SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '2v7g'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_N_TRPN81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 10	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	0.99A	1c9sN-2v7gA: undetectable 1c9sO-2v7gA: undetectable	1c9sN-2v7gA: 8.79 1c9sO-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_P_TRPP81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.01A	1c9sP-2v7gA: undetectable 1c9sQ-2v7gA: undetectable	1c9sP-2v7gA: 8.79 1c9sQ-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_V_TRPV81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 10	GLY A 503 SER A 136 GLY A 492 HIS A 501 ALA A 134	None	1.00A	1c9sL-2v7gA: undetectable 1c9sV-2v7gA: undetectable	1c9sL-2v7gA: 8.79 1c9sV-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ETB_2_T442129_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LEU A 171 THR A 265 ALA A 173 LEU A 194	None NAD A3001 (-4.2A) NAD A3001 ( 4.4A) None	0.94A	1etb2-2v7gA: 1.6	1etb2-2v7gA: 13.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_Q_TRPQ81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.01A	1gtfQ-2v7gA: undetectable 1gtfR-2v7gA: undetectable	1gtfQ-2v7gA: 8.79 1gtfR-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_S_TRPS81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.02A	1gtfS-2v7gA: undetectable 1gtfT-2v7gA: undetectable	1gtfS-2v7gA: 8.79 1gtfT-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_T_TRPT81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.05A	1gtnT-2v7gA: undetectable 1gtnU-2v7gA: undetectable	1gtnT-2v7gA: 8.79 1gtnU-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IE4_B_T44B328_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ALA A 104 LEU A 102 ALA A 475 THR A 479	None	0.90A	1ie4B-2v7gA: 1.6 1ie4D-2v7gA: 1.6	1ie4B-2v7gA: 12.84 1ie4D-2v7gA: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LHV_A_NOGA301_1 (SEX HORMONE-BINDING GLOBULIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ASP A 269 ASN A 272 MET A 496 LEU A 108	None	0.89A	1lhvA-2v7gA: undetectable	1lhvA-2v7gA: 17.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1M8E_B_H4BB903_1 (INDUCIBLE NITRIC OXIDE SYNTHASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.86A	1m8eB-2v7gA: undetectable	1m8eB-2v7gA: 23.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_G_AG2G7003_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LEU A 445 ASP A 446 GLY A 357 ARG A 418	NAD A3001 (-4.1A) None None None	0.56A	1mt1G-2v7gA: undetectable 1mt1J-2v7gA: undetectable	1mt1G-2v7gA: 7.71 1mt1J-2v7gA: 13.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_K_AG2K7002_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.57A	1mt1H-2v7gA: undetectable 1mt1K-2v7gA: undetectable	1mt1H-2v7gA: 13.19 1mt1K-2v7gA: 7.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_D_AG2D7015_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.56A	1n13D-2v7gA: undetectable 1n13E-2v7gA: undetectable	1n13D-2v7gA: 13.19 1n13E-2v7gA: 7.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_F_AG2F7016_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	LEU A 445 ASP A 446 GLY A 357 ARG A 418	NAD A3001 (-4.1A) None None None	0.59A	1n13A-2v7gA: undetectable 1n13F-2v7gA: undetectable	1n13A-2v7gA: 7.71 1n13F-2v7gA: 13.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_H_AG2H7012_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.57A	1n13H-2v7gA: undetectable 1n13K-2v7gA: undetectable	1n13H-2v7gA: 13.19 1n13K-2v7gA: 7.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_J_AG2J7013_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 445 ASP A 446 GLY A 357 ARG A 418	NAD A3001 (-4.1A) None None None	0.57A	1n13G-2v7gA: undetectable 1n13J-2v7gA: undetectable	1n13G-2v7gA: 7.71 1n13J-2v7gA: 13.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NOD_B_H4BB902_1 (NITRIC OXIDE SYNTHASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.87A	1nodB-2v7gA: undetectable	1nodB-2v7gA: 23.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QOM_A_H4BA902_1 (NITRIC OXIDE SYNTHASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.94A	1qomA-2v7gA: undetectable	1qomA-2v7gA: 23.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1T46_A_STIA3_2 (HOMO SAPIENS V-KIT HARDY-ZUCKERMAN 4 FELINE SARCOMA VIRAL ONCOGENE HOMOLOG)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	VAL A 69 VAL A 83 TYR A 129 ARG A 32	None	0.96A	1t46A-2v7gA: undetectable	1t46A-2v7gA: 20.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TYR_B_9CRB130_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 171 THR A 265 ALA A 173 LEU A 194	None NAD A3001 (-4.2A) NAD A3001 ( 4.4A) None	1.00A	1tyrB-2v7gA: undetectable	1tyrB-2v7gA: 13.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UPF_B_URFB999_1 (URACIL PHOSPHORIBOSYLTRANSF ERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ALA A 227 ILE A 226 ILE A 238 ASP A 221	None	0.86A	1upfB-2v7gA: undetectable	1upfB-2v7gA: 18.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_O_TRPO81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.04A	1utdO-2v7gA: undetectable 1utdP-2v7gA: undetectable	1utdO-2v7gA: 8.79 1utdP-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_P_TRPP81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.04A	1utdP-2v7gA: undetectable 1utdQ-2v7gA: undetectable	1utdP-2v7gA: 8.79 1utdQ-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_S_TRPS81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.03A	1utdS-2v7gA: undetectable 1utdT-2v7gA: undetectable	1utdS-2v7gA: 8.79 1utdT-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_U_TRPU81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 10	GLY A 492 HIS A 501 ALA A 134 GLY A 503 SER A 136	None	1.06A	1utdU-2v7gA: undetectable 1utdV-2v7gA: undetectable	1utdU-2v7gA: 8.79 1utdV-2v7gA: 8.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CML_A_ZMRA1478_1 (NEURAMINIDASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 7	SER A 237 ASP A 213 SER A 193 ASN A 195 GLN A 182	None	1.42A	2cmlA-2v7gA: undetectable	2cmlA-2v7gA: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CML_B_ZMRB2478_1 (NEURAMINIDASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 8	SER A 237 ASP A 213 SER A 193 ASN A 195 GLN A 182	None	1.43A	2cmlB-2v7gA: undetectable	2cmlB-2v7gA: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CML_D_ZMRD4478_1 (NEURAMINIDASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 8	SER A 237 ASP A 213 SER A 193 ASN A 195 GLN A 182	None	1.49A	2cmlD-2v7gA: undetectable	2cmlD-2v7gA: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJF_B_ADNB2002_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	ARG A 8 GLU A 11 PRO A 40 ALA A 43	None	1.14A	2ejfB-2v7gA: 0.9	2ejfB-2v7gA: 15.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJG_A_ADNA1501_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ARG A 8 GLU A 11 PRO A 40 ALA A 43	None	1.18A	2ejgA-2v7gA: undetectable	2ejgA-2v7gA: 16.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NOD_B_H4BB902_1 (NITRIC OXIDE SYNTHASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.91A	2nodB-2v7gA: undetectable	2nodB-2v7gA: 23.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q7K_A_TESA304_1 (ANDROGEN RECEPTOR)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	LEU A 394 GLN A 147 VAL A 413 LEU A 421 THR A 376	None None GOL A1561 ( 4.3A) None None	1.30A	2q7kA-2v7gA: undetectable	2q7kA-2v7gA: 17.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QQC_E_AG2E671_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC))	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.61A	2qqcD-2v7gA: undetectable 2qqcE-2v7gA: undetectable	2qqcD-2v7gA: 13.64 2qqcE-2v7gA: 7.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QQC_K_AG2K671_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC))	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.59A	2qqcH-2v7gA: undetectable 2qqcK-2v7gA: undetectable	2qqcH-2v7gA: 13.64 2qqcK-2v7gA: 7.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QQD_B_AG2B671_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC))	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ARG A 418 LEU A 445 ASP A 446 GLY A 357	None NAD A3001 (-4.1A) None None	0.62A	2qqdB-2v7gA: undetectable 2qqdC-2v7gA: undetectable	2qqdB-2v7gA: 13.46 2qqdC-2v7gA: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ROX_B_T44B128_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LYS A 420 LEU A 417 ALA A 419 THR A 523	None	0.99A	2roxB-2v7gA: undetectable	2roxB-2v7gA: 13.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ARU_A_PNXA606_1 (CHITINASE A)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	PHE A 205 GLY A 141 ASP A 39 TYR A 139	None None None ACT A1558 (-4.7A)	1.15A	3aruA-2v7gA: 2.1	3aruA-2v7gA: 22.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_C_DHIC8_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	SER A 435 GLY A 17 GLY A 368	None	0.53A	3bogA-2v7gA: undetectable 3bogC-2v7gA: undetectable	3bogA-2v7gA: undetectable 3bogC-2v7gA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BXO_B_SAMB238_0 (N,N-DIMETHYLTRANSFER ASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 493 HIS A 490 ARG A 351 PHE A 498 SER A 452	NAD A3001 (-3.1A) None None None None	1.48A	3bxoB-2v7gA: 8.3	3bxoB-2v7gA: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CKK_A_SAMA301_0 (TRNA (GUANINE-N(7)-)-METH YLTRANSFERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 174 GLY A 176 GLU A 197 ASN A 243 ALA A 244	NAD A3001 ( 3.8A) NAD A3001 (-3.1A) NAD A3001 (-2.7A) NAD A3001 (-3.2A) NAD A3001 (-3.5A)	1.03A	3ckkA-2v7gA: 5.1	3ckkA-2v7gA: 17.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CZH_A_D2VA602_2 (CYTOCHROME P450 2R1)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	LEU A 223 GLU A 250 ILE A 247	None	0.60A	3czhA-2v7gA: undetectable	3czhA-2v7gA: 22.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3E68_A_H4BA902_1 (NITRIC OXIDE SYNTHASE, INDUCIBLE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.87A	3e68A-2v7gA: undetectable	3e68A-2v7gA: 23.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3E6T_B_H4BB902_1 (NITRIC OXIDE SYNTHASE, INDUCIBLE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.84A	3e6tB-2v7gA: undetectable	3e6tB-2v7gA: 23.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3E7I_B_H4BB2902_1 (NITRIC OXIDE SYNTHASE, INDUCIBLE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.83A	3e7iB-2v7gA: undetectable	3e7iB-2v7gA: 23.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HM1_A_J3ZA2_1 (ESTROGEN RECEPTOR)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	LEU A 31 THR A 27 ALA A 29 LEU A 366 LEU A 20	None	1.11A	3hm1A-2v7gA: undetectable	3hm1A-2v7gA: 18.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NW2_A_H4BA902_1 (NITRIC OXIDE SYNTHASE, INDUCIBLE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.99A	3nw2A-2v7gA: undetectable	3nw2A-2v7gA: 23.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NW2_B_H4BB902_1 (NITRIC OXIDE SYNTHASE, INDUCIBLE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 418 ILE A 410 TRP A 412	None	0.94A	3nw2B-2v7gA: undetectable	3nw2B-2v7gA: 23.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_B_SAMB6735_0 (16S RRNA METHYLASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 497 GLY A 491 ASN A 107 GLU A 333 TRP A 115	None	1.17A	3p2kB-2v7gA: 4.5	3p2kB-2v7gA: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PFG_A_SAMA264_0 (N-METHYLTRANSFERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 492 HIS A 490 LEU A 445 PHE A 498 SER A 452	None None NAD A3001 (-4.1A) None None	1.16A	3pfgA-2v7gA: 7.1	3pfgA-2v7gA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PFG_A_SAMA264_0 (N-METHYLTRANSFERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 493 HIS A 490 LEU A 445 PHE A 498 SER A 452	NAD A3001 (-3.1A) None NAD A3001 (-4.1A) None None	1.38A	3pfgA-2v7gA: 7.1	3pfgA-2v7gA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SOA_A_DB8A445_1 (CALCIUM/CALMODULIN-D EPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LEU A 383 VAL A 380 PHE A 425 PHE A 361	None	1.12A	3soaA-2v7gA: 1.3	3soaA-2v7gA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TWP_A_SALA404_1 (ANTHRANILATE PHOSPHORIBOSYLTRANSF ERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ALA A 348 PRO A 347 ARG A 455 ARG A 328	None None NAD A3001 (-4.0A) None	1.14A	3twpA-2v7gA: undetectable	3twpA-2v7gA: 22.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TWP_B_SALB404_1 (ANTHRANILATE PHOSPHORIBOSYLTRANSF ERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ALA A 348 PRO A 347 ARG A 455 ARG A 328	None None NAD A3001 (-4.0A) None	1.08A	3twpB-2v7gA: undetectable	3twpB-2v7gA: 22.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UVV_A_T3A501_2 (THYROID HORMONE RECEPTOR ALPHA)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 16 MET A 33 ARG A 32	None	1.34A	3uvvA-2v7gA: undetectable	3uvvA-2v7gA: 17.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_A_ACTA504_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	THR A 73 VAL A 69 GLU A 28	None	0.50A	3v4tA-2v7gA: undetectable 3v4tD-2v7gA: undetectable	3v4tA-2v7gA: 24.91 3v4tD-2v7gA: 24.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W68_C_VIVC301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	ILE A 12 VAL A 69 VAL A 505 LEU A 366 VAL A 439	None	1.18A	3w68C-2v7gA: undetectable	3w68C-2v7gA: 17.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A99_C_MIYC391_1 (TETX2 PROTEIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 11	ASN A 105 ARG A 455 HIS A 444 SER A 106 GLY A 53	None NAD A3001 (-4.0A) None None NAD A3001 (-3.2A)	1.50A	4a99C-2v7gA: 0.1	4a99C-2v7gA: 22.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BQF_B_QPSB951_1 (ALPHA-GLUCAN PHOSPHORYLASE 2, CYTOSOLIC)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	GLU A 246 GLU A 250 LYS A 253 ARG A 254	None	0.87A	4bqfB-2v7gA: undetectable	4bqfB-2v7gA: 21.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CP4_A_CAMA416_0 (CYTOCHROME P450-CAM)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	THR A 484 LEU A 72 VAL A 439 VAL A 507	None	0.97A	4cp4A-2v7gA: undetectable	4cp4A-2v7gA: 22.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EYZ_A_CCSA109_0 (CELLULOSOME-RELATED PROTEIN MODULE FROM RUMINOCOCCUS FLAVEFACIENS THAT RESEMBLES PAPAIN-LIKE CYSTEINE PEPTIDASES)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ASN A 107 VAL A 83 ILE A 103 ALA A 475	None	1.02A	4eyzA-2v7gA: undetectable	4eyzA-2v7gA: 18.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EYZ_B_CCSB109_0 (CELLULOSOME-RELATED PROTEIN MODULE FROM RUMINOCOCCUS FLAVEFACIENS THAT RESEMBLES PAPAIN-LIKE CYSTEINE PEPTIDASES)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ASN A 107 VAL A 83 ILE A 103 ALA A 475	None	1.00A	4eyzB-2v7gA: undetectable	4eyzB-2v7gA: 18.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OJ4_A_DIFA501_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	LEU A 72 LEU A 81 VAL A 101 ILE A 103	None	0.86A	4oj4A-2v7gA: undetectable	4oj4A-2v7gA: 18.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OKB_A_198A1002_2 (ANDROGEN RECEPTOR)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LEU A 488 ASN A 107 LEU A 102 VAL A 89	None	1.07A	4okbA-2v7gA: undetectable	4okbA-2v7gA: 18.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PWJ_A_30ZA201_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 6	LEU A 171 THR A 265 ALA A 173 LEU A 194	None NAD A3001 (-4.2A) NAD A3001 ( 4.4A) None	0.99A	4pwjA-2v7gA: 1.3	4pwjA-2v7gA: 15.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PWJ_B_30ZB201_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 171 THR A 265 ALA A 173 LEU A 194	None NAD A3001 (-4.2A) NAD A3001 ( 4.4A) None	1.01A	4pwjB-2v7gA: undetectable	4pwjB-2v7gA: 15.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	THR A 27 THR A 484 ALA A 483 THR A 80	None	1.01A	4qw0K-2v7gA: undetectable	4qw0K-2v7gA: 18.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	THR A 27 THR A 484 ALA A 483 THR A 80	None	1.01A	4qw0Y-2v7gA: undetectable	4qw0Y-2v7gA: 18.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_A_SORA1342_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 175 GLU A 44 GLY A 179 GLY A 180	None NAD A3001 (-4.6A) NAD A3001 (-3.7A) None	0.78A	5a06A-2v7gA: undetectable	5a06A-2v7gA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_B_SORB1342_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 175 GLU A 44 GLY A 179 GLY A 180	None NAD A3001 (-4.6A) NAD A3001 (-3.7A) None	0.80A	5a06B-2v7gA: undetectable	5a06B-2v7gA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_C_SORC1342_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 175 GLU A 44 GLY A 179 GLY A 180	None NAD A3001 (-4.6A) NAD A3001 (-3.7A) None	0.81A	5a06C-2v7gA: undetectable	5a06C-2v7gA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_E_SORE1341_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 175 GLU A 44 GLY A 179 GLY A 180	None NAD A3001 (-4.6A) NAD A3001 (-3.7A) None	0.79A	5a06E-2v7gA: undetectable	5a06E-2v7gA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_F_SORF1341_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 175 GLU A 44 GLY A 179 GLY A 180	None NAD A3001 (-4.6A) NAD A3001 (-3.7A) None	0.78A	5a06F-2v7gA: undetectable	5a06F-2v7gA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BOJ_B_4TXB201_1 (TRANSTHYRETIN)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	LEU A 171 THR A 265 ALA A 173 LEU A 194	None NAD A3001 (-4.2A) NAD A3001 ( 4.4A) None	0.98A	5bojB-2v7gA: 1.4	5bojB-2v7gA: 13.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 7	ALA A 541 ASP A 525 ARG A 442 GLY A 359	None	0.80A	5bs8A-2v7gA: undetectable 5bs8C-2v7gA: undetectable 5bs8D-2v7gA: undetectable	5bs8A-2v7gA: 22.44 5bs8C-2v7gA: 22.44 5bs8D-2v7gA: 19.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M66_A_ADNA502_2 (ADENOSYLHOMOCYSTEINA SE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 4	GLN A 264 THR A 265 GLU A 197 LEU A 194	NAD A3001 (-3.9A) NAD A3001 (-4.2A) NAD A3001 (-2.7A) None	1.18A	5m66A-2v7gA: 7.3	5m66A-2v7gA: 21.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_A_SAMA501_1 (PEPTIDE N-METHYLTRANSFERASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 5	SER A 142 ALA A 181 GLN A 147 THR A 149	None	1.30A	5n0tA-2v7gA: undetectable	5n0tA-2v7gA: 22.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TZO_B_7V7B201_2 (ENDO-1,4-BETA-XYLANA SE A)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	3 / 3	ARG A 362 PRO A 360 TYR A 52	ACT A1558 (-2.9A) None ACT A1558 ( 4.3A)	1.03A	5tzoB-2v7gA: undetectable	5tzoB-2v7gA: 16.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WZ2_C_SAMC601_0 (NS5 MTASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 12	GLY A 180 GLY A 144 GLY A 141 GLY A 177 ILE A 410	None ACT A1558 (-3.4A) None NAD A3001 (-3.8A) None	0.92A	5wz2C-2v7gA: 4.8	5wz2C-2v7gA: 19.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X2T_I_PEMI202_1 (HEMOGLOBIN SUBUNIT ALPHA HEMOGLOBIN SUBUNIT BETA)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	4 / 8	ALA A 156 THR A 152 ALA A 181 TRP A 393	None	1.02A	5x2tI-2v7gA: undetectable 5x2tJ-2v7gA: undetectable 5x2tK-2v7gA: undetectable 5x2tL-2v7gA: undetectable	5x2tI-2v7gA: 13.36 5x2tJ-2v7gA: 13.92 5x2tK-2v7gA: 13.36 5x2tL-2v7gA: 13.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B68_C_9F2C302_1 (BETA-LACTAMASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 10	THR A 187 PRO A 183 TYR A 211 THR A 209 ASP A 221	None	1.50A	6b68C-2v7gA: 0.0 6b68D-2v7gA: 0.0	6b68C-2v7gA: 9.11 6b68D-2v7gA: 9.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B69_A_9F2A302_1 (BETA-LACTAMASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 9	THR A 187 PRO A 183 TYR A 211 THR A 209 ASP A 221	None	1.47A	6b69A-2v7gA: 0.0 6b69B-2v7gA: 0.0	6b69A-2v7gA: 9.11 6b69B-2v7gA: 9.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B69_C_9F2C302_1 (BETA-LACTAMASE)	2v7g	UROCANATE HYDRATASE (Pseudomonas putida)	5 / 9	THR A 187 PRO A 183 TYR A 211 THR A 209 ASP A 221	None	1.47A	6b69C-2v7gA: 0.0 6b69D-2v7gA: 0.0	6b69C-2v7gA: 9.11 6b69D-2v7gA: 9.11

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_N_TRPN81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","0.99A","1c9sN-2v7gA:undetectable;1c9sO-2v7gA:undetectable","1c9sN-2v7gA:8.79;1c9sO-2v7gA:8.79"],["1C9S_P_TRPP81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.01A","1c9sP-2v7gA:undetectable;1c9sQ-2v7gA:undetectable","1c9sP-2v7gA:8.79;1c9sQ-2v7gA:8.79"],["1C9S_V_TRPV81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 503;SER A 136;GLY A 492;HIS A 501;ALA A 134","None","1.00A","1c9sL-2v7gA:undetectable;1c9sV-2v7gA:undetectable","1c9sL-2v7gA:8.79;1c9sV-2v7gA:8.79"],["1ETB_2_T442129_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 171;THR A 265;ALA A 173;LEU A 194","None;NAD A3001 (-4.2A);NAD A3001 ( 4.4A);None","0.94A","1etb2-2v7gA:1.6","1etb2-2v7gA:13.16"],["1GTF_Q_TRPQ81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.01A","1gtfQ-2v7gA:undetectable;1gtfR-2v7gA:undetectable","1gtfQ-2v7gA:8.79;1gtfR-2v7gA:8.79"],["1GTF_S_TRPS81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.02A","1gtfS-2v7gA:undetectable;1gtfT-2v7gA:undetectable","1gtfS-2v7gA:8.79;1gtfT-2v7gA:8.79"],["1GTN_T_TRPT81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.05A","1gtnT-2v7gA:undetectable;1gtnU-2v7gA:undetectable","1gtnT-2v7gA:8.79;1gtnU-2v7gA:8.79"],["1IE4_B_T44B328_1","TRANSTHYRETIN;TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 104;LEU A 102;ALA A 475;THR A 479","None","0.90A","1ie4B-2v7gA:1.6;1ie4D-2v7gA:1.6","1ie4B-2v7gA:12.84;1ie4D-2v7gA:12.84"],["1LHV_A_NOGA301_1","SEX HORMONE-BINDING GLOBULIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ASP A 269;ASN A 272;MET A 496;LEU A 108","None","0.89A","1lhvA-2v7gA:undetectable","1lhvA-2v7gA:17.01"],["1M8E_B_H4BB903_1","INDUCIBLE NITRIC OXIDE SYNTHASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.86A","1m8eB-2v7gA:undetectable","1m8eB-2v7gA:23.53"],["1MT1_G_AG2G7003_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 445;ASP A 446;GLY A 357;ARG A 418","NAD A3001 (-4.1A);None;None;None","0.56A","1mt1G-2v7gA:undetectable;1mt1J-2v7gA:undetectable","1mt1G-2v7gA:7.71;1mt1J-2v7gA:13.19"],["1MT1_K_AG2K7002_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.57A","1mt1H-2v7gA:undetectable;1mt1K-2v7gA:undetectable","1mt1H-2v7gA:13.19;1mt1K-2v7gA:7.71"],["1N13_D_AG2D7015_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.56A","1n13D-2v7gA:undetectable;1n13E-2v7gA:undetectable","1n13D-2v7gA:13.19;1n13E-2v7gA:7.71"],["1N13_F_AG2F7016_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 445;ASP A 446;GLY A 357;ARG A 418","NAD A3001 (-4.1A);None;None;None","0.59A","1n13A-2v7gA:undetectable;1n13F-2v7gA:undetectable","1n13A-2v7gA:7.71;1n13F-2v7gA:13.19"],["1N13_H_AG2H7012_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.57A","1n13H-2v7gA:undetectable;1n13K-2v7gA:undetectable","1n13H-2v7gA:13.19;1n13K-2v7gA:7.71"],["1N13_J_AG2J7013_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 445;ASP A 446;GLY A 357;ARG A 418","NAD A3001 (-4.1A);None;None;None","0.57A","1n13G-2v7gA:undetectable;1n13J-2v7gA:undetectable","1n13G-2v7gA:7.71;1n13J-2v7gA:13.19"],["1NOD_B_H4BB902_1","NITRIC OXIDE SYNTHASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.87A","1nodB-2v7gA:undetectable","1nodB-2v7gA:23.10"],["1QOM_A_H4BA902_1","NITRIC OXIDE SYNTHASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.94A","1qomA-2v7gA:undetectable","1qomA-2v7gA:23.36"],["1T46_A_STIA3_2","HOMO SAPIENS V-KIT HARDY-ZUCKERMAN 4 FELINE SARCOMA VIRAL ONCOGENE HOMOLOG","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"VAL A  69;VAL A  83;TYR A 129;ARG A  32","None","0.96A","1t46A-2v7gA:undetectable","1t46A-2v7gA:20.21"],["1TYR_B_9CRB130_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 171;THR A 265;ALA A 173;LEU A 194","None;NAD A3001 (-4.2A);NAD A3001 ( 4.4A);None","1.00A","1tyrB-2v7gA:undetectable","1tyrB-2v7gA:13.35"],["1UPF_B_URFB999_1","URACIL PHOSPHORIBOSYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 227;ILE A 226;ILE A 238;ASP A 221","None","0.86A","1upfB-2v7gA:undetectable","1upfB-2v7gA:18.85"],["1UTD_O_TRPO81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.04A","1utdO-2v7gA:undetectable;1utdP-2v7gA:undetectable","1utdO-2v7gA:8.79;1utdP-2v7gA:8.79"],["1UTD_P_TRPP81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.04A","1utdP-2v7gA:undetectable;1utdQ-2v7gA:undetectable","1utdP-2v7gA:8.79;1utdQ-2v7gA:8.79"],["1UTD_S_TRPS81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.03A","1utdS-2v7gA:undetectable;1utdT-2v7gA:undetectable","1utdS-2v7gA:8.79;1utdT-2v7gA:8.79"],["1UTD_U_TRPU81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 501;ALA A 134;GLY A 503;SER A 136","None","1.06A","1utdU-2v7gA:undetectable;1utdV-2v7gA:undetectable","1utdU-2v7gA:8.79;1utdV-2v7gA:8.79"],["2CML_A_ZMRA1478_1","NEURAMINIDASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"SER A 237;ASP A 213;SER A 193;ASN A 195;GLN A 182","None","1.42A","2cmlA-2v7gA:undetectable","2cmlA-2v7gA:20.53"],["2CML_B_ZMRB2478_1","NEURAMINIDASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"SER A 237;ASP A 213;SER A 193;ASN A 195;GLN A 182","None","1.43A","2cmlB-2v7gA:undetectable","2cmlB-2v7gA:20.53"],["2CML_D_ZMRD4478_1","NEURAMINIDASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"SER A 237;ASP A 213;SER A 193;ASN A 195;GLN A 182","None","1.49A","2cmlD-2v7gA:undetectable","2cmlD-2v7gA:20.53"],["2EJF_B_ADNB2002_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A   8;GLU A  11;PRO A  40;ALA A  43","None","1.14A","2ejfB-2v7gA:0.9","2ejfB-2v7gA:15.54"],["2EJG_A_ADNA1501_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A   8;GLU A  11;PRO A  40;ALA A  43","None","1.18A","2ejgA-2v7gA:undetectable","2ejgA-2v7gA:16.43"],["2NOD_B_H4BB902_1","NITRIC OXIDE SYNTHASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.91A","2nodB-2v7gA:undetectable","2nodB-2v7gA:23.10"],["2Q7K_A_TESA304_1","ANDROGEN RECEPTOR","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"LEU A 394;GLN A 147;VAL A 413;LEU A 421;THR A 376","None;None;GOL A1561 ( 4.3A);None;None","1.30A","2q7kA-2v7gA:undetectable","2q7kA-2v7gA:17.32"],["2QQC_E_AG2E671_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC);PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC)","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.61A","2qqcD-2v7gA:undetectable;2qqcE-2v7gA:undetectable","2qqcD-2v7gA:13.64;2qqcE-2v7gA:7.80"],["2QQC_K_AG2K671_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC);PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC)","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.59A","2qqcH-2v7gA:undetectable;2qqcK-2v7gA:undetectable","2qqcH-2v7gA:13.64;2qqcK-2v7gA:7.80"],["2QQD_B_AG2B671_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC);PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE (EC 4.1.1.19) (PVLARGDC)","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ARG A 418;LEU A 445;ASP A 446;GLY A 357","None;NAD A3001 (-4.1A);None;None","0.62A","2qqdB-2v7gA:undetectable;2qqdC-2v7gA:undetectable","2qqdB-2v7gA:13.46;2qqdC-2v7gA:16.82"],["2ROX_B_T44B128_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LYS A 420;LEU A 417;ALA A 419;THR A 523","None","0.99A","2roxB-2v7gA:undetectable","2roxB-2v7gA:13.35"],["3ARU_A_PNXA606_1","CHITINASE A","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"PHE A 205;GLY A 141;ASP A  39;TYR A 139","None;None;None;ACT A1558 (-4.7A)","1.15A","3aruA-2v7gA:2.1","3aruA-2v7gA:22.19"],["3BOG_C_DHIC8_0","6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"SER A 435;GLY A  17;GLY A 368","None","0.53A","3bogA-2v7gA:undetectable;3bogC-2v7gA:undetectable","3bogA-2v7gA:undetectable;3bogC-2v7gA:undetectable"],["3BXO_B_SAMB238_0","N,N-DIMETHYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 493;HIS A 490;ARG A 351;PHE A 498;SER A 452","NAD A3001 (-3.1A);None;None;None;None","1.48A","3bxoB-2v7gA:8.3","3bxoB-2v7gA:18.95"],["3CKK_A_SAMA301_0","TRNA (GUANINE-N(7)-)-METHYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 174;GLY A 176;GLU A 197;ASN A 243;ALA A 244","NAD A3001 ( 3.8A);NAD A3001 (-3.1A);NAD A3001 (-2.7A);NAD A3001 (-3.2A);NAD A3001 (-3.5A)","1.03A","3ckkA-2v7gA:5.1","3ckkA-2v7gA:17.62"],["3CZH_A_D2VA602_2","CYTOCHROME P450 2R1","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"LEU A 223;GLU A 250;ILE A 247","None","0.60A","3czhA-2v7gA:undetectable","3czhA-2v7gA:22.00"],["3E68_A_H4BA902_1","NITRIC OXIDE SYNTHASE, INDUCIBLE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.87A","3e68A-2v7gA:undetectable","3e68A-2v7gA:23.40"],["3E6T_B_H4BB902_1","NITRIC OXIDE SYNTHASE, INDUCIBLE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.84A","3e6tB-2v7gA:undetectable","3e6tB-2v7gA:23.40"],["3E7I_B_H4BB2902_1","NITRIC OXIDE SYNTHASE, INDUCIBLE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.83A","3e7iB-2v7gA:undetectable","3e7iB-2v7gA:23.40"],["3HM1_A_J3ZA2_1","ESTROGEN RECEPTOR","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"LEU A  31;THR A  27;ALA A  29;LEU A 366;LEU A  20","None","1.11A","3hm1A-2v7gA:undetectable","3hm1A-2v7gA:18.26"],["3NW2_A_H4BA902_1","NITRIC OXIDE SYNTHASE, INDUCIBLE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.99A","3nw2A-2v7gA:undetectable","3nw2A-2v7gA:23.10"],["3NW2_B_H4BB902_1","NITRIC OXIDE SYNTHASE, INDUCIBLE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 418;ILE A 410;TRP A 412","None","0.94A","3nw2B-2v7gA:undetectable","3nw2B-2v7gA:23.10"],["3P2K_B_SAMB6735_0","16S RRNA METHYLASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 497;GLY A 491;ASN A 107;GLU A 333;TRP A 115","None","1.17A","3p2kB-2v7gA:4.5","3p2kB-2v7gA:15.44"],["3PFG_A_SAMA264_0","N-METHYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 492;HIS A 490;LEU A 445;PHE A 498;SER A 452","None;None;NAD A3001 (-4.1A);None;None","1.16A","3pfgA-2v7gA:7.1","3pfgA-2v7gA:19.33"],["3PFG_A_SAMA264_0","N-METHYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 493;HIS A 490;LEU A 445;PHE A 498;SER A 452","NAD A3001 (-3.1A);None;NAD A3001 (-4.1A);None;None","1.38A","3pfgA-2v7gA:7.1","3pfgA-2v7gA:19.33"],["3SOA_A_DB8A445_1","CALCIUM\/CALMODULIN-DEPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 383;VAL A 380;PHE A 425;PHE A 361","None","1.12A","3soaA-2v7gA:1.3","3soaA-2v7gA:21.75"],["3TWP_A_SALA404_1","ANTHRANILATE PHOSPHORIBOSYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 348;PRO A 347;ARG A 455;ARG A 328","None;None;NAD A3001 (-4.0A);None","1.14A","3twpA-2v7gA:undetectable","3twpA-2v7gA:22.26"],["3TWP_B_SALB404_1","ANTHRANILATE PHOSPHORIBOSYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 348;PRO A 347;ARG A 455;ARG A 328","None;None;NAD A3001 (-4.0A);None","1.08A","3twpB-2v7gA:undetectable","3twpB-2v7gA:22.26"],["3UVV_A_T3A501_2","THYROID HORMONE RECEPTOR ALPHA","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A  16;MET A  33;ARG A  32","None","1.34A","3uvvA-2v7gA:undetectable","3uvvA-2v7gA:17.43"],["3V4T_A_ACTA504_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"THR A  73;VAL A  69;GLU A  28","None","0.50A","3v4tA-2v7gA:undetectable;3v4tD-2v7gA:undetectable","3v4tA-2v7gA:24.91;3v4tD-2v7gA:24.91"],["3W68_C_VIVC301_0","ALPHA-TOCOPHEROL TRANSFER PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"ILE A  12;VAL A  69;VAL A 505;LEU A 366;VAL A 439","None","1.18A","3w68C-2v7gA:undetectable","3w68C-2v7gA:17.95"],["4A99_C_MIYC391_1","TETX2 PROTEIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"ASN A 105;ARG A 455;HIS A 444;SER A 106;GLY A  53","None;NAD A3001 (-4.0A);None;None;NAD A3001 (-3.2A)","1.50A","4a99C-2v7gA:0.1","4a99C-2v7gA:22.12"],["4BQF_B_QPSB951_1","ALPHA-GLUCAN PHOSPHORYLASE 2, CYTOSOLIC","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"GLU A 246;GLU A 250;LYS A 253;ARG A 254","None","0.87A","4bqfB-2v7gA:undetectable","4bqfB-2v7gA:21.88"],["4CP4_A_CAMA416_0","CYTOCHROME P450-CAM","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"THR A 484;LEU A  72;VAL A 439;VAL A 507","None","0.97A","4cp4A-2v7gA:undetectable","4cp4A-2v7gA:22.57"],["4EYZ_A_CCSA109_0","CELLULOSOME-RELATED PROTEIN MODULE FROM RUMINOCOCCUS FLAVEFACIENS THAT RESEMBLES PAPAIN-LIKE CYSTEINE PEPTIDASES","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ASN A 107;VAL A  83;ILE A 103;ALA A 475","None","1.02A","4eyzA-2v7gA:undetectable","4eyzA-2v7gA:18.66"],["4EYZ_B_CCSB109_0","CELLULOSOME-RELATED PROTEIN MODULE FROM RUMINOCOCCUS FLAVEFACIENS THAT RESEMBLES PAPAIN-LIKE CYSTEINE PEPTIDASES","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ASN A 107;VAL A  83;ILE A 103;ALA A 475","None","1.00A","4eyzB-2v7gA:undetectable","4eyzB-2v7gA:18.66"],["4OJ4_A_DIFA501_1","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A  72;LEU A  81;VAL A 101;ILE A 103","None","0.86A","4oj4A-2v7gA:undetectable","4oj4A-2v7gA:18.44"],["4OKB_A_198A1002_2","ANDROGEN RECEPTOR","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 488;ASN A 107;LEU A 102;VAL A  89","None","1.07A","4okbA-2v7gA:undetectable","4okbA-2v7gA:18.27"],["4PWJ_A_30ZA201_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 171;THR A 265;ALA A 173;LEU A 194","None;NAD A3001 (-4.2A);NAD A3001 ( 4.4A);None","0.99A","4pwjA-2v7gA:1.3","4pwjA-2v7gA:15.61"],["4PWJ_B_30ZB201_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 171;THR A 265;ALA A 173;LEU A 194","None;NAD A3001 (-4.2A);NAD A3001 ( 4.4A);None","1.01A","4pwjB-2v7gA:undetectable","4pwjB-2v7gA:15.61"],["4QW0_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"THR A  27;THR A 484;ALA A 483;THR A  80","None","1.01A","4qw0K-2v7gA:undetectable","4qw0K-2v7gA:18.09"],["4QW0_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"THR A  27;THR A 484;ALA A 483;THR A  80","None","1.01A","4qw0Y-2v7gA:undetectable","4qw0Y-2v7gA:18.09"],["5A06_A_SORA1342_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 175;GLU A  44;GLY A 179;GLY A 180","None;NAD A3001 (-4.6A);NAD A3001 (-3.7A);None","0.78A","5a06A-2v7gA:undetectable","5a06A-2v7gA:20.60"],["5A06_B_SORB1342_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 175;GLU A  44;GLY A 179;GLY A 180","None;NAD A3001 (-4.6A);NAD A3001 (-3.7A);None","0.80A","5a06B-2v7gA:undetectable","5a06B-2v7gA:20.60"],["5A06_C_SORC1342_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 175;GLU A  44;GLY A 179;GLY A 180","None;NAD A3001 (-4.6A);NAD A3001 (-3.7A);None","0.81A","5a06C-2v7gA:undetectable","5a06C-2v7gA:20.60"],["5A06_E_SORE1341_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 175;GLU A  44;GLY A 179;GLY A 180","None;NAD A3001 (-4.6A);NAD A3001 (-3.7A);None","0.79A","5a06E-2v7gA:undetectable","5a06E-2v7gA:20.60"],["5A06_F_SORF1341_0","ALDOSE-ALDOSE OXIDOREDUCTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 175;GLU A  44;GLY A 179;GLY A 180","None;NAD A3001 (-4.6A);NAD A3001 (-3.7A);None","0.78A","5a06F-2v7gA:undetectable","5a06F-2v7gA:20.60"],["5BOJ_B_4TXB201_1","TRANSTHYRETIN","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"LEU A 171;THR A 265;ALA A 173;LEU A 194","None;NAD A3001 (-4.2A);NAD A3001 ( 4.4A);None","0.98A","5bojB-2v7gA:1.4","5bojB-2v7gA:13.35"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 541;ASP A 525;ARG A 442;GLY A 359","None","0.80A","5bs8A-2v7gA:undetectable;5bs8C-2v7gA:undetectable;5bs8D-2v7gA:undetectable","5bs8A-2v7gA:22.44;5bs8C-2v7gA:22.44;5bs8D-2v7gA:19.96"],["5M66_A_ADNA502_2","ADENOSYLHOMOCYSTEINASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"GLN A 264;THR A 265;GLU A 197;LEU A 194","NAD A3001 (-3.9A);NAD A3001 (-4.2A);NAD A3001 (-2.7A);None","1.18A","5m66A-2v7gA:7.3","5m66A-2v7gA:21.28"],["5N0T_A_SAMA501_1","PEPTIDE N-METHYLTRANSFERASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"SER A 142;ALA A 181;GLN A 147;THR A 149","None","1.30A","5n0tA-2v7gA:undetectable","5n0tA-2v7gA:22.58"],["5TZO_B_7V7B201_2","ENDO-1,4-BETA-XYLANASE A","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",3,"ARG A 362;PRO A 360;TYR A  52","ACT A1558 (-2.9A);None;ACT A1558 ( 4.3A)","1.03A","5tzoB-2v7gA:undetectable","5tzoB-2v7gA:16.45"],["5WZ2_C_SAMC601_0","NS5 MTASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"GLY A 180;GLY A 144;GLY A 141;GLY A 177;ILE A 410","None;ACT A1558 (-3.4A);None;NAD A3001 (-3.8A);None","0.92A","5wz2C-2v7gA:4.8","5wz2C-2v7gA:19.40"],["5X2T_I_PEMI202_1","HEMOGLOBIN SUBUNIT ALPHA;HEMOGLOBIN SUBUNIT BETA;HEMOGLOBIN SUBUNIT ALPHA;HEMOGLOBIN SUBUNIT BETA","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",4,"ALA A 156;THR A 152;ALA A 181;TRP A 393","None","1.02A","5x2tI-2v7gA:undetectable;5x2tJ-2v7gA:undetectable;5x2tK-2v7gA:undetectable;5x2tL-2v7gA:undetectable","5x2tI-2v7gA:13.36;5x2tJ-2v7gA:13.92;5x2tK-2v7gA:13.36;5x2tL-2v7gA:13.92"],["6B68_C_9F2C302_1","BETA-LACTAMASE;BETA-LACTAMASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"THR A 187;PRO A 183;TYR A 211;THR A 209;ASP A 221","None","1.50A","6b68C-2v7gA:0.0;6b68D-2v7gA:0.0","6b68C-2v7gA:9.11;6b68D-2v7gA:9.11"],["6B69_A_9F2A302_1","BETA-LACTAMASE;BETA-LACTAMASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"THR A 187;PRO A 183;TYR A 211;THR A 209;ASP A 221","None","1.47A","6b69A-2v7gA:0.0;6b69B-2v7gA:0.0","6b69A-2v7gA:9.11;6b69B-2v7gA:9.11"],["6B69_C_9F2C302_1","BETA-LACTAMASE;BETA-LACTAMASE","2v7g","UROCANATE HYDRATASE","Pseudomonas putida",5,"THR A 187;PRO A 183;TYR A 211;THR A 209;ASP A 221","None","1.47A","6b69C-2v7gA:0.0;6b69D-2v7gA:0.0","6b69C-2v7gA:9.11;6b69D-2v7gA:9.11"]]