SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '2lgw'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XCT_G_CPFG1020_1 (DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A)	2lgw	DNAJ HOMOLOG SUBFAMILY B MEMBER 2 (Homo sapiens)	3 / 3	ARG A 67 GLY A 69 SER A 3	None	0.62A	2xctB-2lgwA: undetectable	2xctB-2lgwA: 10.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z3O_F_MFXF101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE E-SITE DNA)	2lgw	DNAJ HOMOLOG SUBFAMILY B MEMBER 2 (Homo sapiens)	4 / 5	ARG A 67 GLY A 69 GLU A 71 SER A 3	None	0.98A	4z3oA-2lgwA: undetectable 4z3oB-2lgwA: undetectable	4z3oA-2lgwA: 9.70 4z3oB-2lgwA: 9.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	2lgw	DNAJ HOMOLOG SUBFAMILY B MEMBER 2 (Homo sapiens)	4 / 5	SER A 3 ARG A 67 GLY A 69 GLU A 71	None	1.00A	5btiA-2lgwA: undetectable 5btiB-2lgwA: undetectable	5btiA-2lgwA: 9.70 5btiB-2lgwA: 17.00

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["2XCT_G_CPFG1020_1","DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A","2lgw","DNAJ HOMOLOG SUBFAMILY B MEMBER 2","Homo sapiens",3,"ARG A  67;GLY A  69;SER A   3","None","0.62A","2xctB-2lgwA:undetectable","2xctB-2lgwA:10.83"],["4Z3O_F_MFXF101_1","DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;E-SITE DNA","2lgw","DNAJ HOMOLOG SUBFAMILY B MEMBER 2","Homo sapiens",4,"ARG A  67;GLY A  69;GLU A  71;SER A   3","None","0.98A","4z3oA-2lgwA:undetectable;4z3oB-2lgwA:undetectable","4z3oA-2lgwA:9.70;4z3oB-2lgwA:9.70"],["5BTI_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","2lgw","DNAJ HOMOLOG SUBFAMILY B MEMBER 2","Homo sapiens",4,"SER A   3;ARG A  67;GLY A  69;GLU A  71","None","1.00A","5btiA-2lgwA:undetectable;5btiB-2lgwA:undetectable","5btiA-2lgwA:9.70;5btiB-2lgwA:17.00"]]