SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '2uvf'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1G5Y_C_9CRC502_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 10	LEU A 171 SER A 220 LEU A 201 ALA A 200 PHE A 162	None	1.19A	1g5yC-2uvfA: undetectable	1g5yC-2uvfA: 17.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P91_A_SAMA1401_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE A)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 11	GLY A 219 GLY A 271 ILE A 216 TYR A 196 PRO A 192	None	1.17A	1p91A-2uvfA: undetectable	1p91A-2uvfA: 17.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1V55_W_CHDW4060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE I CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.87A	1v55N-2uvfA: undetectable 1v55W-2uvfA: undetectable	1v55N-2uvfA: 22.56 1v55W-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AZX_A_TRPA601_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	TYR A 510 GLY A 412 GLY A 475 THR A 444 ILE A 508	None	1.03A	2azxA-2uvfA: undetectable	2azxA-2uvfA: 22.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AZX_B_TRPB603_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	THR A 411 GLY A 410 GLY A 386 GLU A 361 GLN A 418	None	1.26A	2azxB-2uvfA: undetectable	2azxB-2uvfA: 22.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIJ_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.85A	2eijN-2uvfA: undetectable 2eijW-2uvfA: undetectable	2eijN-2uvfA: 22.56 2eijW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIK_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.89A	2eikA-2uvfA: undetectable 2eikJ-2uvfA: undetectable	2eikA-2uvfA: 22.56 2eikJ-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIK_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.85A	2eikN-2uvfA: undetectable 2eikW-2uvfA: undetectable	2eikN-2uvfA: 22.56 2eikW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIL_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.85A	2eilN-2uvfA: undetectable 2eilW-2uvfA: undetectable	2eilN-2uvfA: 22.56 2eilW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIM_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	TYR A 375 MET A 433 THR A 461 LEU A 460	None	1.45A	2eimJ-2uvfA: undetectable	2eimJ-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIN_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.79A	2einA-2uvfA: undetectable 2einJ-2uvfA: undetectable	2einA-2uvfA: 22.56 2einJ-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJG_B_ADNB1502_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	GLU A 61 LYS A 58 ASN A 455 ALA A 59	None	1.43A	2ejgB-2uvfA: undetectable	2ejgB-2uvfA: 17.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F80_B_017B301_2 (POL POLYPROTEIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	LEU A 333 ALA A 377 ASN A 378 GLY A 305 ILE A 306	None None SO4 A1612 (-3.2A) None None	0.93A	2f80B-2uvfA: undetectable	2f80B-2uvfA: 10.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IVU_A_ZD6A3015_1 (PROTO-ONCOGENE TYROSINE-PROTEIN KINASE RECEPTOR RET PRECURSOR)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	ALA A 513 GLY A 410 SER A 469	None	0.57A	2ivuA-2uvfA: undetectable	2ivuA-2uvfA: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7H_B_SAMB530_1 (TYPE I RESTRICTION ENZYME ECOKI M PROTEIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	TYR A 233 GLU A 361 THR A 335	None	0.62A	2y7hB-2uvfA: undetectable	2y7hB-2uvfA: 23.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A50_D_VD3D2001_1 (VITAMIN D HYDROXYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	ILE A 191 LEU A 211 LEU A 203 ILE A 180 ALA A 179	None	1.08A	3a50D-2uvfA: undetectable	3a50D-2uvfA: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ABK_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.86A	3abkA-2uvfA: undetectable 3abkJ-2uvfA: undetectable	3abkA-2uvfA: 22.56 3abkJ-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ABL_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.91A	3ablN-2uvfA: undetectable 3ablW-2uvfA: undetectable	3ablN-2uvfA: 22.56 3ablW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ABM_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.88A	3abmN-2uvfA: undetectable 3abmW-2uvfA: undetectable	3abmN-2uvfA: 22.56 3abmW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG2_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	TYR A 375 MET A 433 THR A 461 LEU A 460	None	1.44A	3ag2J-2uvfA: undetectable	3ag2J-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG3_W_CHDW1059_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.86A	3ag3N-2uvfA: 0.0 3ag3W-2uvfA: undetectable	3ag3N-2uvfA: 22.56 3ag3W-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG4_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	TYR A 375 MET A 433 THR A 461 LEU A 460	None	1.43A	3ag4J-2uvfA: undetectable	3ag4J-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ASN_W_CHDW1059_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.90A	3asnN-2uvfA: undetectable 3asnW-2uvfA: undetectable	3asnN-2uvfA: 22.56 3asnW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ASO_W_CHDW1059_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.89A	3asoN-2uvfA: undetectable 3asoW-2uvfA: undetectable	3asoN-2uvfA: 22.56 3asoW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3D9L_A_ACTA501_0 (CTD-PEPTIDE RNA-BINDING PROTEIN 16)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	PRO A 90 PRO A 93 TYR A 94 TYR A 430	SO4 A1611 (-3.6A) None SO4 A1610 (-3.9A) None	1.02A	3d9lA-2uvfA: undetectable 3d9lY-2uvfA: undetectable	3d9lA-2uvfA: 13.32 3d9lY-2uvfA: 2.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DCJ_B_THHB401_0 (PROBABLE 5'-PHOSPHORIBOSYLGLY CINAMIDE FORMYLTRANSFERASE PURN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	SER A 388 ILE A 383 ASN A 362 VAL A 365	None	0.70A	3dcjB-2uvfA: undetectable	3dcjB-2uvfA: 17.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DDY_A_RBFA187_1 (LUMAZINE PROTEIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	THR A 173 ILE A 180 ASP A 181 GLN A 178 ALA A 179	None	1.11A	3ddyA-2uvfA: undetectable	3ddyA-2uvfA: 15.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3H0A_A_9RAA500_2 (RETINOIC ACID RECEPTOR RXR-ALPHA)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	ILE A 448 PHE A 519 HIS A 443	None None AD0 A1617 (-3.8A)	0.70A	3h0aA-2uvfA: undetectable	3h0aA-2uvfA: 16.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LZV_A_017A200_1 (HIV-1 PROTEASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 10	LEU A 333 ALA A 377 ASN A 378 GLY A 305 ILE A 306	None None SO4 A1612 (-3.2A) None None	0.92A	3lzvA-2uvfA: undetectable	3lzvA-2uvfA: 10.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NDI_A_SAMA601_1 (METHYLTRANSFERASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 9	GLY A 346 ASN A 368 PRO A 90 SER A 89 HIS A 372	None None SO4 A1611 (-3.6A) None None	1.45A	3ndiA-2uvfA: 0.4	3ndiA-2uvfA: 22.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RAE_F_LFXF101_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 4	SER A 236 GLY A 386 GLU A 449	None	0.67A	3raeA-2uvfA: undetectable 3raeC-2uvfA: undetectable	3raeA-2uvfA: 21.73 3raeC-2uvfA: 18.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SPK_A_TPVA100_2 (HIV-1 PROTEASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	LEU A 333 ALA A 377 GLY A 305 ILE A 306	None	0.74A	3spkB-2uvfA: undetectable	3spkB-2uvfA: 9.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUD_B_SUEB1201_1 (NS3 PROTEASE, NS4A PROTEIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	6 / 12	GLN A 418 TYR A 510 GLY A 410 GLY A 386 ALA A 408 SER A 332	None None None None AD0 A1617 ( 3.8A) None	1.42A	3sudB-2uvfA: undetectable	3sudB-2uvfA: 16.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3R_C_9PLC501_1 (CYTOCHROME P450 2A6)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 9	PHE A 431 PHE A 407 ASN A 456 ILE A 438 PHE A 385	None	1.44A	3t3rC-2uvfA: undetectable	3t3rC-2uvfA: 21.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_A_RTZA1_1 (CYTOCHROME P450 2D6)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	LEU A 460 GLY A 287 LEU A 286 GLU A 285 ASP A 399	None	1.27A	3tbgA-2uvfA: undetectable	3tbgA-2uvfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_C_RTZC1_1 (CYTOCHROME P450 2D6)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	LEU A 460 GLY A 287 LEU A 286 GLU A 285 ASP A 399	None	1.27A	3tbgC-2uvfA: undetectable	3tbgC-2uvfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TEH_B_DAHB786_1 (PHENYLALANYL-TRNA SYNTHETASE BETA CHAIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	HIS A 443 LEU A 232 GLY A 412 ALA A 415	AD0 A1617 (-3.8A) AD0 A1617 (-4.7A) None None	0.94A	3tehB-2uvfA: undetectable	3tehB-2uvfA: 21.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UQ6_B_ADNB401_2 (ADENOSINE KINASE, PUTATIVE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	LEU A 333 GLY A 356 PHE A 347 ASN A 359	None	1.05A	3uq6B-2uvfA: undetectable	3uq6B-2uvfA: 20.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C5N_A_PXLA300_1 (PHOSPHOMETHYLPYRIMID INE KINASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	GLY A 464 ASP A 462 GLY A 436 CYH A 404	None	0.58A	4c5nA-2uvfA: undetectable	4c5nA-2uvfA: 18.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C5N_C_PXLC300_1 (PHOSPHOMETHYLPYRIMID INE KINASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	GLY A 464 ASP A 462 GLY A 436 CYH A 404	None	0.59A	4c5nC-2uvfA: undetectable	4c5nC-2uvfA: 18.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CEV_A_GAIA407_0 (PROTEIN (ARGINASE))	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 6	GLU A 285 LEU A 460 MET A 433 ASP A 399	None	1.49A	4cevA-2uvfA: undetectable 4cevB-2uvfA: undetectable	4cevA-2uvfA: 18.95 4cevB-2uvfA: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FGL_D_CLQD303_0 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ASN A 362 GLY A 338 VAL A 339 ILE A 248	None	0.86A	4fglC-2uvfA: undetectable	4fglC-2uvfA: 16.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OKB_A_198A1002_2 (ANDROGEN RECEPTOR)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 6	LEU A 201 ASN A 246 LEU A 209 VAL A 342	None	1.17A	4okbA-2uvfA: undetectable	4okbA-2uvfA: 16.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZDY_A_1YNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	GLY A 401 TYR A 459 GLY A 287 THR A 283 THR A 374	NI A1614 (-3.7A) None None None None	1.18A	4zdyA-2uvfA: undetectable	4zdyA-2uvfA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZJO_D_ERYD1101_0 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 11	TYR A 235 SER A 236 GLU A 419 THR A 411 GLY A 410	None	1.35A	4zjoD-2uvfA: undetectable	4zjoD-2uvfA: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_F_SORF1343_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ARG A 276 PHE A 397 ARG A 432 ASP A 399	NI A1615 (-4.5A) SO4 A1610 (-2.9A) None None	1.46A	5a06F-2uvfA: undetectable	5a06F-2uvfA: 21.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B1B_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.91A	5b1bN-2uvfA: undetectable 5b1bW-2uvfA: undetectable	5b1bN-2uvfA: 22.56 5b1bW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B3S_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.92A	5b3sN-2uvfA: undetectable 5b3sW-2uvfA: undetectable	5b3sN-2uvfA: 22.56 5b3sW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ASP A 399 ARG A 432 GLU A 285 ARG A 350	None	0.98A	5bs8A-2uvfA: undetectable 5bs8B-2uvfA: undetectable 5bs8C-2uvfA: undetectable	5bs8A-2uvfA: 22.71 5bs8B-2uvfA: 18.70 5bs8C-2uvfA: 22.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ASP A 399 ARG A 432 GLU A 285 ARG A 350	None	0.97A	5btdA-2uvfA: undetectable 5btdB-2uvfA: undetectable 5btdC-2uvfA: undetectable	5btdA-2uvfA: 22.71 5btdB-2uvfA: 18.70 5btdC-2uvfA: 22.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ARG A 350 ASP A 399 ARG A 432 GLU A 285	None	0.97A	5btdA-2uvfA: undetectable 5btdC-2uvfA: undetectable 5btdD-2uvfA: undetectable	5btdA-2uvfA: 22.71 5btdC-2uvfA: 22.71 5btdD-2uvfA: 18.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ASP A 399 ARG A 432 GLU A 285 ARG A 350	None	0.99A	5btfA-2uvfA: undetectable 5btfB-2uvfA: undetectable 5btfC-2uvfA: undetectable	5btfA-2uvfA: 22.86 5btfB-2uvfA: 18.70 5btfC-2uvfA: 22.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	ARG A 350 ASP A 399 ARG A 432 GLU A 285	None	1.00A	5btfA-2uvfA: undetectable 5btfC-2uvfA: undetectable 5btfD-2uvfA: undetectable	5btfA-2uvfA: 22.86 5btfC-2uvfA: 22.86 5btfD-2uvfA: 18.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EQB_A_1YNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	GLY A 346 ILE A 165 GLY A 163 LEU A 217 THR A 264	None	0.94A	5eqbA-2uvfA: undetectable	5eqbA-2uvfA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESL_A_1YNA701_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	GLY A 401 TYR A 459 GLY A 287 THR A 283 THR A 374	NI A1614 (-3.7A) None None None None	1.19A	5eslA-2uvfA: undetectable	5eslA-2uvfA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5G08_A_Z80A1187_1 (FREQUENIN 2)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 6	PHE A 482 PHE A 577 THR A 567 TRP A 591	None	1.21A	5g08A-2uvfA: undetectable	5g08A-2uvfA: 15.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5H3A_A_D16A401_1 (ORF70)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	PHE A 385 ILE A 405 GLY A 441 PHE A 407	None None AD0 A1617 (-4.6A) None	0.77A	5h3aA-2uvfA: undetectable	5h3aA-2uvfA: 18.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HIK_A_SAMA301_0 (GLYCINE SARCOSINE N-METHYLTRANSFERASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	ARG A 330 GLY A 441 SER A 442 GLY A 380 HIS A 435	None AD0 A1617 (-4.6A) AD0 A1617 (-3.4A) None NI A1614 ( 3.4A)	0.97A	5hikA-2uvfA: undetectable	5hikA-2uvfA: 18.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HNZ_B_TA1B902_2 (TUBULIN BETA-2B CHAIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	LEU A 201 LEU A 217 ARG A 330	None	0.59A	5hnzB-2uvfA: undetectable	5hnzB-2uvfA: 20.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IY5_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 7	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.87A	5iy5N-2uvfA: undetectable 5iy5W-2uvfA: undetectable	5iy5N-2uvfA: 22.56 5iy5W-2uvfA: 9.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JLC_A_1YNA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	TYR A 230 GLY A 229 GLY A 265 LEU A 333	None	0.86A	5jlcA-2uvfA: undetectable	5jlcA-2uvfA: 22.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QGK_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	VAL A 130 TYR A 69 GLN A 70	None	0.68A	5qgkA-2uvfA: undetectable	5qgkA-2uvfA: 15.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QGR_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	VAL A 130 TYR A 69 GLN A 70	None	0.65A	5qgrA-2uvfA: undetectable	5qgrA-2uvfA: 15.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QGT_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	VAL A 130 TYR A 69 GLN A 70	None	0.67A	5qgtA-2uvfA: undetectable	5qgtA-2uvfA: 15.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5T8H_B_478B401_2 (PROTEASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	LEU A 465 ALA A 453 ILE A 405 GLY A 423 ILE A 438	None	0.90A	5t8hB-2uvfA: undetectable	5t8hB-2uvfA: 11.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5U63_A_ACTA406_0 (THIOREDOXIN REDUCTASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	3 / 3	HIS A 555 SER A 575 ARG A 552	None	0.94A	5u63A-2uvfA: undetectable	5u63A-2uvfA: 20.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VC0_A_RITA602_1 (CYTOCHROME P450 3A4)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	ARG A 350 LEU A 171 ILE A 176 ALA A 164 ALA A 193	None	1.16A	5vc0A-2uvfA: undetectable	5vc0A-2uvfA: 21.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XDH_B_DAHB60_1 (PUTATIVE CYTOCHROME C)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	HIS A 372 MET A 334 ASN A 406 LEU A 333	None None AD0 A1617 (-3.0A) None	1.38A	5xdhB-2uvfA: 0.0	5xdhB-2uvfA: 9.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XDH_C_DAHC60_1 (PUTATIVE CYTOCHROME C)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 6	HIS A 372 MET A 334 ASN A 406 LEU A 333	None None AD0 A1617 (-3.0A) None	1.33A	5xdhA-2uvfA: undetectable 5xdhC-2uvfA: undetectable	5xdhA-2uvfA: 9.52 5xdhC-2uvfA: 9.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XDH_D_DAHD60_1 (PUTATIVE CYTOCHROME C)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 5	HIS A 372 MET A 334 ASN A 406 LEU A 333	None None AD0 A1617 (-3.0A) None	1.46A	5xdhD-2uvfA: undetectable	5xdhD-2uvfA: 9.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XDX_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT VIIA-HEART)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.93A	5xdxN-2uvfA: undetectable 5xdxW-2uvfA: undetectable	5xdxN-2uvfA: 22.56 5xdxW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YN6_A_SAMA401_0 (NSP16 PROTEIN)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	GLY A 380 GLY A 434 ASN A 351 ASP A 402 PHE A 354	None None None AD0 A1617 (-3.1A) AD0 A1617 ( 4.9A)	1.32A	5yn6A-2uvfA: undetectable	5yn6A-2uvfA: 20.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZCO_J_CHDJ101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.90A	5zcoA-2uvfA: undetectable 5zcoJ-2uvfA: undetectable	5zcoA-2uvfA: 22.56 5zcoJ-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZCP_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.89A	5zcpN-2uvfA: undetectable 5zcpW-2uvfA: undetectable	5zcpN-2uvfA: 22.56 5zcpW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZCQ_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 8	PHE A 347 MET A 334 THR A 335 LEU A 336	None	0.91A	5zcqN-2uvfA: undetectable 5zcqW-2uvfA: undetectable	5zcqN-2uvfA: 22.56 5zcqW-2uvfA: 8.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6D9H_R_ADNR400_1 (CHIMERA PROTEIN OF MUSCARINIC ACETYLCHOLINE RECEPTOR M4 AND ADENOSINE RECEPTOR A1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 10	VAL A 365 PHE A 385 LEU A 370 ASN A 396 ILE A 357	None	1.43A	6d9hR-2uvfA: undetectable	6d9hR-2uvfA: 7.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6E8Q_A_X2NA602_0 (LANOSTEROL 14-ALPHA DEMETHYLASE)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	5 / 12	GLY A 401 TYR A 459 GLY A 287 THR A 283 THR A 374	NI A1614 (-3.7A) None None None None	1.16A	6e8qA-2uvfA: undetectable	6e8qA-2uvfA: 8.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HU9_Q_PCFQ202_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 5A, MITOCHONDRIAL CYTOCHROME C OXIDASE SUBUNIT 1)	2uvf	EXOPOLYGALACTURONASE (Yersinia enterocolitica)	4 / 6	ILE A 282 ALA A 277 ARG A 276 ASP A 270	None None NI A1615 (-4.5A) NI A1615 (-3.9A)	1.14A	6hu9m-2uvfA: undetectable 6hu9q-2uvfA: undetectable	6hu9m-2uvfA: 23.78 6hu9q-2uvfA: 12.29

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1G5Y_C_9CRC502_1","RETINOIC ACID RECEPTOR RXR-ALPHA","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 171;SER A 220;LEU A 201;ALA A 200;PHE A 162","None","1.19A","1g5yC-2uvfA:undetectable","1g5yC-2uvfA:17.50"],["1P91_A_SAMA1401_0","RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE A","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 219;GLY A 271;ILE A 216;TYR A 196;PRO A 192","None","1.17A","1p91A-2uvfA:undetectable","1p91A-2uvfA:17.84"],["1V55_W_CHDW4060_0","CYTOCHROME C OXIDASE POLYPEPTIDE I;CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.87A","1v55N-2uvfA:undetectable;1v55W-2uvfA:undetectable","1v55N-2uvfA:22.56;1v55W-2uvfA:8.13"],["2AZX_A_TRPA601_0","TRYPTOPHANYL-TRNA SYNTHETASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"TYR A 510;GLY A 412;GLY A 475;THR A 444;ILE A 508","None","1.03A","2azxA-2uvfA:undetectable","2azxA-2uvfA:22.03"],["2AZX_B_TRPB603_0","TRYPTOPHANYL-TRNA SYNTHETASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"THR A 411;GLY A 410;GLY A 386;GLU A 361;GLN A 418","None","1.26A","2azxB-2uvfA:undetectable","2azxB-2uvfA:22.03"],["2EIJ_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.85A","2eijN-2uvfA:undetectable;2eijW-2uvfA:undetectable","2eijN-2uvfA:22.56;2eijW-2uvfA:8.13"],["2EIK_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.89A","2eikA-2uvfA:undetectable;2eikJ-2uvfA:undetectable","2eikA-2uvfA:22.56;2eikJ-2uvfA:8.13"],["2EIK_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.85A","2eikN-2uvfA:undetectable;2eikW-2uvfA:undetectable","2eikN-2uvfA:22.56;2eikW-2uvfA:8.13"],["2EIL_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.85A","2eilN-2uvfA:undetectable;2eilW-2uvfA:undetectable","2eilN-2uvfA:22.56;2eilW-2uvfA:8.13"],["2EIM_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"TYR A 375;MET A 433;THR A 461;LEU A 460","None","1.45A","2eimJ-2uvfA:undetectable","2eimJ-2uvfA:8.13"],["2EIN_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.79A","2einA-2uvfA:undetectable;2einJ-2uvfA:undetectable","2einA-2uvfA:22.56;2einJ-2uvfA:8.13"],["2EJG_B_ADNB1502_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"GLU A  61;LYS A  58;ASN A 455;ALA A  59","None","1.43A","2ejgB-2uvfA:undetectable","2ejgB-2uvfA:17.56"],["2F80_B_017B301_2","POL POLYPROTEIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 333;ALA A 377;ASN A 378;GLY A 305;ILE A 306","None;None;SO4 A1612 (-3.2A);None;None","0.93A","2f80B-2uvfA:undetectable","2f80B-2uvfA:10.05"],["2IVU_A_ZD6A3015_1","PROTO-ONCOGENE TYROSINE-PROTEIN KINASE RECEPTOR RET PRECURSOR","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"ALA A 513;GLY A 410;SER A 469","None","0.57A","2ivuA-2uvfA:undetectable","2ivuA-2uvfA:20.53"],["2Y7H_B_SAMB530_1","TYPE I RESTRICTION ENZYME ECOKI M PROTEIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"TYR A 233;GLU A 361;THR A 335","None","0.62A","2y7hB-2uvfA:undetectable","2y7hB-2uvfA:23.50"],["3A50_D_VD3D2001_1","VITAMIN D HYDROXYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"ILE A 191;LEU A 211;LEU A 203;ILE A 180;ALA A 179","None","1.08A","3a50D-2uvfA:undetectable","3a50D-2uvfA:21.74"],["3ABK_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.86A","3abkA-2uvfA:undetectable;3abkJ-2uvfA:undetectable","3abkA-2uvfA:22.56;3abkJ-2uvfA:8.13"],["3ABL_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.91A","3ablN-2uvfA:undetectable;3ablW-2uvfA:undetectable","3ablN-2uvfA:22.56;3ablW-2uvfA:8.13"],["3ABM_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.88A","3abmN-2uvfA:undetectable;3abmW-2uvfA:undetectable","3abmN-2uvfA:22.56;3abmW-2uvfA:8.13"],["3AG2_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"TYR A 375;MET A 433;THR A 461;LEU A 460","None","1.44A","3ag2J-2uvfA:undetectable","3ag2J-2uvfA:8.13"],["3AG3_W_CHDW1059_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.86A","3ag3N-2uvfA:0.0;3ag3W-2uvfA:undetectable","3ag3N-2uvfA:22.56;3ag3W-2uvfA:8.13"],["3AG4_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"TYR A 375;MET A 433;THR A 461;LEU A 460","None","1.43A","3ag4J-2uvfA:undetectable","3ag4J-2uvfA:8.13"],["3ASN_W_CHDW1059_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.90A","3asnN-2uvfA:undetectable;3asnW-2uvfA:undetectable","3asnN-2uvfA:22.56;3asnW-2uvfA:8.13"],["3ASO_W_CHDW1059_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.89A","3asoN-2uvfA:undetectable;3asoW-2uvfA:undetectable","3asoN-2uvfA:22.56;3asoW-2uvfA:8.13"],["3D9L_A_ACTA501_0","CTD-PEPTIDE;RNA-BINDING PROTEIN 16","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PRO A  90;PRO A  93;TYR A  94;TYR A 430","SO4 A1611 (-3.6A);None;SO4 A1610 (-3.9A);None","1.02A","3d9lA-2uvfA:undetectable;3d9lY-2uvfA:undetectable","3d9lA-2uvfA:13.32;3d9lY-2uvfA:2.60"],["3DCJ_B_THHB401_0","PROBABLE 5'-PHOSPHORIBOSYLGLYCINAMIDE FORMYLTRANSFERASE PURN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"SER A 388;ILE A 383;ASN A 362;VAL A 365","None","0.70A","3dcjB-2uvfA:undetectable","3dcjB-2uvfA:17.69"],["3DDY_A_RBFA187_1","LUMAZINE PROTEIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"THR A 173;ILE A 180;ASP A 181;GLN A 178;ALA A 179","None","1.11A","3ddyA-2uvfA:undetectable","3ddyA-2uvfA:15.91"],["3H0A_A_9RAA500_2","RETINOIC ACID RECEPTOR RXR-ALPHA","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"ILE A 448;PHE A 519;HIS A 443","None;None;AD0 A1617 (-3.8A)","0.70A","3h0aA-2uvfA:undetectable","3h0aA-2uvfA:16.45"],["3LZV_A_017A200_1","HIV-1 PROTEASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 333;ALA A 377;ASN A 378;GLY A 305;ILE A 306","None;None;SO4 A1612 (-3.2A);None;None","0.92A","3lzvA-2uvfA:undetectable","3lzvA-2uvfA:10.57"],["3NDI_A_SAMA601_1","METHYLTRANSFERASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 346;ASN A 368;PRO A  90;SER A  89;HIS A 372","None;None;SO4 A1611 (-3.6A);None;None","1.45A","3ndiA-2uvfA:0.4","3ndiA-2uvfA:22.19"],["3RAE_F_LFXF101_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"SER A 236;GLY A 386;GLU A 449","None","0.67A","3raeA-2uvfA:undetectable;3raeC-2uvfA:undetectable","3raeA-2uvfA:21.73;3raeC-2uvfA:18.94"],["3SPK_A_TPVA100_2","HIV-1 PROTEASE;HIV-1 PROTEASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"LEU A 333;ALA A 377;GLY A 305;ILE A 306","None","0.74A","3spkB-2uvfA:undetectable","3spkB-2uvfA:9.38"],["3SUD_B_SUEB1201_1","NS3 PROTEASE, NS4A PROTEIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",6,"GLN A 418;TYR A 510;GLY A 410;GLY A 386;ALA A 408;SER A 332","None;None;None;None;AD0 A1617 ( 3.8A);None","1.42A","3sudB-2uvfA:undetectable","3sudB-2uvfA:16.00"],["3T3R_C_9PLC501_1","CYTOCHROME P450 2A6","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"PHE A 431;PHE A 407;ASN A 456;ILE A 438;PHE A 385","None","1.44A","3t3rC-2uvfA:undetectable","3t3rC-2uvfA:21.08"],["3TBG_A_RTZA1_1","CYTOCHROME P450 2D6","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 460;GLY A 287;LEU A 286;GLU A 285;ASP A 399","None","1.27A","3tbgA-2uvfA:undetectable","3tbgA-2uvfA:19.22"],["3TBG_C_RTZC1_1","CYTOCHROME P450 2D6","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 460;GLY A 287;LEU A 286;GLU A 285;ASP A 399","None","1.27A","3tbgC-2uvfA:undetectable","3tbgC-2uvfA:19.22"],["3TEH_B_DAHB786_1","PHENYLALANYL-TRNA SYNTHETASE BETA CHAIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"HIS A 443;LEU A 232;GLY A 412;ALA A 415","AD0 A1617 (-3.8A);AD0 A1617 (-4.7A);None;None","0.94A","3tehB-2uvfA:undetectable","3tehB-2uvfA:21.78"],["3UQ6_B_ADNB401_2","ADENOSINE KINASE, PUTATIVE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"LEU A 333;GLY A 356;PHE A 347;ASN A 359","None","1.05A","3uq6B-2uvfA:undetectable","3uq6B-2uvfA:20.68"],["4C5N_A_PXLA300_1","PHOSPHOMETHYLPYRIMIDINE KINASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"GLY A 464;ASP A 462;GLY A 436;CYH A 404","None","0.58A","4c5nA-2uvfA:undetectable","4c5nA-2uvfA:18.91"],["4C5N_C_PXLC300_1","PHOSPHOMETHYLPYRIMIDINE KINASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"GLY A 464;ASP A 462;GLY A 436;CYH A 404","None","0.59A","4c5nC-2uvfA:undetectable","4c5nC-2uvfA:18.91"],["4CEV_A_GAIA407_0","PROTEIN (ARGINASE)","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"GLU A 285;LEU A 460;MET A 433;ASP A 399","None","1.49A","4cevA-2uvfA:undetectable;4cevB-2uvfA:undetectable","4cevA-2uvfA:18.95;4cevB-2uvfA:18.95"],["4FGL_D_CLQD303_0","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ASN A 362;GLY A 338;VAL A 339;ILE A 248","None","0.86A","4fglC-2uvfA:undetectable","4fglC-2uvfA:16.78"],["4OKB_A_198A1002_2","ANDROGEN RECEPTOR","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"LEU A 201;ASN A 246;LEU A 209;VAL A 342","None","1.17A","4okbA-2uvfA:undetectable","4okbA-2uvfA:16.07"],["4ZDY_A_1YNA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 401;TYR A 459;GLY A 287;THR A 283;THR A 374"," NI A1614 (-3.7A);None;None;None;None","1.18A","4zdyA-2uvfA:undetectable","4zdyA-2uvfA:21.75"],["4ZJO_D_ERYD1101_0","MULTIDRUG EFFLUX PUMP SUBUNIT ACRB","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"TYR A 235;SER A 236;GLU A 419;THR A 411;GLY A 410","None","1.35A","4zjoD-2uvfA:undetectable","4zjoD-2uvfA:21.35"],["5A06_F_SORF1343_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ARG A 276;PHE A 397;ARG A 432;ASP A 399"," NI A1615 (-4.5A);SO4 A1610 (-2.9A);None;None","1.46A","5a06F-2uvfA:undetectable","5a06F-2uvfA:21.30"],["5B1B_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.91A","5b1bN-2uvfA:undetectable;5b1bW-2uvfA:undetectable","5b1bN-2uvfA:22.56;5b1bW-2uvfA:8.13"],["5B3S_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.92A","5b3sN-2uvfA:undetectable;5b3sW-2uvfA:undetectable","5b3sN-2uvfA:22.56;5b3sW-2uvfA:8.13"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ASP A 399;ARG A 432;GLU A 285;ARG A 350","None","0.98A","5bs8A-2uvfA:undetectable;5bs8B-2uvfA:undetectable;5bs8C-2uvfA:undetectable","5bs8A-2uvfA:22.71;5bs8B-2uvfA:18.70;5bs8C-2uvfA:22.71"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ASP A 399;ARG A 432;GLU A 285;ARG A 350","None","0.97A","5btdA-2uvfA:undetectable;5btdB-2uvfA:undetectable;5btdC-2uvfA:undetectable","5btdA-2uvfA:22.71;5btdB-2uvfA:18.70;5btdC-2uvfA:22.71"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ARG A 350;ASP A 399;ARG A 432;GLU A 285","None","0.97A","5btdA-2uvfA:undetectable;5btdC-2uvfA:undetectable;5btdD-2uvfA:undetectable","5btdA-2uvfA:22.71;5btdC-2uvfA:22.71;5btdD-2uvfA:18.70"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ASP A 399;ARG A 432;GLU A 285;ARG A 350","None","0.99A","5btfA-2uvfA:undetectable;5btfB-2uvfA:undetectable;5btfC-2uvfA:undetectable","5btfA-2uvfA:22.86;5btfB-2uvfA:18.70;5btfC-2uvfA:22.86"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ARG A 350;ASP A 399;ARG A 432;GLU A 285","None","1.00A","5btfA-2uvfA:undetectable;5btfC-2uvfA:undetectable;5btfD-2uvfA:undetectable","5btfA-2uvfA:22.86;5btfC-2uvfA:22.86;5btfD-2uvfA:18.70"],["5EQB_A_1YNA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 346;ILE A 165;GLY A 163;LEU A 217;THR A 264","None","0.94A","5eqbA-2uvfA:undetectable","5eqbA-2uvfA:21.75"],["5ESL_A_1YNA701_1","LANOSTEROL 14-ALPHA DEMETHYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 401;TYR A 459;GLY A 287;THR A 283;THR A 374"," NI A1614 (-3.7A);None;None;None;None","1.19A","5eslA-2uvfA:undetectable","5eslA-2uvfA:21.75"],["5G08_A_Z80A1187_1","FREQUENIN 2","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 482;PHE A 577;THR A 567;TRP A 591","None","1.21A","5g08A-2uvfA:undetectable","5g08A-2uvfA:15.93"],["5H3A_A_D16A401_1","ORF70","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 385;ILE A 405;GLY A 441;PHE A 407","None;None;AD0 A1617 (-4.6A);None","0.77A","5h3aA-2uvfA:undetectable","5h3aA-2uvfA:18.24"],["5HIK_A_SAMA301_0","GLYCINE SARCOSINE N-METHYLTRANSFERASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"ARG A 330;GLY A 441;SER A 442;GLY A 380;HIS A 435","None;AD0 A1617 (-4.6A);AD0 A1617 (-3.4A);None; NI A1614 ( 3.4A)","0.97A","5hikA-2uvfA:undetectable","5hikA-2uvfA:18.11"],["5HNZ_B_TA1B902_2","TUBULIN BETA-2B CHAIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"LEU A 201;LEU A 217;ARG A 330","None","0.59A","5hnzB-2uvfA:undetectable","5hnzB-2uvfA:20.54"],["5IY5_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.87A","5iy5N-2uvfA:undetectable;5iy5W-2uvfA:undetectable","5iy5N-2uvfA:22.56;5iy5W-2uvfA:9.24"],["5JLC_A_1YNA602_2","LANOSTEROL 14-ALPHA DEMETHYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"TYR A 230;GLY A 229;GLY A 265;LEU A 333","None","0.86A","5jlcA-2uvfA:undetectable","5jlcA-2uvfA:22.78"],["5QGK_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"VAL A 130;TYR A  69;GLN A  70","None","0.68A","5qgkA-2uvfA:undetectable","5qgkA-2uvfA:15.79"],["5QGR_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"VAL A 130;TYR A  69;GLN A  70","None","0.65A","5qgrA-2uvfA:undetectable","5qgrA-2uvfA:15.79"],["5QGT_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"VAL A 130;TYR A  69;GLN A  70","None","0.67A","5qgtA-2uvfA:undetectable","5qgtA-2uvfA:15.79"],["5T8H_B_478B401_2","PROTEASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"LEU A 465;ALA A 453;ILE A 405;GLY A 423;ILE A 438","None","0.90A","5t8hB-2uvfA:undetectable","5t8hB-2uvfA:11.09"],["5U63_A_ACTA406_0","THIOREDOXIN REDUCTASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",3,"HIS A 555;SER A 575;ARG A 552","None","0.94A","5u63A-2uvfA:undetectable","5u63A-2uvfA:20.52"],["5VC0_A_RITA602_1","CYTOCHROME P450 3A4","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"ARG A 350;LEU A 171;ILE A 176;ALA A 164;ALA A 193","None","1.16A","5vc0A-2uvfA:undetectable","5vc0A-2uvfA:21.91"],["5XDH_B_DAHB60_1","PUTATIVE CYTOCHROME C","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"HIS A 372;MET A 334;ASN A 406;LEU A 333","None;None;AD0 A1617 (-3.0A);None","1.38A","5xdhB-2uvfA:0.0","5xdhB-2uvfA:9.52"],["5XDH_C_DAHC60_1","PUTATIVE CYTOCHROME C;PUTATIVE CYTOCHROME C","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"HIS A 372;MET A 334;ASN A 406;LEU A 333","None;None;AD0 A1617 (-3.0A);None","1.33A","5xdhA-2uvfA:undetectable;5xdhC-2uvfA:undetectable","5xdhA-2uvfA:9.52;5xdhC-2uvfA:9.52"],["5XDH_D_DAHD60_1","PUTATIVE CYTOCHROME C","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"HIS A 372;MET A 334;ASN A 406;LEU A 333","None;None;AD0 A1617 (-3.0A);None","1.46A","5xdhD-2uvfA:undetectable","5xdhD-2uvfA:9.52"],["5XDX_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT VIIA-HEART","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.93A","5xdxN-2uvfA:undetectable;5xdxW-2uvfA:undetectable","5xdxN-2uvfA:22.56;5xdxW-2uvfA:8.13"],["5YN6_A_SAMA401_0","NSP16 PROTEIN","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 380;GLY A 434;ASN A 351;ASP A 402;PHE A 354","None;None;None;AD0 A1617 (-3.1A);AD0 A1617 ( 4.9A)","1.32A","5yn6A-2uvfA:undetectable","5yn6A-2uvfA:20.40"],["5ZCO_J_CHDJ101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.90A","5zcoA-2uvfA:undetectable;5zcoJ-2uvfA:undetectable","5zcoA-2uvfA:22.56;5zcoJ-2uvfA:8.13"],["5ZCP_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.89A","5zcpN-2uvfA:undetectable;5zcpW-2uvfA:undetectable","5zcpN-2uvfA:22.56;5zcpW-2uvfA:8.13"],["5ZCQ_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"PHE A 347;MET A 334;THR A 335;LEU A 336","None","0.91A","5zcqN-2uvfA:undetectable;5zcqW-2uvfA:undetectable","5zcqN-2uvfA:22.56;5zcqW-2uvfA:8.13"],["6D9H_R_ADNR400_1","CHIMERA PROTEIN OF MUSCARINIC ACETYLCHOLINE RECEPTOR M4 AND ADENOSINE RECEPTOR A1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"VAL A 365;PHE A 385;LEU A 370;ASN A 396;ILE A 357","None","1.43A","6d9hR-2uvfA:undetectable","6d9hR-2uvfA:7.39"],["6E8Q_A_X2NA602_0","LANOSTEROL 14-ALPHA DEMETHYLASE","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",5,"GLY A 401;TYR A 459;GLY A 287;THR A 283;THR A 374"," NI A1614 (-3.7A);None;None;None;None","1.16A","6e8qA-2uvfA:undetectable","6e8qA-2uvfA:8.70"],["6HU9_Q_PCFQ202_0","CYTOCHROME C OXIDASE POLYPEPTIDE 5A, MITOCHONDRIAL;CYTOCHROME C OXIDASE SUBUNIT 1","2uvf","EXOPOLYGALACTURONASE","Yersinia enterocolitica",4,"ILE A 282;ALA A 277;ARG A 276;ASP A 270","None;None; NI A1615 (-4.5A); NI A1615 (-3.9A)","1.14A","6hu9m-2uvfA:undetectable;6hu9q-2uvfA:undetectable","6hu9m-2uvfA:23.78;6hu9q-2uvfA:12.29"]]