undetectable","1eqbD-1xrcA:22.52"],["1EQB_D_FFOD4293_0","SERINE HYDROXYMETHYLTRANSFERASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"GLU A 295;TYR A 125;PHE A 315","None","0.91A","1eqbC-1xrcA:undetectable","1eqbC-1xrcA:22.52"],["1LQT_B_ACTB1868_0","FPRA","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"ALA A 141;HIS A 142;VAL A 145","None","0.43A","1lqtB-1xrcA:undetectable","1lqtB-1xrcA:24.64"],["1LQU_B_ACTB1425_0","FPRA","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"ALA A 141;HIS A 142;VAL A 145","None","0.45A","1lquB-1xrcA:undetectable","1lquB-1xrcA:24.64"],["1OHR_A_1UNA201_1","ASPARTYLPROTEASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"ALA A  25;ASP A  28;ASP A  24;THR A  43;VAL A  50;ILE A  22","None","1.35A","1ohrA-1xrcA:undetectable","1ohrA-1xrcA:16.25"],["1P7L_C_SAMC685_0","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.82A","1p7lC-1xrcA:57.2","1p7lC-1xrcA:100.00"],["1P7L_C_SAMC885_1","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.81A","1p7lD-1xrcA:57.2","1p7lD-1xrcA:100.00"],["1RG9_A_SAMA385_0","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.83A","1rg9A-1xrcA:57.2","1rg9A-1xrcA:100.00"],["1RG9_B_SAMB485_1","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.83A","1rg9B-1xrcA:57.3","1rg9B-1xrcA:100.00"],["1RG9_C_SAMC585_0","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.83A","1rg9C-1xrcA:57.2","1rg9C-1xrcA:100.00"],["1RG9_C_SAMC685_1","S-ADENOSYLMETHIONINE SYNTHETASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.83A","1rg9D-1xrcA:57.3","1rg9D-1xrcA:100.00"],["2AOH_C_FRDC305_2","POL POLYPROTEIN;PEPTIDE INHIBITOR","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"LEU A  31;GLY A  54;ALA A  37;ILE A  30","None","0.75A","2aohB-1xrcA:undetectable","2aohB-1xrcA:14.60"],["2OBV_A_SAMA501_0","S-ADENOSYLMETHIONINE SYNTHETASE ISOFORM TYPE-1","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.60A","2obvA-1xrcA:54.4","2obvA-1xrcA:56.74"],["2P02_A_SAMA2_0","S-ADENOSYLMETHIONINE SYNTHETASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.62A","2p02A-1xrcA:54.0","2p02A-1xrcA:54.70"],["2Q6H_A_CXXA801_1","TRANSPORTER","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"LEU A 347;LEU A 346;LEU A  27;ASP A  24;ASP A  28","None","1.20A","2q6hA-1xrcA:0.7","2q6hA-1xrcA:22.00"],["2QEO_A_LNRA200_1","D7R4 PROTEIN","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"ARG A  69;ILE A  22;VAL A  50;PHE A  84;ASP A  85","None","1.26A","2qeoA-1xrcA:0.0","2qeoA-1xrcA:16.75"],["3JQZ_A_LQZA586_1","SERUM ALBUMIN","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ARG A 244;ASP A  16;LYS A 245;LYS A 165","None","1.49A","3jqzA-1xrcA:0.0","3jqzA-1xrcA:20.70"],["3NXU_A_RITA600_2","CYTOCHROME P450 3A4","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ILE A 341;LEU A  31;THR A 354;THR A  57","None","1.18A","3nxuA-1xrcA:undetectable","3nxuA-1xrcA:21.93"],["3TBG_B_RTZB1_1","CYTOCHROME P450 2D6","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"GLY A  53;GLU A  42;ALA A  19;ASP A  20;SER A  23","None;  K A 413 (-2.9A);None;None;None","1.03A","3tbgB-1xrcA:0.0","3tbgB-1xrcA:21.81"],["3TBG_D_RTZD1_1","CYTOCHROME P450 2D6","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"GLY A  53;GLU A  42;ALA A  19;ASP A  20;SER A  23","None;  K A 413 (-2.9A);None;None;None","1.03A","3tbgD-1xrcA:0.0","3tbgD-1xrcA:21.81"],["3TL9_A_ROCA401_4","PROTEASE;PROTEASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ASP A  16;ASP A  20;GLY A  13;THR A  71","None","1.06A","3tl9B-1xrcA:undetectable","3tl9B-1xrcA:14.71"],["4EMA_A_BRLA601_2","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"PHE A 332;VAL A 312;ILE A 310","None","0.62A","4emaA-1xrcA:undetectable","4emaA-1xrcA:21.97"],["4EYS_A_ACTA402_0","MCCC FAMILY PROTEIN","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"SER A  23;ASP A  20;SER A 263;GLU A  42","None;None;None;  K A 413 (-2.9A)","1.02A","4eysA-1xrcA:undetectable","4eysA-1xrcA:22.56"],["4K0B_B_SAMB504_1","S-ADENOSYLMETHIONINE SYNTHASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;ASP A 238","None","0.57A","4k0bB-1xrcA:27.4","4k0bB-1xrcA:25.37"],["4KR3_A_GLYA701_0","GLYCINE--TRNA LIGASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ARG A 143;GLU A 363;ARG A 279;GLU A 368","None","1.39A","4kr3A-1xrcA:undetectable","4kr3A-1xrcA:19.44"],["4KTT_A_SAMA405_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.54A","4kttA-1xrcA:52.0","4kttA-1xrcA:54.70"],["4KTT_C_SAMC404_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.58A","4kttC-1xrcA:51.7","4kttC-1xrcA:54.70"],["4KTV_A_ADNA403_1","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2;S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230","None","0.33A","4ktvA-1xrcA:52.1;4ktvB-1xrcA:54.1","4ktvA-1xrcA:54.70;4ktvB-1xrcA:54.70"],["4KTV_A_ADNA403_1","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2;S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.65A","4ktvA-1xrcA:52.1;4ktvB-1xrcA:54.1","4ktvA-1xrcA:54.70;4ktvB-1xrcA:54.70"],["4KTV_C_ADNC403_1","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2;S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;PHE A 230;ASP A 238","None","0.53A","4ktvC-1xrcA:51.8;4ktvD-1xrcA:53.9","4ktvC-1xrcA:54.70;4ktvD-1xrcA:54.70"],["4L7I_B_SAMB501_1","S-ADENOSYLMETHIONINE SYNTHASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;ASP A 238","None","0.48A","4l7iB-1xrcA:27.1","4l7iB-1xrcA:25.37"],["4MME_A_29QA603_1","TRANSPORTER","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",5,"ASP A 238;VAL A  10;ALA A 164;GLY A 240;GLY A  13","None","1.41A","4mmeA-1xrcA:0.6","4mmeA-1xrcA:21.42"],["4NDN_A_SAMA407_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.59A","4ndnA-1xrcA:52.6","4ndnA-1xrcA:54.84"],["4NDN_C_SAMC405_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;PHE A 230;ASP A 238","None","0.50A","4ndnC-1xrcA:52.2","4ndnC-1xrcA:54.84"],["4ODJ_A_SAMA500_0","S-ADENOSYLMETHIONINE SYNTHASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;PHE A 230;ASP A 238","None","0.43A","4odjA-1xrcA:53.7","4odjA-1xrcA:47.94"],["4QA0_A_SHHA404_2","HISTONE DEACETYLASE 8;HISTONE DEACETYLASE 8","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"PRO A 135;MET A 134;TYR A 251","None","0.82A","4qa0B-1xrcA:undetectable","4qa0B-1xrcA:22.99"],["4QA0_B_SHHB404_1","HISTONE DEACETYLASE 8;HISTONE DEACETYLASE 8","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"PRO A 135;MET A 134;TYR A 251","None","0.81A","4qa0A-1xrcA:undetectable","4qa0A-1xrcA:22.99"],["4QA2_A_SHHA404_2","HISTONE DEACETYLASE 8;HISTONE DEACETYLASE 8","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"PRO A 135;MET A 134;TYR A 251","None","0.89A","4qa2B-1xrcA:undetectable","4qa2B-1xrcA:22.99"],["4QZU_D_ACTD201_0","RETINOL-BINDING PROTEIN 2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"ASP A  16;HIS A  14;LYS A  17","None","1.00A","4qzuD-1xrcA:0.0","4qzuD-1xrcA:15.87"],["4UCK_B_SAMB2409_1","RNA-DIRECTED RNA POLYMERASE L","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"GLY A 264;GLU A  42;ASP A  20;ASP A  28","  K A 413 ( 4.5A);  K A 413 (-2.9A);None;None","0.96A","4uckB-1xrcA:undetectable","4uckB-1xrcA:20.93"],["5A1I_A_ADNA407_1","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.59A","5a1iA-1xrcA:54.0","5a1iA-1xrcA:54.84"],["5A1I_A_SAMA405_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;PHE A 230;ASP A 238","None","0.51A","5a1iA-1xrcA:54.0","5a1iA-1xrcA:54.84"],["5BMV_C_VLBC507_2","TUBULIN ALPHA-1B CHAIN","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"VAL A  52;ILE A  95;VAL A  26;ILE A  22","None","0.80A","5bmvC-1xrcA:undetectable","5bmvC-1xrcA:21.52"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ALA A  60;GLY A  54;THR A 242;GLU A  42","None;None;  K A 413 ( 4.7A);  K A 413 (-2.9A)","0.92A","5bs8A-1xrcA:1.3;5bs8C-1xrcA:1.3;5bs8D-1xrcA:undetectable","5bs8A-1xrcA:21.25;5bs8C-1xrcA:21.25;5bs8D-1xrcA:24.04"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ALA A  60;GLY A  54;THR A 242;GLU A  42","None;None;  K A 413 ( 4.7A);  K A 413 (-2.9A)","0.93A","5btgA-1xrcA:1.3;5btgB-1xrcA:undetectable;5btgC-1xrcA:1.3","5btgA-1xrcA:21.25;5btgB-1xrcA:24.04;5btgC-1xrcA:21.25"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"ALA A  60;GLY A  54;THR A 242;GLU A  42","None;None;  K A 413 ( 4.7A);  K A 413 (-2.9A)","0.93A","5btgA-1xrcA:1.3;5btgC-1xrcA:1.3;5btgD-1xrcA:undetectable","5btgA-1xrcA:21.25;5btgC-1xrcA:21.25;5btgD-1xrcA:24.04"],["5N9X_A_THRA601_0","ADENYLATION DOMAIN","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"PHE A 230;GLY A 234;GLY A  13;HIS A  14","None","1.05A","5n9xA-1xrcA:undetectable","5n9xA-1xrcA:20.71"],["5T8S_B_SAMB402_1","S-ADENOSYLMETHIONINE SYNTHASE","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",8,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;THR A 227;PHE A 230;ASP A 238","None","0.73A","5t8sB-1xrcA:58.3","5t8sB-1xrcA:67.68"],["5UXD_A_ZITA501_1","MACROLIDE 2'-PHOSPHOTRANSFERASE MPHH","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",4,"GLU A 368;ALA A 282;GLY A 124;TYR A 125","None","1.00A","5uxdA-1xrcA:undetectable","5uxdA-1xrcA:23.45"],["5Y2T_A_8LXA501_1","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",3,"SER A 263;HIS A 359;TYR A 276","None","1.05A","5y2tA-1xrcA:0.0","5y2tA-1xrcA:undetectable"],["6FBN_B_SAMB401_1","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.62A","6fbnB-1xrcA:51.3","6fbnB-1xrcA:54.59"],["6FBO_A_ADNA406_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.58A","6fboA-1xrcA:54.2","6fboA-1xrcA:43.36"],["6FBP_B_ADNB404_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.62A","6fbpA-1xrcA:54.8;6fbpB-1xrcA:52.9","6fbpA-1xrcA:43.36;6fbpB-1xrcA:43.36"],["6FCB_A_SAMA405_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.61A","6fcbA-1xrcA:54.4","6fcbA-1xrcA:54.59"],["6FCD_A_ADNA405_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",7,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;SER A 186;PHE A 230;ASP A 238","None","0.59A","6fcdA-1xrcA:54.0","6fcdA-1xrcA:43.36"],["6G6R_A_SAMA406_0","S-ADENOSYLMETHIONINE SYNTHASE ISOFORM TYPE-2","1xrc","S-ADENOSYLMETHIONINE SYNTHETASE","Escherichia coli",6,"HIS A  14;PRO A  15;ASP A 163;LYS A 165;PHE A 230;ASP A 238","None","0.52A","6g6rA-1xrcA:54.1","6g6rA-1xrcA:54.84"]]