SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '2q0x'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ISM_B_NCAB305_0 (BONE MARROW STROMAL CELL ANTIGEN 1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	LEU A 51 SER A 50 TRP A 43 PHE A 70	None	1.06A	1ismB-2q0xA: undetectable	1ismB-2q0xA: 21.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1V55_P_CHDP4271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE III CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.90A	1v55P-2q0xA: undetectable 1v55W-2q0xA: undetectable	1v55P-2q0xA: 23.31 1v55W-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DYS_C_CHDC310_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	1.02A	2dysC-2q0xA: undetectable 2dysJ-2q0xA: undetectable	2dysC-2q0xA: 23.31 2dysJ-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIJ_P_CHDP1271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.89A	2eijP-2q0xA: undetectable 2eijW-2q0xA: undetectable	2eijP-2q0xA: 23.31 2eijW-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIL_P_CHDP1271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 8	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.90A	2eilP-2q0xA: undetectable 2eilW-2q0xA: undetectable	2eilP-2q0xA: 23.31 2eilW-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F78_B_BEZB1004_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	SER A 77 ARG A 191 LEU A 192 THR A 117	None	1.17A	2f78B-2q0xA: undetectable	2f78B-2q0xA: 21.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XCT_X_CPFX1020_1 (DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 4	ARG A 172 GLY A 171 GLU A 170 SER A 82	None	1.23A	2xctS-2q0xA: 2.3 2xctU-2q0xA: 3.4	2xctS-2q0xA: 19.32 2xctU-2q0xA: 19.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZXW_C_CHDC271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.90A	2zxwC-2q0xA: undetectable 2zxwJ-2q0xA: undetectable	2zxwC-2q0xA: 23.31 2zxwJ-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZXW_P_CHDP1271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.89A	2zxwP-2q0xA: undetectable 2zxwW-2q0xA: undetectable	2zxwP-2q0xA: 23.31 2zxwW-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG1_C_CHDC271_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 3)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.96A	3ag1C-2q0xA: undetectable 3ag1J-2q0xA: undetectable	3ag1C-2q0xA: 23.31 3ag1J-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ASO_C_CHDC271_0 (CYTOCHROME C OXIDASE SUBUNIT 3 CYTOCHROME C OXIDASE SUBUNIT 7A1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 8	LEU A 288 GLN A 289 PHE A 290 LEU A 64	None	0.94A	3asoC-2q0xA: undetectable 3asoJ-2q0xA: undetectable	3asoC-2q0xA: 23.31 3asoJ-2q0xA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K9F_F_LFXF0_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	1.06A	3k9fA-2q0xA: undetectable 3k9fB-2q0xA: undetectable 3k9fC-2q0xA: 2.9	3k9fA-2q0xA: 23.06 3k9fB-2q0xA: 23.06 3k9fC-2q0xA: 20.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K9F_H_LFXH0_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	1.06A	3k9fA-2q0xA: undetectable 3k9fB-2q0xA: undetectable 3k9fD-2q0xA: 3.0	3k9fA-2q0xA: 23.06 3k9fB-2q0xA: 23.06 3k9fD-2q0xA: 20.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ONN_A_ACTA271_0 (PROTEIN SSM1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	GLY A 173 GLU A 174 GLY A 171 PRO A 84	None	1.08A	3onnA-2q0xA: 4.1	3onnA-2q0xA: 20.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RR3_A_FLRA700_1 (PROSTAGLANDIN G/H SYNTHASE 2)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	VAL A 138 LEU A 126 VAL A 44 ALA A 114 LEU A 140	None	1.03A	3rr3A-2q0xA: undetectable	3rr3A-2q0xA: 17.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RR3_B_FLRB700_1 (PROSTAGLANDIN G/H SYNTHASE 2)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	VAL A 138 LEU A 126 VAL A 44 ALA A 114 LEU A 140	None	1.03A	3rr3B-2q0xA: undetectable	3rr3B-2q0xA: 17.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3Z_A_9PLA501_1 (CYTOCHROME P450 2E1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	PHE A 123 LEU A 227 ALA A 114 LEU A 126	None	1.00A	3t3zA-2q0xA: undetectable	3t3zA-2q0xA: 22.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W67_B_VIVB301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	TRP A 68 LEU A 140 VAL A 75 ILE A 135 LEU A 125	None	1.03A	3w67B-2q0xA: undetectable	3w67B-2q0xA: 22.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W68_B_VIVB301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	TRP A 68 LEU A 140 VAL A 75 ILE A 135 LEU A 125	None	1.03A	3w68B-2q0xA: 2.5	3w68B-2q0xA: 22.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CCQ_A_ACTA1317_0 (THIOREDOXIN REDUCTASE)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	3 / 3	LEU A 126 GLU A 127 SER A 129	None	0.73A	4ccqA-2q0xA: undetectable	4ccqA-2q0xA: 23.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G5J_A_0WMA1102_1 (EPIDERMAL GROWTH FACTOR RECEPTOR)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	PHE A 54 TYR A 56 HIS A 283 ILE A 287	None GOL A 336 (-4.5A) None None	1.00A	4g5jA-2q0xA: undetectable	4g5jA-2q0xA: 22.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.83A	5btaA-2q0xA: undetectable 5btaC-2q0xA: undetectable 5btaD-2q0xA: 2.9	5btaA-2q0xA: 23.50 5btaC-2q0xA: 23.50 5btaD-2q0xA: 22.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.84A	5btaA-2q0xA: undetectable 5btaB-2q0xA: 3.6 5btaC-2q0xA: undetectable	5btaA-2q0xA: 23.50 5btaB-2q0xA: 22.13 5btaC-2q0xA: 23.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.86A	5btcA-2q0xA: undetectable 5btcC-2q0xA: undetectable 5btcD-2q0xA: 2.8	5btcA-2q0xA: 23.50 5btcC-2q0xA: 23.50 5btcD-2q0xA: 22.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.88A	5btcA-2q0xA: undetectable 5btcB-2q0xA: 2.8 5btcC-2q0xA: undetectable	5btcA-2q0xA: 23.50 5btcB-2q0xA: 22.13 5btcC-2q0xA: 23.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.84A	5btfA-2q0xA: undetectable 5btfB-2q0xA: 3.5 5btfC-2q0xA: undetectable	5btfA-2q0xA: 23.50 5btfB-2q0xA: 22.13 5btfC-2q0xA: 23.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 7	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.84A	5btfA-2q0xA: undetectable 5btfC-2q0xA: undetectable 5btfD-2q0xA: 2.5	5btfA-2q0xA: 23.50 5btfC-2q0xA: 23.50 5btfD-2q0xA: 22.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.93A	5btiA-2q0xA: undetectable 5btiB-2q0xA: 3.5	5btiA-2q0xA: 23.50 5btiB-2q0xA: 22.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.92A	5btiC-2q0xA: undetectable 5btiD-2q0xA: 3.6	5btiC-2q0xA: 23.50 5btiD-2q0xA: 22.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDQ_E_MFXE2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.94A	5cdqA-2q0xA: undetectable 5cdqB-2q0xA: 3.6 5cdqC-2q0xA: undetectable	5cdqA-2q0xA: 20.89 5cdqB-2q0xA: 20.94 5cdqC-2q0xA: 20.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDQ_V_MFXV2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 5	SER A 82 ARG A 172 GLY A 171 GLU A 170	None	0.94A	5cdqR-2q0xA: undetectable 5cdqS-2q0xA: 3.5 5cdqT-2q0xA: undetectable	5cdqR-2q0xA: 20.89 5cdqS-2q0xA: 20.94 5cdqT-2q0xA: 20.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HW8_F_FK5F201_1 (FK506-BINDING PROTEIN 1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	ASP A 95 ILE A 28 TYR A 20 ILE A 100 ILE A 135	None	0.99A	5hw8B-2q0xA: undetectable 5hw8F-2q0xA: undetectable 5hw8G-2q0xA: undetectable	5hw8B-2q0xA: 17.34 5hw8F-2q0xA: 17.34 5hw8G-2q0xA: 17.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HYR_B_ESTB601_1 (ESTROGEN RECEPTOR)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 11	LEU A 112 ALA A 111 MET A 107 LEU A 101 LEU A 64	None	1.19A	5hyrB-2q0xA: undetectable	5hyrB-2q0xA: 21.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKR_B_ID8B602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	LEU A 121 LEU A 126 VAL A 44 ALA A 114 LEU A 140	None	1.09A	5ikrB-2q0xA: undetectable	5ikrB-2q0xA: 20.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KOC_B_SAMB401_0 (PAVINE N-METHYLTRANSFERASE)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	6 / 12	PHE A 197 GLY A 118 VAL A 75 VAL A 122 LEU A 121 HIS A 87	None	1.31A	5kocB-2q0xA: undetectable	5kocB-2q0xA: 21.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6E5Z_A_CCSA106_0 (PROTEIN/NUCLEIC ACID DEGLYCASE DJ-1)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 10	GLU A 49 GLY A 45 GLY A 118 ALA A 114 HIS A 141	None	0.98A	6e5zA-2q0xA: undetectable	6e5zA-2q0xA: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA812_0 (GEPHYRIN)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	4 / 6	GLU A 109 ARG A 298 VAL A 225 PRO A 226	None	1.28A	6fgdA-2q0xA: 2.7	6fgdA-2q0xA: 22.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6J21_A_GBQA1201_0 (SUBSTANCE-P RECEPTOR,ENDOLYSIN)	2q0x	UNCHARACTERIZED PROTEIN (Trypanosoma brucei)	5 / 12	ILE A 139 VAL A 41 HIS A 283 PHE A 57 PHE A 54	None	1.31A	6j21A-2q0xA: undetectable	6j21A-2q0xA: 20.87

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1ISM_B_NCAB305_0","BONE MARROW STROMAL CELL ANTIGEN 1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A  51;SER A  50;TRP A  43;PHE A  70","None","1.06A","1ismB-2q0xA:undetectable","1ismB-2q0xA:21.19"],["1V55_P_CHDP4271_0","CYTOCHROME C OXIDASE POLYPEPTIDE III;CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.90A","1v55P-2q0xA:undetectable;1v55W-2q0xA:undetectable","1v55P-2q0xA:23.31;1v55W-2q0xA:11.41"],["2DYS_C_CHDC310_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","1.02A","2dysC-2q0xA:undetectable;2dysJ-2q0xA:undetectable","2dysC-2q0xA:23.31;2dysJ-2q0xA:11.41"],["2EIJ_P_CHDP1271_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.89A","2eijP-2q0xA:undetectable;2eijW-2q0xA:undetectable","2eijP-2q0xA:23.31;2eijW-2q0xA:11.41"],["2EIL_P_CHDP1271_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.90A","2eilP-2q0xA:undetectable;2eilW-2q0xA:undetectable","2eilP-2q0xA:23.31;2eilW-2q0xA:11.41"],["2F78_B_BEZB1004_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  77;ARG A 191;LEU A 192;THR A 117","None","1.17A","2f78B-2q0xA:undetectable","2f78B-2q0xA:21.11"],["2XCT_X_CPFX1020_1","DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"ARG A 172;GLY A 171;GLU A 170;SER A  82","None","1.23A","2xctS-2q0xA:2.3;2xctU-2q0xA:3.4","2xctS-2q0xA:19.32;2xctU-2q0xA:19.32"],["2ZXW_C_CHDC271_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.90A","2zxwC-2q0xA:undetectable;2zxwJ-2q0xA:undetectable","2zxwC-2q0xA:23.31;2zxwJ-2q0xA:11.41"],["2ZXW_P_CHDP1271_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.89A","2zxwP-2q0xA:undetectable;2zxwW-2q0xA:undetectable","2zxwP-2q0xA:23.31;2zxwW-2q0xA:11.41"],["3AG1_C_CHDC271_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 3","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.96A","3ag1C-2q0xA:undetectable;3ag1J-2q0xA:undetectable","3ag1C-2q0xA:23.31;3ag1J-2q0xA:11.41"],["3ASO_C_CHDC271_0","CYTOCHROME C OXIDASE SUBUNIT 3;CYTOCHROME C OXIDASE SUBUNIT 7A1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"LEU A 288;GLN A 289;PHE A 290;LEU A  64","None","0.94A","3asoC-2q0xA:undetectable;3asoJ-2q0xA:undetectable","3asoC-2q0xA:23.31;3asoJ-2q0xA:11.41"],["3K9F_F_LFXF0_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","1.06A","3k9fA-2q0xA:undetectable;3k9fB-2q0xA:undetectable;3k9fC-2q0xA:2.9","3k9fA-2q0xA:23.06;3k9fB-2q0xA:23.06;3k9fC-2q0xA:20.76"],["3K9F_H_LFXH0_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","1.06A","3k9fA-2q0xA:undetectable;3k9fB-2q0xA:undetectable;3k9fD-2q0xA:3.0","3k9fA-2q0xA:23.06;3k9fB-2q0xA:23.06;3k9fD-2q0xA:20.76"],["3ONN_A_ACTA271_0","PROTEIN SSM1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"GLY A 173;GLU A 174;GLY A 171;PRO A  84","None","1.08A","3onnA-2q0xA:4.1","3onnA-2q0xA:20.17"],["3RR3_A_FLRA700_1","PROSTAGLANDIN G\/H SYNTHASE 2","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"VAL A 138;LEU A 126;VAL A  44;ALA A 114;LEU A 140","None","1.03A","3rr3A-2q0xA:undetectable","3rr3A-2q0xA:17.94"],["3RR3_B_FLRB700_1","PROSTAGLANDIN G\/H SYNTHASE 2","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"VAL A 138;LEU A 126;VAL A  44;ALA A 114;LEU A 140","None","1.03A","3rr3B-2q0xA:undetectable","3rr3B-2q0xA:17.94"],["3T3Z_A_9PLA501_1","CYTOCHROME P450 2E1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"PHE A 123;LEU A 227;ALA A 114;LEU A 126","None","1.00A","3t3zA-2q0xA:undetectable","3t3zA-2q0xA:22.54"],["3W67_B_VIVB301_0","ALPHA-TOCOPHEROL TRANSFER PROTEIN","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"TRP A  68;LEU A 140;VAL A  75;ILE A 135;LEU A 125","None","1.03A","3w67B-2q0xA:undetectable","3w67B-2q0xA:22.32"],["3W68_B_VIVB301_0","ALPHA-TOCOPHEROL TRANSFER PROTEIN","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"TRP A  68;LEU A 140;VAL A  75;ILE A 135;LEU A 125","None","1.03A","3w68B-2q0xA:2.5","3w68B-2q0xA:22.32"],["4CCQ_A_ACTA1317_0","THIOREDOXIN REDUCTASE","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",3,"LEU A 126;GLU A 127;SER A 129","None","0.73A","4ccqA-2q0xA:undetectable","4ccqA-2q0xA:23.14"],["4G5J_A_0WMA1102_1","EPIDERMAL GROWTH FACTOR RECEPTOR","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"PHE A  54;TYR A  56;HIS A 283;ILE A 287","None;GOL A 336 (-4.5A);None;None","1.00A","4g5jA-2q0xA:undetectable","4g5jA-2q0xA:22.07"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.83A","5btaA-2q0xA:undetectable;5btaC-2q0xA:undetectable;5btaD-2q0xA:2.9","5btaA-2q0xA:23.50;5btaC-2q0xA:23.50;5btaD-2q0xA:22.13"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.84A","5btaA-2q0xA:undetectable;5btaB-2q0xA:3.6;5btaC-2q0xA:undetectable","5btaA-2q0xA:23.50;5btaB-2q0xA:22.13;5btaC-2q0xA:23.50"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.86A","5btcA-2q0xA:undetectable;5btcC-2q0xA:undetectable;5btcD-2q0xA:2.8","5btcA-2q0xA:23.50;5btcC-2q0xA:23.50;5btcD-2q0xA:22.13"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.88A","5btcA-2q0xA:undetectable;5btcB-2q0xA:2.8;5btcC-2q0xA:undetectable","5btcA-2q0xA:23.50;5btcB-2q0xA:22.13;5btcC-2q0xA:23.50"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.84A","5btfA-2q0xA:undetectable;5btfB-2q0xA:3.5;5btfC-2q0xA:undetectable","5btfA-2q0xA:23.50;5btfB-2q0xA:22.13;5btfC-2q0xA:23.50"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.84A","5btfA-2q0xA:undetectable;5btfC-2q0xA:undetectable;5btfD-2q0xA:2.5","5btfA-2q0xA:23.50;5btfC-2q0xA:23.50;5btfD-2q0xA:22.13"],["5BTI_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.93A","5btiA-2q0xA:undetectable;5btiB-2q0xA:3.5","5btiA-2q0xA:23.50;5btiB-2q0xA:22.13"],["5BTI_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.92A","5btiC-2q0xA:undetectable;5btiD-2q0xA:3.6","5btiC-2q0xA:23.50;5btiD-2q0xA:22.13"],["5CDQ_E_MFXE2101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.94A","5cdqA-2q0xA:undetectable;5cdqB-2q0xA:3.6;5cdqC-2q0xA:undetectable","5cdqA-2q0xA:20.89;5cdqB-2q0xA:20.94;5cdqC-2q0xA:20.89"],["5CDQ_V_MFXV2101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"SER A  82;ARG A 172;GLY A 171;GLU A 170","None","0.94A","5cdqR-2q0xA:undetectable;5cdqS-2q0xA:3.5;5cdqT-2q0xA:undetectable","5cdqR-2q0xA:20.89;5cdqS-2q0xA:20.94;5cdqT-2q0xA:20.89"],["5HW8_F_FK5F201_1","FK506-BINDING PROTEIN 1;FK506-BINDING PROTEIN 1;FK506-BINDING PROTEIN 1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"ASP A  95;ILE A  28;TYR A  20;ILE A 100;ILE A 135","None","0.99A","5hw8B-2q0xA:undetectable;5hw8F-2q0xA:undetectable;5hw8G-2q0xA:undetectable","5hw8B-2q0xA:17.34;5hw8F-2q0xA:17.34;5hw8G-2q0xA:17.34"],["5HYR_B_ESTB601_1","ESTROGEN RECEPTOR","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"LEU A 112;ALA A 111;MET A 107;LEU A 101;LEU A  64","None","1.19A","5hyrB-2q0xA:undetectable","5hyrB-2q0xA:21.84"],["5IKR_B_ID8B602_1","PROSTAGLANDIN G\/H SYNTHASE 2","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"LEU A 121;LEU A 126;VAL A  44;ALA A 114;LEU A 140","None","1.09A","5ikrB-2q0xA:undetectable","5ikrB-2q0xA:20.57"],["5KOC_B_SAMB401_0","PAVINE N-METHYLTRANSFERASE","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",6,"PHE A 197;GLY A 118;VAL A  75;VAL A 122;LEU A 121;HIS A  87","None","1.31A","5kocB-2q0xA:undetectable","5kocB-2q0xA:21.10"],["6E5Z_A_CCSA106_0","PROTEIN\/NUCLEIC ACID DEGLYCASE DJ-1","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"GLU A  49;GLY A  45;GLY A 118;ALA A 114;HIS A 141","None","0.98A","6e5zA-2q0xA:undetectable","6e5zA-2q0xA:21.41"],["6FGD_A_ACTA812_0","GEPHYRIN","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",4,"GLU A 109;ARG A 298;VAL A 225;PRO A 226","None","1.28A","6fgdA-2q0xA:2.7","6fgdA-2q0xA:22.32"],["6J21_A_GBQA1201_0","SUBSTANCE-P RECEPTOR,ENDOLYSIN","2q0x","UNCHARACTERIZED PROTEIN","Trypanosoma brucei",5,"ILE A 139;VAL A  41;HIS A 283;PHE A  57;PHE A  54","None","1.31A","6j21A-2q0xA:undetectable","6j21A-2q0xA:20.87"]]