SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '2w9m'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_B_TRPB81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.22A	1c9sA-2w9mA: undetectable 1c9sB-2w9mA: undetectable	1c9sA-2w9mA: 8.00 1c9sB-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DVT_A_FLPA125_1 (TRANSTHYRETIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 8	LEU A 321 ALA A 533 LEU A 547 SER A 546	None	0.86A	1dvtA-2w9mA: undetectable 1dvtB-2w9mA: undetectable	1dvtA-2w9mA: 12.45 1dvtB-2w9mA: 12.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E9Y_B_HAEB800_1 (UREASE SUBUNIT BETA)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	HIS A 332 HIS A 428 HIS A 456 ASP A 516	ZN A1566 (-3.4A) ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-2.5A)	0.90A	1e9yB-2w9mA: 7.4	1e9yB-2w9mA: 24.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FML_A_RTLA401_0 (RETINOL DEHYDRATASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 100 LEU A 99 HIS A 456 HIS A 364 ILE A 26	None None ZN A1567 (-3.6A) ZN A1565 (-3.2A) None	1.36A	1fmlA-2w9mA: undetectable	1fmlA-2w9mA: 21.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FWE_C_HAEC989_1 (UREASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 6	HIS A 332 HIS A 334 HIS A 428 HIS A 456 ASP A 516	ZN A1566 (-3.4A) ZN A1566 (-3.5A) ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-2.5A)	0.94A	1fweC-2w9mA: 8.0	1fweC-2w9mA: 23.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FWE_C_HAEC989_1 (UREASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 6	HIS A 332 HIS A 364 HIS A 428 HIS A 456 ASP A 516	ZN A1566 (-3.4A) ZN A1565 (-3.2A) ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-2.5A)	1.14A	1fweC-2w9mA: 8.0	1fweC-2w9mA: 23.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_R_TRPR81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.26A	1gtnR-2w9mA: undetectable 1gtnS-2w9mA: undetectable	1gtnR-2w9mA: 8.00 1gtnS-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ITU_A_CILA451_1 (RENAL DIPEPTIDASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ASP A 516 GLU A 401 HIS A 364 HIS A 428 HIS A 456	ZN A1566 (-2.5A) ZN A1567 ( 2.4A) ZN A1565 (-3.2A) ZN A1567 (-3.4A) ZN A1567 (-3.6A)	0.91A	1ituA-2w9mA: 2.9	1ituA-2w9mA: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ITU_B_CILB452_1 (RENAL DIPEPTIDASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ASP A 516 GLU A 401 HIS A 364 HIS A 428 HIS A 456	ZN A1566 (-2.5A) ZN A1567 ( 2.4A) ZN A1565 (-3.2A) ZN A1567 (-3.4A) ZN A1567 (-3.6A)	0.96A	1ituB-2w9mA: 3.6	1ituB-2w9mA: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OE3_A_CUA502_0 (DISSIMILATORY COPPER-CONTAINING NITRITE REDUCTASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	ASP A 339 HIS A 334 HIS A 364	ZN A1565 (-2.1A) ZN A1566 (-3.5A) ZN A1565 (-3.2A)	0.69A	1oe3A-2w9mA: undetectable	1oe3A-2w9mA: 20.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OS2_D_HAED574_1 (MACROPHAGE METALLOELASTASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.15A	1os2D-2w9mA: undetectable	1os2D-2w9mA: 15.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SA1_B_PODB700_1 (TUBULIN ALPHA CHAIN TUBULIN BETA CHAIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 177 ALA A 174 LEU A 173 ALA A 198 ALA A 185	None	1.06A	1sa1A-2w9mA: undetectable 1sa1B-2w9mA: undetectable	1sa1A-2w9mA: 20.00 1sa1B-2w9mA: 21.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_D_TRPD81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.19A	1utdD-2w9mA: undetectable 1utdE-2w9mA: undetectable	1utdD-2w9mA: 8.00 1utdE-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_G_TRPG81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.20A	1utdG-2w9mA: undetectable 1utdH-2w9mA: undetectable	1utdG-2w9mA: 8.00 1utdH-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_J_TRPJ81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 8	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.20A	1utdJ-2w9mA: undetectable 1utdK-2w9mA: undetectable	1utdJ-2w9mA: 8.00 1utdK-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_K_TRPK81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.18A	1utdA-2w9mA: undetectable 1utdK-2w9mA: undetectable	1utdA-2w9mA: 8.00 1utdK-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_M_TRPM81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 11	ALA A 348 THR A 333 HIS A 334 THR A 361 ILE A 396	None None ZN A1566 (-3.5A) None None	1.24A	1utdM-2w9mA: undetectable 1utdN-2w9mA: undetectable	1utdM-2w9mA: 8.00 1utdN-2w9mA: 8.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTZ_A_HAEA1267_1 (MACROPHAGE METALLOELASTASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.10A	1utzA-2w9mA: undetectable	1utzA-2w9mA: 15.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTZ_B_HAEB1266_1 (MACROPHAGE METALLOELASTASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.10A	1utzB-2w9mA: undetectable	1utzB-2w9mA: 15.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WMQ_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.92A	1wmqA-2w9mA: undetectable	1wmqA-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WMQ_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.92A	1wmqB-2w9mA: undetectable	1wmqB-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WPU_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.92A	1wpuA-2w9mA: undetectable	1wpuA-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WPU_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.92A	1wpuB-2w9mA: undetectable	1wpuB-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WRQ_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.93A	1wrqA-2w9mA: undetectable	1wrqA-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WRQ_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	0.91A	1wrqB-2w9mA: undetectable	1wrqB-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZEA_A_DHIA6_0 (MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, H CHAIN MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, L CHAIN SHORT SYNTHETIC D-AMINO ACID PEPTIDE D2)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	TRP A 312 ARG A 304 PHE A 255	None	1.33A	1zeaH-2w9mA: undetectable 1zeaL-2w9mA: undetectable	1zeaH-2w9mA: 17.56 1zeaL-2w9mA: 16.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A58_A_RBFA300_1 (6,7-DIMETHYL-8-RIBIT YLLUMAZINE SYNTHASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 11	TYR A 422 GLY A 399 SER A 400 HIS A 334 ILE A 344	None None None ZN A1566 (-3.5A) None	1.43A	2a58A-2w9mA: undetectable 2a58E-2w9mA: undetectable	2a58A-2w9mA: 16.33 2a58E-2w9mA: 16.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A58_D_RBFD303_1 (6,7-DIMETHYL-8-RIBIT YLLUMAZINE SYNTHASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 11	ILE A 344 TYR A 422 GLY A 399 SER A 400 HIS A 334	None None None None ZN A1566 (-3.5A)	1.43A	2a58C-2w9mA: undetectable 2a58D-2w9mA: undetectable	2a58C-2w9mA: 16.33 2a58D-2w9mA: 16.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXE_B_1FLB2002_1 (SERUM ALBUMIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 11	ALA A 457 LEU A 442 ALA A 445 LEU A 472 VAL A 475	None	1.09A	2bxeB-2w9mA: undetectable	2bxeB-2w9mA: 23.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXG_B_IBPB2002_1 (SERUM ALBUMIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	ALA A 457 LEU A 442 ALA A 445 LEU A 472 VAL A 475	None	1.05A	2bxgB-2w9mA: undetectable	2bxgB-2w9mA: 23.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F80_B_017B301_1 (POL POLYPROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 410 ASN A 430 VAL A 427 VAL A 425 ILE A 404	None	1.00A	2f80A-2w9mA: undetectable	2f80A-2w9mA: 9.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2O4P_A_TPVA300_2 (PROTEASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	LEU A 410 VAL A 427 ILE A 443 VAL A 425 ILE A 404	None	0.98A	2o4pB-2w9mA: undetectable	2o4pB-2w9mA: 10.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OW9_B_HAEB502_1 (COLLAGENASE 3)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.06A	2ow9B-2w9mA: undetectable	2ow9B-2w9mA: 14.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OZR_C_HAEC3001_1 (COLLAGENASE 3)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.10A	2ozrC-2w9mA: undetectable	2ozrC-2w9mA: 14.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OZR_D_HAED3002_1 (COLLAGENASE 3)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	HIS A 364 GLU A 401 HIS A 334 HIS A 518	ZN A1565 (-3.2A) ZN A1567 ( 2.4A) ZN A1566 (-3.5A) ZN A1565 (-3.3A)	1.09A	2ozrD-2w9mA: undetectable	2ozrD-2w9mA: 14.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PYN_A_1UNA1001_3 (PROTEASE RETROPEPSIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	ASP A 295 THR A 284 PRO A 285	None	0.70A	2pynB-2w9mA: undetectable	2pynB-2w9mA: 10.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q64_B_1UNB1001_4 (PROTEASE RETROPEPSIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	ASP A 295 THR A 284 PRO A 285	None	0.67A	2q64B-2w9mA: undetectable	2q64B-2w9mA: 10.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QD4_A_CHDA803_0 (FERROCHELATASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	LEU A 92 PRO A 93 ILE A 26 ARG A 111	None ZN A1565 ( 4.2A) None None	0.84A	2qd4A-2w9mA: 2.8	2qd4A-2w9mA: 20.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QD4_B_CHDB927_0 (FERROCHELATASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	LEU A 92 PRO A 93 ARG A 111	None ZN A1565 ( 4.2A) None	0.50A	2qd4B-2w9mA: undetectable	2qd4B-2w9mA: 20.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOY_A_HISA1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	ARG A 494 GLY A 90 ALA A 88 HIS A 428 HIS A 364	ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A) ZN A1565 (-3.2A)	1.02A	3boyA-2w9mA: undetectable 3boyC-2w9mA: undetectable	3boyA-2w9mA: 14.56 3boyC-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOY_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	HIS A 364 ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1565 (-3.2A) ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	1.02A	3boyA-2w9mA: undetectable 3boyB-2w9mA: undetectable	3boyA-2w9mA: 14.56 3boyB-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOY_A_HISA3001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	HIS A 364 ARG A 494 GLY A 90 ALA A 88 HIS A 428	ZN A1565 (-3.2A) ZN A1567 ( 4.8A) None None ZN A1567 (-3.4A)	1.02A	3boyB-2w9mA: undetectable 3boyC-2w9mA: undetectable	3boyB-2w9mA: 14.56 3boyC-2w9mA: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3C0Z_C_SHHC301_1 (HISTONE DEACETYLASE 7A)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ASP A 403 HIS A 332 ASP A 516 HIS A 456	None ZN A1566 (-3.4A) ZN A1566 (-2.5A) ZN A1567 (-3.6A)	0.92A	3c0zC-2w9mA: undetectable	3c0zC-2w9mA: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NS1_C_PM6C1_1 (XANTHINE DEHYDROGENASE/OXIDAS E)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	GLU A 86 THR A 20 ALA A 89 ALA A 88	None	1.26A	3ns1C-2w9mA: undetectable	3ns1C-2w9mA: 23.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OU6_C_SAMC300_0 (SAM-DEPENDENT METHYLTRANSFERASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 420 GLU A 487 GLY A 399 SER A 400 ASP A 421	None	1.31A	3ou6C-2w9mA: undetectable	3ou6C-2w9mA: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OU7_A_SAMA300_0 (SAM-DEPENDENT METHYLTRANSFERASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 154 GLY A 104 GLY A 101 ASP A 98 LEU A 99	None	1.22A	3ou7A-2w9mA: undetectable	3ou7A-2w9mA: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OU7_D_SAMD300_0 (SAM-DEPENDENT METHYLTRANSFERASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 154 GLY A 104 GLY A 101 ASP A 98 LEU A 99	None	1.23A	3ou7D-2w9mA: undetectable	3ou7D-2w9mA: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T01_A_PPFA503_1 (PHOSPHONOACETATE HYDROLASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	ASN A 491 ASP A 339 HIS A 364 HIS A 334	None ZN A1565 (-2.1A) ZN A1565 (-3.2A) ZN A1566 (-3.5A)	1.06A	3t01A-2w9mA: undetectable	3t01A-2w9mA: 25.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TKG_C_ROCC901_3 (PROTEASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	ASP A 295 THR A 284 PRO A 285	None	0.62A	3tkgD-2w9mA: undetectable	3tkgD-2w9mA: 9.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VHU_A_SNLA1001_2 (MINERALOCORTICOID RECEPTOR)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	LEU A 200 LEU A 177 LEU A 224 SER A 225	None	0.95A	3vhuA-2w9mA: undetectable	3vhuA-2w9mA: 18.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W1W_A_CHDA1504_0 (FERROCHELATASE, MITOCHONDRIAL)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 4	PRO A 93 LEU A 96 ILE A 26 ARG A 111	ZN A1565 ( 4.2A) None None None	1.24A	3w1wA-2w9mA: undetectable	3w1wA-2w9mA: 21.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WDM_B_ADNB301_1 (4-PHOSPHOPANTOATE--B ETA-ALANINE LIGASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	ALA A 238 GLY A 204 LEU A 224 LEU A 180 ILE A 235	None	1.08A	3wdmB-2w9mA: undetectable	3wdmB-2w9mA: 19.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WDM_C_ADNC301_1 (4-PHOSPHOPANTOATE--B ETA-ALANINE LIGASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 9	ALA A 238 GLY A 204 LEU A 224 LEU A 180 ILE A 235	None	1.07A	3wdmC-2w9mA: undetectable	3wdmC-2w9mA: 19.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WDM_D_ADND301_1 (4-PHOSPHOPANTOATE--B ETA-ALANINE LIGASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	ALA A 238 GLY A 204 LEU A 224 LEU A 180 ILE A 235	None	1.09A	3wdmD-2w9mA: undetectable	3wdmD-2w9mA: 19.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AE1_A_NCAA1536_0 (DIPHTHERIA TOXIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	GLY A 166 TYR A 228 ALA A 165 GLU A 229	None	0.94A	4ae1A-2w9mA: undetectable	4ae1A-2w9mA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9N_A_CAMA1419_0 (CYTOCHROME P450)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 8	LEU A 99 LEU A 96 GLY A 95 VAL A 519	None	0.77A	4c9nA-2w9mA: undetectable	4c9nA-2w9mA: 25.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EXS_B_X8ZB301_1 (BETA-LACTAMASE NDM-1)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 8	HIS A 456 ASP A 516 HIS A 428 HIS A 334	ZN A1567 (-3.6A) ZN A1566 (-2.5A) ZN A1567 (-3.4A) ZN A1566 (-3.5A)	0.90A	4exsB-2w9mA: undetectable	4exsB-2w9mA: 19.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4H9M_A_HAEA929_1 (UREASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	HIS A 332 HIS A 428 HIS A 456 ASP A 516	ZN A1566 (-3.4A) ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-2.5A)	0.95A	4h9mA-2w9mA: 7.2	4h9mA-2w9mA: 22.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4M2V_A_BZ1A302_2 (CARBONIC ANHYDRASE 2)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	HIS A 428 VAL A 475 LEU A 454	ZN A1567 (-3.4A) None None	0.64A	4m2vA-2w9mA: undetectable	4m2vA-2w9mA: 17.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWZ_A_SAMA301_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ILE A 62 ILE A 69 ARG A 35 SER A 39 LEU A 17	None	1.05A	4mwzA-2w9mA: undetectable	4mwzA-2w9mA: 18.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NKV_A_AERA601_2 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	LEU A 173 ASP A 227 GLU A 199 VAL A 223	None	1.25A	4nkvA-2w9mA: undetectable	4nkvA-2w9mA: 22.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4O2B_B_LOCB503_1 (TUBULIN ALPHA-1B CHAIN TUBULIN BETA-2B CHAIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	SER A 400 ALA A 398 VAL A 397	None	0.52A	4o2bA-2w9mA: undetectable	4o2bA-2w9mA: 21.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4O2B_D_LOCD503_1 (TUBULIN ALPHA-1B CHAIN TUBULIN BETA-2B CHAIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	SER A 400 ALA A 398 VAL A 397	None	0.57A	4o2bC-2w9mA: undetectable	4o2bC-2w9mA: 21.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6S_A_DAHA305_1 (TYROSINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	HIS A 334 HIS A 332 HIS A 456 HIS A 428	ZN A1566 (-3.5A) ZN A1566 (-3.4A) ZN A1567 (-3.6A) ZN A1567 (-3.4A)	0.92A	4p6sA-2w9mA: undetectable	4p6sA-2w9mA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6S_B_DAHB305_1 (TYROSINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	HIS A 334 HIS A 332 HIS A 456 HIS A 428	ZN A1566 (-3.5A) ZN A1566 (-3.4A) ZN A1567 (-3.6A) ZN A1567 (-3.4A)	0.96A	4p6sB-2w9mA: undetectable	4p6sB-2w9mA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6S_B_DAHB305_1 (TYROSINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	HIS A 428 HIS A 456 HIS A 332 HIS A 334	ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-3.4A) ZN A1566 (-3.5A)	0.72A	4p6sB-2w9mA: undetectable	4p6sB-2w9mA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q15_A_HFGA803_1 (PROLINE--TRNA LIGASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	GLU A 507 THR A 539 HIS A 542	None	0.86A	4q15A-2w9mA: undetectable	4q15A-2w9mA: 21.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R7L_A_SHHA709_1 (LEUKOTRIENE A-4 HYDROLASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ALA A 517 HIS A 428 HIS A 456 GLU A 401 LEU A 359	None ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1567 ( 2.4A) None	1.18A	4r7lA-2w9mA: undetectable	4r7lA-2w9mA: 23.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UBP_C_HAEC800_1 (PROTEIN (UREASE (CHAIN C)))	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 6	HIS A 332 HIS A 334 HIS A 428 HIS A 456 ASP A 516	ZN A1566 (-3.4A) ZN A1566 (-3.5A) ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-2.5A)	0.95A	4ubpC-2w9mA: 5.8	4ubpC-2w9mA: 22.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YDQ_B_HFGB802_1 (PROLINE--TRNA LIGASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	GLU A 507 THR A 539 HIS A 542	None	0.75A	4ydqB-2w9mA: undetectable	4ydqB-2w9mA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z2E_F_TR6F101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B SYMMETRIZED E-SITE DNA)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	GLY A 267 ARG A 277 GLY A 278 GLU A 280	None	1.17A	4z2eB-2w9mA: undetectable 4z2eC-2w9mA: undetectable	4z2eB-2w9mA: 25.36 4z2eC-2w9mA: 20.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A5Z_A_WJZA304_0 (BETA-LACTAMASE NDM-1)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 8	HIS A 456 ASP A 516 HIS A 428 HIS A 334	ZN A1567 (-3.6A) ZN A1566 (-2.5A) ZN A1567 (-3.4A) ZN A1566 (-3.5A)	0.91A	5a5zA-2w9mA: undetectable	5a5zA-2w9mA: 19.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 7	ALA A 183 ASP A 187 ARG A 196 GLY A 252 GLU A 253	None	1.13A	5btgA-2w9mA: undetectable 5btgC-2w9mA: undetectable 5btgD-2w9mA: undetectable	5btgA-2w9mA: 24.64 5btgC-2w9mA: 24.64 5btgD-2w9mA: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DWK_C_ACTC207_0 (DIACYLGLYCEROL KINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	GLU A 172 ALA A 168 GLU A 126 GLU A 229	None	1.31A	5dwkC-2w9mA: undetectable	5dwkC-2w9mA: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DWK_C_ACTC207_0 (DIACYLGLYCEROL KINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	GLU A 172 ALA A 168 GLU A 171 GLU A 129	None	1.43A	5dwkC-2w9mA: undetectable	5dwkC-2w9mA: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EB5_B_010B607_0 (HNL ISOENZYME 5)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 10	ALA A 512 VAL A 453 HIS A 332 VAL A 424 TYR A 422	None None ZN A1566 (-3.4A) None None	1.48A	5eb5B-2w9mA: undetectable	5eb5B-2w9mA: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I3A_A_HQEA303_1 (TYROSINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	HIS A 428 HIS A 456 HIS A 332 HIS A 334	ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-3.4A) ZN A1566 (-3.5A)	0.73A	5i3aA-2w9mA: undetectable	5i3aA-2w9mA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I3A_B_HQEB304_1 (TYROSINASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 7	HIS A 428 HIS A 456 HIS A 332 HIS A 334	ZN A1567 (-3.4A) ZN A1567 (-3.6A) ZN A1566 (-3.4A) ZN A1566 (-3.5A)	0.72A	5i3aB-2w9mA: undetectable	5i3aB-2w9mA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MFX_A_ACTA701_0 (GENOME POLYPROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	ARG A 189 THR A 201 ALA A 183 ASP A 247	None	1.27A	5mfxA-2w9mA: undetectable	5mfxA-2w9mA: 23.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ILE A 404 VAL A 424 VAL A 423 SER A 426 ILE A 443	None None None ZN A1567 ( 4.3A) None	1.16A	5n0sB-2w9mA: undetectable	5n0sB-2w9mA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NCD_A_ACTA301_0 (PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ASP A 339 HIS A 518 HIS A 334 HIS A 428	ZN A1565 (-2.1A) ZN A1565 (-3.3A) ZN A1566 (-3.5A) ZN A1567 (-3.4A)	0.76A	5ncdA-2w9mA: 2.9 5ncdD-2w9mA: 2.4	5ncdA-2w9mA: 17.62 5ncdD-2w9mA: 17.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NCD_C_ACTC301_0 (PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	HIS A 428 ASP A 339 HIS A 518 HIS A 334	ZN A1567 (-3.4A) ZN A1565 (-2.1A) ZN A1565 (-3.3A) ZN A1566 (-3.5A)	0.81A	5ncdB-2w9mA: 2.9 5ncdC-2w9mA: 2.7	5ncdB-2w9mA: 17.62 5ncdC-2w9mA: 17.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NEL_A_ACTA302_0 (PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	ASP A 339 HIS A 518 HIS A 334 HIS A 428	ZN A1565 (-2.1A) ZN A1565 (-3.3A) ZN A1566 (-3.5A) ZN A1567 (-3.4A)	0.85A	5nelA-2w9mA: 2.3 5nelD-2w9mA: 3.7	5nelA-2w9mA: 17.62 5nelD-2w9mA: 17.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OEX_A_CUA601_0 (THIOCYANATE DEHYDROGENASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	HIS A 518 ASP A 339 HIS A 364	ZN A1565 (-3.3A) ZN A1565 (-2.1A) ZN A1565 (-3.2A)	0.45A	5oexA-2w9mA: undetectable	5oexA-2w9mA: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OEX_B_CUB601_0 (THIOCYANATE DEHYDROGENASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	HIS A 518 ASP A 339 HIS A 364	ZN A1565 (-3.3A) ZN A1565 (-2.1A) ZN A1565 (-3.2A)	0.41A	5oexB-2w9mA: undetectable	5oexB-2w9mA: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OEX_C_CUC601_0 (THIOCYANATE DEHYDROGENASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	HIS A 518 ASP A 339 HIS A 364	ZN A1565 (-3.3A) ZN A1565 (-2.1A) ZN A1565 (-3.2A)	0.37A	5oexC-2w9mA: undetectable	5oexC-2w9mA: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OEX_D_CUD601_0 (THIOCYANATE DEHYDROGENASE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	HIS A 518 ASP A 339 HIS A 364	ZN A1565 (-3.3A) ZN A1565 (-2.1A) ZN A1565 (-3.2A)	0.37A	5oexD-2w9mA: undetectable	5oexD-2w9mA: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TZO_B_7V7B201_1 (ENDO-1,4-BETA-XYLANA SE A)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	LEU A 294 PHE A 291 VAL A 290 ALA A 242 GLY A 244	None	1.16A	5tzoB-2w9mA: undetectable	5tzoB-2w9mA: 14.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UBB_A_SAMA301_1 (ALPHA N-TERMINAL PROTEIN METHYLTRANSFERASE 1B)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 5	GLY A 230 ARG A 125 ASP A 227 GLN A 219	None	1.42A	5ubbA-2w9mA: undetectable	5ubbA-2w9mA: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X6Y_A_SAMA902_0 (MRNA CAPPING ENZYME P5)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	GLY A 244 PRO A 239 ALA A 238 PHE A 291 THR A 286	None	1.30A	5x6yA-2w9mA: undetectable	5x6yA-2w9mA: 21.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X6Y_C_SAMC902_0 (MRNA CAPPING ENZYME P5)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	GLY A 244 PRO A 239 ALA A 238 PHE A 291 THR A 286	None	1.32A	5x6yC-2w9mA: undetectable	5x6yC-2w9mA: 21.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XIW_D_LOCD503_1 (TUBULIN ALPHA-1B CHAIN TUBULIN BETA CHAIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	SER A 400 ALA A 398 VAL A 397	None	0.49A	5xiwC-2w9mA: undetectable	5xiwC-2w9mA: 8.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Y9Y_A_ACTA412_0 (UNCHARACTERIZED PROTEIN KDOO)	2w9m	POLYMERASE X (Deinococcus radiodurans)	3 / 3	ARG A 189 PHE A 298 ARG A 304	None	1.08A	5y9yA-2w9mA: undetectable	5y9yA-2w9mA: 21.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZJ8_A_9DCA303_0 (METALLO-BETA-LACTAMA SE TYPE 2)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 8	HIS A 456 ASP A 516 HIS A 428 HIS A 334	ZN A1567 (-3.6A) ZN A1566 (-2.5A) ZN A1567 (-3.4A) ZN A1566 (-3.5A)	0.94A	5zj8A-2w9mA: undetectable	5zj8A-2w9mA: 18.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CCV_C_RFPC1205_1 (-)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	ASP A 516 LEU A 442 ARG A 441 ARG A 494 HIS A 334	ZN A1566 (-2.5A) None None ZN A1567 ( 4.8A) ZN A1566 (-3.5A)	1.15A	6ccvC-2w9mA: 0.0	6ccvC-2w9mA: 20.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EXI_D_ADND502_0 (ADENOSYLHOMOCYSTEINA SE)	2w9m	POLYMERASE X (Deinococcus radiodurans)	5 / 12	THR A 361 ASP A 516 HIS A 428 GLY A 340 HIS A 518	None ZN A1566 (-2.5A) ZN A1567 (-3.4A) None ZN A1565 (-3.3A)	1.11A	6exiD-2w9mA: 2.7	6exiD-2w9mA: 9.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MVX_A_K4DA1304_0 (ION TRANSPORT PROTEIN)	2w9m	POLYMERASE X (Deinococcus radiodurans)	4 / 6	THR A 351 LEU A 354 THR A 333 LEU A 327	None	1.10A	6mvxA-2w9mA: undetectable 6mvxB-2w9mA: undetectable 6mvxC-2w9mA: undetectable	6mvxA-2w9mA: 17.87 6mvxB-2w9mA: 17.87 6mvxC-2w9mA: 17.87

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_B_TRPB81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.22A","1c9sA-2w9mA:undetectable;1c9sB-2w9mA:undetectable","1c9sA-2w9mA:8.00;1c9sB-2w9mA:8.00"],["1DVT_A_FLPA125_1","TRANSTHYRETIN;TRANSTHYRETIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"LEU A 321;ALA A 533;LEU A 547;SER A 546","None","0.86A","1dvtA-2w9mA:undetectable;1dvtB-2w9mA:undetectable","1dvtA-2w9mA:12.45;1dvtB-2w9mA:12.45"],["1E9Y_B_HAEB800_1","UREASE SUBUNIT BETA","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 332;HIS A 428;HIS A 456;ASP A 516"," ZN A1566 (-3.4A); ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-2.5A)","0.90A","1e9yB-2w9mA:7.4","1e9yB-2w9mA:24.13"],["1FML_A_RTLA401_0","RETINOL DEHYDRATASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 100;LEU A  99;HIS A 456;HIS A 364;ILE A  26","None;None; ZN A1567 (-3.6A); ZN A1565 (-3.2A);None","1.36A","1fmlA-2w9mA:undetectable","1fmlA-2w9mA:21.25"],["1FWE_C_HAEC989_1","UREASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"HIS A 332;HIS A 334;HIS A 428;HIS A 456;ASP A 516"," ZN A1566 (-3.4A); ZN A1566 (-3.5A); ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-2.5A)","0.94A","1fweC-2w9mA:8.0","1fweC-2w9mA:23.81"],["1FWE_C_HAEC989_1","UREASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"HIS A 332;HIS A 364;HIS A 428;HIS A 456;ASP A 516"," ZN A1566 (-3.4A); ZN A1565 (-3.2A); ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-2.5A)","1.14A","1fweC-2w9mA:8.0","1fweC-2w9mA:23.81"],["1GTN_R_TRPR81_0","TRP RNA-BINDING ATTENUATION PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.26A","1gtnR-2w9mA:undetectable;1gtnS-2w9mA:undetectable","1gtnR-2w9mA:8.00;1gtnS-2w9mA:8.00"],["1ITU_A_CILA451_1","RENAL DIPEPTIDASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ASP A 516;GLU A 401;HIS A 364;HIS A 428;HIS A 456"," ZN A1566 (-2.5A); ZN A1567 ( 2.4A); ZN A1565 (-3.2A); ZN A1567 (-3.4A); ZN A1567 (-3.6A)","0.91A","1ituA-2w9mA:2.9","1ituA-2w9mA:21.29"],["1ITU_B_CILB452_1","RENAL DIPEPTIDASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ASP A 516;GLU A 401;HIS A 364;HIS A 428;HIS A 456"," ZN A1566 (-2.5A); ZN A1567 ( 2.4A); ZN A1565 (-3.2A); ZN A1567 (-3.4A); ZN A1567 (-3.6A)","0.96A","1ituB-2w9mA:3.6","1ituB-2w9mA:21.29"],["1OE3_A_CUA502_0","DISSIMILATORY COPPER-CONTAINING NITRITE REDUCTASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"ASP A 339;HIS A 334;HIS A 364"," ZN A1565 (-2.1A); ZN A1566 (-3.5A); ZN A1565 (-3.2A)","0.69A","1oe3A-2w9mA:undetectable","1oe3A-2w9mA:20.24"],["1OS2_D_HAED574_1","MACROPHAGE METALLOELASTASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.15A","1os2D-2w9mA:undetectable","1os2D-2w9mA:15.82"],["1SA1_B_PODB700_1","TUBULIN ALPHA CHAIN;TUBULIN BETA CHAIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 177;ALA A 174;LEU A 173;ALA A 198;ALA A 185","None","1.06A","1sa1A-2w9mA:undetectable;1sa1B-2w9mA:undetectable","1sa1A-2w9mA:20.00;1sa1B-2w9mA:21.54"],["1UTD_D_TRPD81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.19A","1utdD-2w9mA:undetectable;1utdE-2w9mA:undetectable","1utdD-2w9mA:8.00;1utdE-2w9mA:8.00"],["1UTD_G_TRPG81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.20A","1utdG-2w9mA:undetectable;1utdH-2w9mA:undetectable","1utdG-2w9mA:8.00;1utdH-2w9mA:8.00"],["1UTD_J_TRPJ81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.20A","1utdJ-2w9mA:undetectable;1utdK-2w9mA:undetectable","1utdJ-2w9mA:8.00;1utdK-2w9mA:8.00"],["1UTD_K_TRPK81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.18A","1utdA-2w9mA:undetectable;1utdK-2w9mA:undetectable","1utdA-2w9mA:8.00;1utdK-2w9mA:8.00"],["1UTD_M_TRPM81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 348;THR A 333;HIS A 334;THR A 361;ILE A 396","None;None; ZN A1566 (-3.5A);None;None","1.24A","1utdM-2w9mA:undetectable;1utdN-2w9mA:undetectable","1utdM-2w9mA:8.00;1utdN-2w9mA:8.00"],["1UTZ_A_HAEA1267_1","MACROPHAGE METALLOELASTASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.10A","1utzA-2w9mA:undetectable","1utzA-2w9mA:15.99"],["1UTZ_B_HAEB1266_1","MACROPHAGE METALLOELASTASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.10A","1utzB-2w9mA:undetectable","1utzB-2w9mA:15.99"],["1WMQ_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.92A","1wmqA-2w9mA:undetectable","1wmqA-2w9mA:14.56"],["1WMQ_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.92A","1wmqB-2w9mA:undetectable","1wmqB-2w9mA:14.56"],["1WPU_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.92A","1wpuA-2w9mA:undetectable","1wpuA-2w9mA:14.56"],["1WPU_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.92A","1wpuB-2w9mA:undetectable","1wpuB-2w9mA:14.56"],["1WRQ_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.93A","1wrqA-2w9mA:undetectable","1wrqA-2w9mA:14.56"],["1WRQ_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","0.91A","1wrqB-2w9mA:undetectable","1wrqB-2w9mA:14.56"],["1ZEA_A_DHIA6_0","MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, H CHAIN;MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, L CHAIN;SHORT SYNTHETIC D-AMINO ACID PEPTIDE D2","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"TRP A 312;ARG A 304;PHE A 255","None","1.33A","1zeaH-2w9mA:undetectable;1zeaL-2w9mA:undetectable","1zeaH-2w9mA:17.56;1zeaL-2w9mA:16.27"],["2A58_A_RBFA300_1","6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE;6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"TYR A 422;GLY A 399;SER A 400;HIS A 334;ILE A 344","None;None;None; ZN A1566 (-3.5A);None","1.43A","2a58A-2w9mA:undetectable;2a58E-2w9mA:undetectable","2a58A-2w9mA:16.33;2a58E-2w9mA:16.33"],["2A58_D_RBFD303_1","6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE;6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ILE A 344;TYR A 422;GLY A 399;SER A 400;HIS A 334","None;None;None;None; ZN A1566 (-3.5A)","1.43A","2a58C-2w9mA:undetectable;2a58D-2w9mA:undetectable","2a58C-2w9mA:16.33;2a58D-2w9mA:16.33"],["2BXE_B_1FLB2002_1","SERUM ALBUMIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 457;LEU A 442;ALA A 445;LEU A 472;VAL A 475","None","1.09A","2bxeB-2w9mA:undetectable","2bxeB-2w9mA:23.59"],["2BXG_B_IBPB2002_1","SERUM ALBUMIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 457;LEU A 442;ALA A 445;LEU A 472;VAL A 475","None","1.05A","2bxgB-2w9mA:undetectable","2bxgB-2w9mA:23.59"],["2F80_B_017B301_1","POL POLYPROTEIN;POL POLYPROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 410;ASN A 430;VAL A 427;VAL A 425;ILE A 404","None","1.00A","2f80A-2w9mA:undetectable","2f80A-2w9mA:9.93"],["2O4P_A_TPVA300_2","PROTEASE;PROTEASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 410;VAL A 427;ILE A 443;VAL A 425;ILE A 404","None","0.98A","2o4pB-2w9mA:undetectable","2o4pB-2w9mA:10.33"],["2OW9_B_HAEB502_1","COLLAGENASE 3","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.06A","2ow9B-2w9mA:undetectable","2ow9B-2w9mA:14.49"],["2OZR_C_HAEC3001_1","COLLAGENASE 3","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.10A","2ozrC-2w9mA:undetectable","2ozrC-2w9mA:14.49"],["2OZR_D_HAED3002_1","COLLAGENASE 3","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 364;GLU A 401;HIS A 334;HIS A 518"," ZN A1565 (-3.2A); ZN A1567 ( 2.4A); ZN A1566 (-3.5A); ZN A1565 (-3.3A)","1.09A","2ozrD-2w9mA:undetectable","2ozrD-2w9mA:14.49"],["2PYN_A_1UNA1001_3","PROTEASE RETROPEPSIN;PROTEASE RETROPEPSIN","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"ASP A 295;THR A 284;PRO A 285","None","0.70A","2pynB-2w9mA:undetectable","2pynB-2w9mA:10.33"],["2Q64_B_1UNB1001_4","PROTEASE RETROPEPSIN","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"ASP A 295;THR A 284;PRO A 285","None","0.67A","2q64B-2w9mA:undetectable","2q64B-2w9mA:10.51"],["2QD4_A_CHDA803_0","FERROCHELATASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"LEU A  92;PRO A  93;ILE A  26;ARG A 111","None; ZN A1565 ( 4.2A);None;None","0.84A","2qd4A-2w9mA:2.8","2qd4A-2w9mA:20.91"],["2QD4_B_CHDB927_0","FERROCHELATASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"LEU A  92;PRO A  93;ARG A 111","None; ZN A1565 ( 4.2A);None","0.50A","2qd4B-2w9mA:undetectable","2qd4B-2w9mA:20.91"],["3BOY_A_HISA1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ARG A 494;GLY A  90;ALA A  88;HIS A 428;HIS A 364"," ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A); ZN A1565 (-3.2A)","1.02A","3boyA-2w9mA:undetectable;3boyC-2w9mA:undetectable","3boyA-2w9mA:14.56;3boyC-2w9mA:14.56"],["3BOY_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"HIS A 364;ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1565 (-3.2A); ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","1.02A","3boyA-2w9mA:undetectable;3boyB-2w9mA:undetectable","3boyA-2w9mA:14.56;3boyB-2w9mA:14.56"],["3BOY_A_HISA3001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"HIS A 364;ARG A 494;GLY A  90;ALA A  88;HIS A 428"," ZN A1565 (-3.2A); ZN A1567 ( 4.8A);None;None; ZN A1567 (-3.4A)","1.02A","3boyB-2w9mA:undetectable;3boyC-2w9mA:undetectable","3boyB-2w9mA:14.56;3boyC-2w9mA:14.56"],["3C0Z_C_SHHC301_1","HISTONE DEACETYLASE 7A","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ASP A 403;HIS A 332;ASP A 516;HIS A 456","None; ZN A1566 (-3.4A); ZN A1566 (-2.5A); ZN A1567 (-3.6A)","0.92A","3c0zC-2w9mA:undetectable","3c0zC-2w9mA:22.47"],["3NS1_C_PM6C1_1","XANTHINE DEHYDROGENASE\/OXIDASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLU A  86;THR A  20;ALA A  89;ALA A  88","None","1.26A","3ns1C-2w9mA:undetectable","3ns1C-2w9mA:23.31"],["3OU6_C_SAMC300_0","SAM-DEPENDENT METHYLTRANSFERASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 420;GLU A 487;GLY A 399;SER A 400;ASP A 421","None","1.31A","3ou6C-2w9mA:undetectable","3ou6C-2w9mA:20.49"],["3OU7_A_SAMA300_0","SAM-DEPENDENT METHYLTRANSFERASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 154;GLY A 104;GLY A 101;ASP A  98;LEU A  99","None","1.22A","3ou7A-2w9mA:undetectable","3ou7A-2w9mA:20.49"],["3OU7_D_SAMD300_0","SAM-DEPENDENT METHYLTRANSFERASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 154;GLY A 104;GLY A 101;ASP A  98;LEU A  99","None","1.23A","3ou7D-2w9mA:undetectable","3ou7D-2w9mA:20.49"],["3T01_A_PPFA503_1","PHOSPHONOACETATE HYDROLASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ASN A 491;ASP A 339;HIS A 364;HIS A 334","None; ZN A1565 (-2.1A); ZN A1565 (-3.2A); ZN A1566 (-3.5A)","1.06A","3t01A-2w9mA:undetectable","3t01A-2w9mA:25.94"],["3TKG_C_ROCC901_3","PROTEASE;PROTEASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"ASP A 295;THR A 284;PRO A 285","None","0.62A","3tkgD-2w9mA:undetectable","3tkgD-2w9mA:9.87"],["3VHU_A_SNLA1001_2","MINERALOCORTICOID RECEPTOR","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"LEU A 200;LEU A 177;LEU A 224;SER A 225","None","0.95A","3vhuA-2w9mA:undetectable","3vhuA-2w9mA:18.15"],["3W1W_A_CHDA1504_0","FERROCHELATASE, MITOCHONDRIAL","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"PRO A  93;LEU A  96;ILE A  26;ARG A 111"," ZN A1565 ( 4.2A);None;None;None","1.24A","3w1wA-2w9mA:undetectable","3w1wA-2w9mA:21.38"],["3WDM_B_ADNB301_1","4-PHOSPHOPANTOATE--BETA-ALANINE LIGASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 238;GLY A 204;LEU A 224;LEU A 180;ILE A 235","None","1.08A","3wdmB-2w9mA:undetectable","3wdmB-2w9mA:19.46"],["3WDM_C_ADNC301_1","4-PHOSPHOPANTOATE--BETA-ALANINE LIGASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 238;GLY A 204;LEU A 224;LEU A 180;ILE A 235","None","1.07A","3wdmC-2w9mA:undetectable","3wdmC-2w9mA:19.46"],["3WDM_D_ADND301_1","4-PHOSPHOPANTOATE--BETA-ALANINE LIGASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 238;GLY A 204;LEU A 224;LEU A 180;ILE A 235","None","1.09A","3wdmD-2w9mA:undetectable","3wdmD-2w9mA:19.46"],["4AE1_A_NCAA1536_0","DIPHTHERIA TOXIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLY A 166;TYR A 228;ALA A 165;GLU A 229","None","0.94A","4ae1A-2w9mA:undetectable","4ae1A-2w9mA:undetectable"],["4C9N_A_CAMA1419_0","CYTOCHROME P450","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"LEU A  99;LEU A  96;GLY A  95;VAL A 519","None","0.77A","4c9nA-2w9mA:undetectable","4c9nA-2w9mA:25.55"],["4EXS_B_X8ZB301_1","BETA-LACTAMASE NDM-1","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 456;ASP A 516;HIS A 428;HIS A 334"," ZN A1567 (-3.6A); ZN A1566 (-2.5A); ZN A1567 (-3.4A); ZN A1566 (-3.5A)","0.90A","4exsB-2w9mA:undetectable","4exsB-2w9mA:19.45"],["4H9M_A_HAEA929_1","UREASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 332;HIS A 428;HIS A 456;ASP A 516"," ZN A1566 (-3.4A); ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-2.5A)","0.95A","4h9mA-2w9mA:7.2","4h9mA-2w9mA:22.31"],["4M2V_A_BZ1A302_2","CARBONIC ANHYDRASE 2","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"HIS A 428;VAL A 475;LEU A 454"," ZN A1567 (-3.4A);None;None","0.64A","4m2vA-2w9mA:undetectable","4m2vA-2w9mA:17.05"],["4MWZ_A_SAMA301_0","PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ILE A  62;ILE A  69;ARG A  35;SER A  39;LEU A  17","None","1.05A","4mwzA-2w9mA:undetectable","4mwzA-2w9mA:18.17"],["4NKV_A_AERA601_2","STEROID 17-ALPHA-HYDROXYLASE\/17,20 LYASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"LEU A 173;ASP A 227;GLU A 199;VAL A 223","None","1.25A","4nkvA-2w9mA:undetectable","4nkvA-2w9mA:22.85"],["4O2B_B_LOCB503_1","TUBULIN ALPHA-1B CHAIN;TUBULIN BETA-2B CHAIN","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"SER A 400;ALA A 398;VAL A 397","None","0.52A","4o2bA-2w9mA:undetectable","4o2bA-2w9mA:21.23"],["4O2B_D_LOCD503_1","TUBULIN ALPHA-1B CHAIN;TUBULIN BETA-2B CHAIN","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"SER A 400;ALA A 398;VAL A 397","None","0.57A","4o2bC-2w9mA:undetectable","4o2bC-2w9mA:21.23"],["4P6S_A_DAHA305_1","TYROSINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 334;HIS A 332;HIS A 456;HIS A 428"," ZN A1566 (-3.5A); ZN A1566 (-3.4A); ZN A1567 (-3.6A); ZN A1567 (-3.4A)","0.92A","4p6sA-2w9mA:undetectable","4p6sA-2w9mA:19.17"],["4P6S_B_DAHB305_1","TYROSINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 334;HIS A 332;HIS A 456;HIS A 428"," ZN A1566 (-3.5A); ZN A1566 (-3.4A); ZN A1567 (-3.6A); ZN A1567 (-3.4A)","0.96A","4p6sB-2w9mA:undetectable","4p6sB-2w9mA:19.17"],["4P6S_B_DAHB305_1","TYROSINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 428;HIS A 456;HIS A 332;HIS A 334"," ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-3.4A); ZN A1566 (-3.5A)","0.72A","4p6sB-2w9mA:undetectable","4p6sB-2w9mA:19.17"],["4Q15_A_HFGA803_1","PROLINE--TRNA LIGASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"GLU A 507;THR A 539;HIS A 542","None","0.86A","4q15A-2w9mA:undetectable","4q15A-2w9mA:21.90"],["4R7L_A_SHHA709_1","LEUKOTRIENE A-4 HYDROLASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 517;HIS A 428;HIS A 456;GLU A 401;LEU A 359","None; ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1567 ( 2.4A);None","1.18A","4r7lA-2w9mA:undetectable","4r7lA-2w9mA:23.09"],["4UBP_C_HAEC800_1","PROTEIN (UREASE (CHAIN C))","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"HIS A 332;HIS A 334;HIS A 428;HIS A 456;ASP A 516"," ZN A1566 (-3.4A); ZN A1566 (-3.5A); ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-2.5A)","0.95A","4ubpC-2w9mA:5.8","4ubpC-2w9mA:22.53"],["4YDQ_B_HFGB802_1","PROLINE--TRNA LIGASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"GLU A 507;THR A 539;HIS A 542","None","0.75A","4ydqB-2w9mA:undetectable","4ydqB-2w9mA:21.75"],["4Z2E_F_TR6F101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;SYMMETRIZED E-SITE DNA","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLY A 267;ARG A 277;GLY A 278;GLU A 280","None","1.17A","4z2eB-2w9mA:undetectable;4z2eC-2w9mA:undetectable","4z2eB-2w9mA:25.36;4z2eC-2w9mA:20.89"],["5A5Z_A_WJZA304_0","BETA-LACTAMASE NDM-1","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 456;ASP A 516;HIS A 428;HIS A 334"," ZN A1567 (-3.6A); ZN A1566 (-2.5A); ZN A1567 (-3.4A); ZN A1566 (-3.5A)","0.91A","5a5zA-2w9mA:undetectable","5a5zA-2w9mA:19.45"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 183;ASP A 187;ARG A 196;GLY A 252;GLU A 253","None","1.13A","5btgA-2w9mA:undetectable;5btgC-2w9mA:undetectable;5btgD-2w9mA:undetectable","5btgA-2w9mA:24.64;5btgC-2w9mA:24.64;5btgD-2w9mA:21.35"],["5DWK_C_ACTC207_0","DIACYLGLYCEROL KINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLU A 172;ALA A 168;GLU A 126;GLU A 229","None","1.31A","5dwkC-2w9mA:undetectable","5dwkC-2w9mA:13.32"],["5DWK_C_ACTC207_0","DIACYLGLYCEROL KINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLU A 172;ALA A 168;GLU A 171;GLU A 129","None","1.43A","5dwkC-2w9mA:undetectable","5dwkC-2w9mA:13.32"],["5EB5_B_010B607_0","HNL ISOENZYME 5","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ALA A 512;VAL A 453;HIS A 332;VAL A 424;TYR A 422","None;None; ZN A1566 (-3.4A);None;None","1.48A","5eb5B-2w9mA:undetectable","5eb5B-2w9mA:22.15"],["5I3A_A_HQEA303_1","TYROSINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 428;HIS A 456;HIS A 332;HIS A 334"," ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-3.4A); ZN A1566 (-3.5A)","0.73A","5i3aA-2w9mA:undetectable","5i3aA-2w9mA:19.17"],["5I3A_B_HQEB304_1","TYROSINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 428;HIS A 456;HIS A 332;HIS A 334"," ZN A1567 (-3.4A); ZN A1567 (-3.6A); ZN A1566 (-3.4A); ZN A1566 (-3.5A)","0.72A","5i3aB-2w9mA:undetectable","5i3aB-2w9mA:19.17"],["5MFX_A_ACTA701_0","GENOME POLYPROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ARG A 189;THR A 201;ALA A 183;ASP A 247","None","1.27A","5mfxA-2w9mA:undetectable","5mfxA-2w9mA:23.51"],["5N0S_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ILE A 404;VAL A 424;VAL A 423;SER A 426;ILE A 443","None;None;None; ZN A1567 ( 4.3A);None","1.16A","5n0sB-2w9mA:undetectable","5n0sB-2w9mA:21.75"],["5NCD_A_ACTA301_0","PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ASP A 339;HIS A 518;HIS A 334;HIS A 428"," ZN A1565 (-2.1A); ZN A1565 (-3.3A); ZN A1566 (-3.5A); ZN A1567 (-3.4A)","0.76A","5ncdA-2w9mA:2.9;5ncdD-2w9mA:2.4","5ncdA-2w9mA:17.62;5ncdD-2w9mA:17.62"],["5NCD_C_ACTC301_0","PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 428;ASP A 339;HIS A 518;HIS A 334"," ZN A1567 (-3.4A); ZN A1565 (-2.1A); ZN A1565 (-3.3A); ZN A1566 (-3.5A)","0.81A","5ncdB-2w9mA:2.9;5ncdC-2w9mA:2.7","5ncdB-2w9mA:17.62;5ncdC-2w9mA:17.62"],["5NEL_A_ACTA302_0","PEPTIDOGLYCAN N-ACETYLGLUCOSAMINE DEACETYLASE","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"ASP A 339;HIS A 518;HIS A 334;HIS A 428"," ZN A1565 (-2.1A); ZN A1565 (-3.3A); ZN A1566 (-3.5A); ZN A1567 (-3.4A)","0.85A","5nelA-2w9mA:2.3;5nelD-2w9mA:3.7","5nelA-2w9mA:17.62;5nelD-2w9mA:17.62"],["5OEX_A_CUA601_0","THIOCYANATE DEHYDROGENASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"HIS A 518;ASP A 339;HIS A 364"," ZN A1565 (-3.3A); ZN A1565 (-2.1A); ZN A1565 (-3.2A)","0.45A","5oexA-2w9mA:undetectable","5oexA-2w9mA:21.72"],["5OEX_B_CUB601_0","THIOCYANATE DEHYDROGENASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"HIS A 518;ASP A 339;HIS A 364"," ZN A1565 (-3.3A); ZN A1565 (-2.1A); ZN A1565 (-3.2A)","0.41A","5oexB-2w9mA:undetectable","5oexB-2w9mA:21.72"],["5OEX_C_CUC601_0","THIOCYANATE DEHYDROGENASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"HIS A 518;ASP A 339;HIS A 364"," ZN A1565 (-3.3A); ZN A1565 (-2.1A); ZN A1565 (-3.2A)","0.37A","5oexC-2w9mA:undetectable","5oexC-2w9mA:21.72"],["5OEX_D_CUD601_0","THIOCYANATE DEHYDROGENASE","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"HIS A 518;ASP A 339;HIS A 364"," ZN A1565 (-3.3A); ZN A1565 (-2.1A); ZN A1565 (-3.2A)","0.37A","5oexD-2w9mA:undetectable","5oexD-2w9mA:21.72"],["5TZO_B_7V7B201_1","ENDO-1,4-BETA-XYLANASE A","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"LEU A 294;PHE A 291;VAL A 290;ALA A 242;GLY A 244","None","1.16A","5tzoB-2w9mA:undetectable","5tzoB-2w9mA:14.36"],["5UBB_A_SAMA301_1","ALPHA N-TERMINAL PROTEIN METHYLTRANSFERASE 1B","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"GLY A 230;ARG A 125;ASP A 227;GLN A 219","None","1.42A","5ubbA-2w9mA:undetectable","5ubbA-2w9mA:18.04"],["5X6Y_A_SAMA902_0","MRNA CAPPING ENZYME P5","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"GLY A 244;PRO A 239;ALA A 238;PHE A 291;THR A 286","None","1.30A","5x6yA-2w9mA:undetectable","5x6yA-2w9mA:21.73"],["5X6Y_C_SAMC902_0","MRNA CAPPING ENZYME P5","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"GLY A 244;PRO A 239;ALA A 238;PHE A 291;THR A 286","None","1.32A","5x6yC-2w9mA:undetectable","5x6yC-2w9mA:21.73"],["5XIW_D_LOCD503_1","TUBULIN ALPHA-1B CHAIN;TUBULIN BETA CHAIN","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"SER A 400;ALA A 398;VAL A 397","None","0.49A","5xiwC-2w9mA:undetectable","5xiwC-2w9mA:8.39"],["5Y9Y_A_ACTA412_0","UNCHARACTERIZED PROTEIN KDOO","2w9m","POLYMERASE X","Deinococcus radiodurans",3,"ARG A 189;PHE A 298;ARG A 304","None","1.08A","5y9yA-2w9mA:undetectable","5y9yA-2w9mA:21.98"],["5ZJ8_A_9DCA303_0","METALLO-BETA-LACTAMASE TYPE 2","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"HIS A 456;ASP A 516;HIS A 428;HIS A 334"," ZN A1567 (-3.6A); ZN A1566 (-2.5A); ZN A1567 (-3.4A); ZN A1566 (-3.5A)","0.94A","5zj8A-2w9mA:undetectable","5zj8A-2w9mA:18.63"],["6CCV_C_RFPC1205_1","-","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"ASP A 516;LEU A 442;ARG A 441;ARG A 494;HIS A 334"," ZN A1566 (-2.5A);None;None; ZN A1567 ( 4.8A); ZN A1566 (-3.5A)","1.15A","6ccvC-2w9mA:0.0","6ccvC-2w9mA:20.83"],["6EXI_D_ADND502_0","ADENOSYLHOMOCYSTEINASE","2w9m","POLYMERASE X","Deinococcus radiodurans",5,"THR A 361;ASP A 516;HIS A 428;GLY A 340;HIS A 518","None; ZN A1566 (-2.5A); ZN A1567 (-3.4A);None; ZN A1565 (-3.3A)","1.11A","6exiD-2w9mA:2.7","6exiD-2w9mA:9.04"],["6MVX_A_K4DA1304_0","ION TRANSPORT PROTEIN","2w9m","POLYMERASE X","Deinococcus radiodurans",4,"THR A 351;LEU A 354;THR A 333;LEU A 327","None","1.10A","6mvxA-2w9mA:undetectable;6mvxB-2w9mA:undetectable;6mvxC-2w9mA:undetectable","6mvxA-2w9mA:17.87;6mvxB-2w9mA:17.87;6mvxC-2w9mA:17.87"]]