SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3gdn'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DB1_A_VDXA428_2 (VITAMIN D NUCLEAR RECEPTOR)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	LEU A 201 ILE A 254 ARG A 483 VAL A 51	None	0.88A	1db1A-3gdnA: undetectable	1db1A-3gdnA: 18.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E73_M_ASCM995_0 (MYROSINASE MA1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	GLN A 515 ILE A 511 ARG A 507 TYR A 508	None	1.33A	1e73M-3gdnA: undetectable	1e73M-3gdnA: 23.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EIZ_A_SAMA301_0 (FTSJ)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	GLY A 261 GLY A 463 GLY A 462 LEU A 265 LEU A 266	FAD A 522 ( 4.0A) None None None None	1.01A	1eizA-3gdnA: 2.3	1eizA-3gdnA: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EJ0_A_SAMA301_0 (FTSJ)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	GLY A 261 GLY A 463 GLY A 462 LEU A 265 LEU A 266	FAD A 522 ( 4.0A) None None None None	1.01A	1ej0A-3gdnA: undetectable	1ej0A-3gdnA: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LWE_A_NVPA999_1 (HIV-1 REVERSE TRANSCRIPTASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 7	LEU A 201 VAL A 213 GLY A 212 TYR A 11	None	1.03A	1lweA-3gdnA: undetectable	1lweA-3gdnA: 19.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MX1_F_THAF6_1 (LIVER CARBOXYLESTERASE I)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	6 / 12	GLY A 35 GLY A 104 SER A 107 LEU A 201 LEU A 103 LEU A 200	FAD A 522 (-3.3A) None None None None None	1.48A	1mx1F-3gdnA: undetectable	1mx1F-3gdnA: 22.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_A_BEZA502_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	PHE A 302 ASN A 304 ILE A 434 GLY A 433	None	0.77A	1oniA-3gdnA: undetectable 1oniB-3gdnA: undetectable	1oniA-3gdnA: 16.91 1oniB-3gdnA: 16.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_D_BEZD508_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	PHE A 302 ASN A 304 ILE A 434 GLY A 433	None	0.77A	1oniD-3gdnA: undetectable 1oniF-3gdnA: undetectable	1oniD-3gdnA: 16.91 1oniF-3gdnA: 16.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_I_BEZI518_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 7	ILE A 434 GLY A 433 PHE A 302 ASN A 304	None	0.67A	1oniG-3gdnA: undetectable 1oniI-3gdnA: undetectable	1oniG-3gdnA: 16.91 1oniI-3gdnA: 16.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UOB_A_PNNA1311_0 (DEACETOXYCEPHALOSPOR IN C SYNTHETASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	SER A 488 LEU A 470 LEU A 277 VAL A 291 ILE A 479	None	1.12A	1uobA-3gdnA: undetectable	1uobA-3gdnA: 20.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YA4_A_CTXA1_1 (CES1 PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	ALA A 42 GLY A 35 GLY A 104 SER A 107 LEU A 201	None FAD A 522 (-3.3A) None None None	0.85A	1ya4A-3gdnA: undetectable	1ya4A-3gdnA: 22.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AQU_B_DR7B300_2 (HIV-1 PROTEASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	6 / 11	ARG A 380 GLY A 261 ALA A 257 ASP A 486 ILE A 31 ILE A 220	None FAD A 522 ( 4.0A) FAD A 522 (-3.6A) FAD A 522 (-4.7A) None None	1.38A	2aquB-3gdnA: undetectable	2aquB-3gdnA: 10.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BDM_A_TMIA503_1 (CYTOCHROME P450 2B4)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 8	LEU A 482 VAL A 285 VAL A 291 VAL A 255	None	0.93A	2bdmA-3gdnA: undetectable	2bdmA-3gdnA: 22.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FL5_F_RBFF204_1 (IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN IMMUNOGLOBULIN IGG1 HEAVY CHAIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 8	TYR A 63 ASN A 75 ARG A 88 TYR A 74	None	1.08A	2fl5E-3gdnA: undetectable 2fl5F-3gdnA: undetectable	2fl5E-3gdnA: 18.27 2fl5F-3gdnA: 22.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX4_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 8	ILE A 260 PHE A 387 GLY A 463 GLY A 462	None	0.80A	2qx4A-3gdnA: undetectable 2qx4B-3gdnA: 2.9	2qx4A-3gdnA: 18.67 2qx4B-3gdnA: 18.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX6_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	ILE A 260 PHE A 387 GLY A 463 GLY A 462	None	0.81A	2qx6A-3gdnA: 3.0 2qx6B-3gdnA: 2.7	2qx6A-3gdnA: 18.67 2qx6B-3gdnA: 18.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2RK8_A_PPFA3969_1 (PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP])	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 8	HIS A 214 SER A 58 ASP A 17 ALA A 62	None	1.15A	2rk8A-3gdnA: undetectable	2rk8A-3gdnA: 21.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YY8_B_SAMB500_0 (UPF0106 PROTEIN PH0461)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	LEU A 410 VAL A 426 GLY A 425 ILE A 305 GLU A 427	None	1.18A	2yy8A-3gdnA: undetectable 2yy8B-3gdnA: undetectable	2yy8A-3gdnA: 15.85 2yy8B-3gdnA: 15.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HUO_B_PNNB301_0 (CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	CYH A 39 GLY A 38 GLY A 34 GLY A 104 ARG A 56	None None None None FAD A 522 (-4.2A)	0.92A	3huoB-3gdnA: undetectable	3huoB-3gdnA: 19.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IHZ_A_FK5A501_2 (70 KDA PEPTIDYLPROLYL ISOMERASE, PUTATIVE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 8	TYR A 457 GLY A 180 SER A 322 ILE A 321	HBX A 530 (-4.3A) None None None	0.84A	3ihzB-3gdnA: undetectable	3ihzB-3gdnA: 12.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IJD_B_C2FB314_1 (UNCHARACTERIZED PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	THR A 119 LYS A 1 GLU A 178	NAG A 525 (-3.5A) None NAG A 525 (-3.7A)	0.90A	3ijdB-3gdnA: undetectable	3ijdB-3gdnA: 21.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQA_C_DX4C270_0 (PTERIDINE REDUCTASE 1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	SER A 91 ASP A 297 TYR A 389 PRO A 344	None	1.18A	3jqaC-3gdnA: 3.3	3jqaC-3gdnA: 20.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQA_D_DX4D270_0 (PTERIDINE REDUCTASE 1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	SER A 91 ASP A 297 TYR A 389 PRO A 344	None	1.21A	3jqaD-3gdnA: 3.4	3jqaD-3gdnA: 20.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_A_CELA682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.92A	3ln1A-3gdnA: undetectable	3ln1A-3gdnA: 21.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_B_CELB682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.93A	3ln1B-3gdnA: undetectable	3ln1B-3gdnA: 21.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_C_CELC682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.92A	3ln1C-3gdnA: undetectable	3ln1C-3gdnA: 21.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_D_CELD682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.92A	3ln1D-3gdnA: undetectable	3ln1D-3gdnA: 21.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3O9M_B_BEZB999_0 (CHOLINESTERASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	GLY A 105 GLY A 104 SER A 107 LEU A 200	FAD A 522 (-3.1A) None None None	0.77A	3o9mB-3gdnA: undetectable	3o9mB-3gdnA: 22.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OU6_B_SAMB300_1 (SAM-DEPENDENT METHYLTRANSFERASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	TYR A 368 ASP A 395 ASP A 324	None	0.85A	3ou6B-3gdnA: 2.4	3ou6B-3gdnA: 18.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SMT_A_ACTA500_0 (HISTONE-LYSINE N-METHYLTRANSFERASE SETD3)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	PHE A 162 SER A 322 GLN A 327	None	0.82A	3smtA-3gdnA: undetectable	3smtA-3gdnA: 20.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SOA_A_DB8A445_1 (CALCIUM/CALMODULIN-D EPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	LEU A 76 VAL A 73 PHE A 330 PHE A 355	None None HBX A 530 (-4.0A) None	1.01A	3soaA-3gdnA: undetectable	3soaA-3gdnA: 21.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W67_A_VIVA301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	LEU A 228 ILE A 220 VAL A 271 LEU A 266 VAL A 469	None	1.15A	3w67A-3gdnA: undetectable	3w67A-3gdnA: 19.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EVR_A_BEZA401_0 (PUTATIVE ABC TRANSPORTER SUBUNIT, SUBSTRATE-BINDING COMPONENT)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	LEU A 265 VAL A 255 ALA A 230 PHE A 222 SER A 269	None	1.31A	4evrA-3gdnA: 3.7	4evrA-3gdnA: 22.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K50_B_ACTB701_0 (RNA (33-MER) RNA POLYMERASE 3D-POL)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	HIS A 7 GLY A 104 ILE A 108	None	0.60A	4k50A-3gdnA: undetectable	4k50A-3gdnA: 22.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K50_J_ACTJ701_0 (RNA (33-MER) RNA POLYMERASE 3D-POL)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	HIS A 7 GLY A 104 ILE A 108	None	0.60A	4k50I-3gdnA: undetectable	4k50I-3gdnA: 22.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOT_A_CE3A205_1 (UNCHARACTERIZED PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	PHE A 342 ARG A 194 GLY A 112 ASN A 110 PHE A 330	HBX A 530 ( 4.7A) None FAD A 522 (-3.9A) FAD A 522 (-4.2A) HBX A 530 (-4.0A)	1.43A	4kotA-3gdnA: undetectable	4kotA-3gdnA: 14.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOU_A_C04A206_1 (UNCHARACTERIZED PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 10	PHE A 342 ARG A 194 GLY A 112 ASN A 110 PHE A 330	HBX A 530 ( 4.7A) None FAD A 522 (-3.9A) FAD A 522 (-4.2A) HBX A 530 (-4.0A)	1.41A	4kouA-3gdnA: undetectable	4kouA-3gdnA: 14.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOW_A_CFXA204_1 (UNCHARACTERIZED PROTEIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	PHE A 342 ARG A 194 GLY A 112 ASN A 110 PHE A 330	HBX A 530 ( 4.7A) None FAD A 522 (-3.9A) FAD A 522 (-4.2A) HBX A 530 (-4.0A)	1.41A	4kowA-3gdnA: undetectable	4kowA-3gdnA: 14.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNX_A_T44A501_1 (THYROID HORMONE RECEPTOR ALPHA)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 6	SER A 107 GLN A 499 VAL A 141 THR A 144	None FAD A 522 (-4.6A) None None	1.29A	4lnxA-3gdnA: undetectable	4lnxA-3gdnA: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWR_A_ZMRA513_2 (NEURAMINIDASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 5	LEU A 470 ASP A 473 ARG A 483 ILE A 513	None	1.20A	4mwrA-3gdnA: undetectable	4mwrA-3gdnA: 21.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWZ_A_SAMA301_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	ILE A 108 GLY A 34 GLY A 105 ILE A 31 LEU A 209	None None FAD A 522 (-3.1A) None None	1.08A	4mwzA-3gdnA: undetectable	4mwzA-3gdnA: 19.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QOI_B_ML1B303_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	GLY A 506 ILE A 254 GLY A 472 PHE A 490 PHE A 501	None None None MXN A 531 (-3.7A) MXN A 531 (-3.8A)	1.11A	4qoiA-3gdnA: undetectable 4qoiB-3gdnA: 2.5	4qoiA-3gdnA: 18.60 4qoiB-3gdnA: 18.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	HIS A 177 SER A 496 THR A 158 THR A 181 SER A 329	NAG A 523 (-4.0A) None None None None	1.38A	4qvyV-3gdnA: 0.6 4qvyb-3gdnA: undetectable	4qvyV-3gdnA: 16.92 4qvyb-3gdnA: 18.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	HIS A 177 SER A 496 THR A 158 THR A 181 SER A 329	NAG A 523 (-4.0A) None None None None	1.38A	4qvyH-3gdnA: undetectable 4qvyN-3gdnA: undetectable	4qvyH-3gdnA: 16.92 4qvyN-3gdnA: 18.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TVT_A_ASCA303_0 (THAUMATIN-1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 7	LEU A 266 SER A 269 ILE A 220 VAL A 233	None	1.03A	4tvtA-3gdnA: undetectable	4tvtA-3gdnA: 18.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UYM_A_VORA590_1 (14-ALPHA STEROL DEMETHYLASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 7	TYR A 348 SER A 332 LEU A 432 PHE A 355	None	1.03A	4uymA-3gdnA: undetectable	4uymA-3gdnA: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XO7_B_ASDB402_1 (ALDO-KETO REDUCTASE FAMILY 1 MEMBER C2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 7	TYR A 457 ILE A 406 HIS A 497 LEU A 319	HBX A 530 (-4.3A) None HBX A 530 ( 3.9A) None	1.24A	4xo7B-3gdnA: undetectable	4xo7B-3gdnA: 20.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_B_STRB603_1 (CYTOCHROME P450 21-HYDROXYLASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	VAL A 469 SER A 488 VAL A 271 LEU A 267 LEU A 295	None	1.12A	4y8wB-3gdnA: undetectable	4y8wB-3gdnA: 21.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 5	SER A 269 ARG A 56 GLY A 33 GLU A 55	None FAD A 522 (-4.2A) FAD A 522 (-3.3A) FAD A 522 (-2.8A)	1.21A	5btiA-3gdnA: undetectable 5btiB-3gdnA: undetectable	5btiA-3gdnA: 22.07 5btiB-3gdnA: 21.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 5	SER A 269 ARG A 56 GLY A 33 GLU A 55	None FAD A 522 (-4.2A) FAD A 522 (-3.3A) FAD A 522 (-2.8A)	1.21A	5btiC-3gdnA: undetectable 5btiD-3gdnA: undetectable	5btiC-3gdnA: 22.07 5btiD-3gdnA: 21.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DBY_A_NPSA602_1 (SERUM ALBUMIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	LEU A 465 PHE A 474 LEU A 505 TYR A 502 SER A 125	None None None FAD A 522 (-4.5A) MXN A 531 (-4.1A)	1.44A	5dbyA-3gdnA: 0.5	5dbyA-3gdnA: 20.31
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5EB5_A_010A609_0 (HNL ISOENZYME 5)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	6 / 11	ALA A 111 ARG A 300 HIS A 357 TYR A 457 TRP A 458 HIS A 497	FAD A 522 ( 3.0A) None HBX A 530 (-4.5A) HBX A 530 (-4.3A) FAD A 522 (-3.9A) HBX A 530 ( 3.9A)	0.35A	5eb5A-3gdnA: 64.6	5eb5A-3gdnA: 74.44
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5EB5_B_010B607_0 (HNL ISOENZYME 5)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	6 / 10	ALA A 111 ARG A 300 HIS A 357 TYR A 457 TRP A 458 HIS A 497	FAD A 522 ( 3.0A) None HBX A 530 (-4.5A) HBX A 530 (-4.3A) FAD A 522 (-3.9A) HBX A 530 ( 3.9A)	0.36A	5eb5B-3gdnA: 64.8	5eb5B-3gdnA: 74.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HNX_B_TA1B902_1 (TUBULIN BETA-2B CHAIN)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	VAL A 291 HIS A 288 LEU A 228 THR A 229 ARG A 475	None	1.30A	5hnxB-3gdnA: undetectable	5hnxB-3gdnA: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGJ_A_CTYA402_2 (MACROLIDE 2'-PHOSPHOTRANSFERAS E)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 5	PRO A 299 HIS A 497 LEU A 409 PHE A 330	None HBX A 530 ( 3.9A) None HBX A 530 (-4.0A)	1.46A	5igjA-3gdnA: undetectable	5igjA-3gdnA: 20.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKT_B_TLFB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	3 / 3	TYR A 11 TYR A 147 SER A 5	None	0.80A	5iktB-3gdnA: undetectable	5iktB-3gdnA: 22.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JW1_A_CELA602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.92A	5jw1A-3gdnA: undetectable	5jw1A-3gdnA: 20.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JW1_B_CELB602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.96A	5jw1B-3gdnA: undetectable	5jw1B-3gdnA: 20.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KIR_A_RCXA601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.93A	5kirA-3gdnA: undetectable	5kirA-3gdnA: 22.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KIR_B_RCXB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 12	TYR A 457 ALA A 495 VAL A 113 GLY A 112 ALA A 111	HBX A 530 (-4.3A) None FAD A 522 (-3.7A) FAD A 522 (-3.9A) FAD A 522 ( 3.0A)	0.93A	5kirB-3gdnA: undetectable	5kirB-3gdnA: 22.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	HIS A 177 SER A 496 THR A 158 THR A 181 SER A 329	NAG A 523 (-4.0A) None None None None	1.37A	5l5fV-3gdnA: undetectable 5l5fb-3gdnA: undetectable	5l5fV-3gdnA: 16.92 5l5fb-3gdnA: 18.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 11	HIS A 177 SER A 496 THR A 158 THR A 181 SER A 329	NAG A 523 (-4.0A) None None None None	1.37A	5l5fH-3gdnA: undetectable 5l5fN-3gdnA: undetectable	5l5fH-3gdnA: 16.92 5l5fN-3gdnA: 18.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_A_PCFA1803_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 10	TYR A 418 ILE A 305 ILE A 431 ILE A 311 ASN A 309	None	1.24A	5vkqA-3gdnA: undetectable 5vkqD-3gdnA: undetectable	5vkqA-3gdnA: 15.43 5vkqD-3gdnA: 15.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_B_PCFB1808_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 10	ILE A 311 ASN A 309 TYR A 418 ILE A 305 ILE A 431	None	1.25A	5vkqA-3gdnA: undetectable 5vkqB-3gdnA: undetectable	5vkqA-3gdnA: 15.43 5vkqB-3gdnA: 15.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_D_PCFD1801_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	5 / 10	ILE A 311 ASN A 309 TYR A 418 ILE A 305 ILE A 431	None	1.20A	5vkqC-3gdnA: undetectable 5vkqD-3gdnA: undetectable	5vkqC-3gdnA: 15.43 5vkqD-3gdnA: 15.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GTQ_A_ACTA204_0 (N-ACETYLTRANSFERASE)	3gdn	R-OXYNITRILE LYASE ISOENZYME 1 (Prunus dulcis)	4 / 5	THR A 259 CYH A 464 THR A 489 GLY A 487	None None None FAD A 522 (-3.6A)	1.18A	6gtqA-3gdnA: 1.8	6gtqA-3gdnA: 15.74

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1DB1_A_VDXA428_2","VITAMIN D NUCLEAR RECEPTOR","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A 201;ILE A 254;ARG A 483;VAL A  51","None","0.88A","1db1A-3gdnA:undetectable","1db1A-3gdnA:18.98"],["1E73_M_ASCM995_0","MYROSINASE MA1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"GLN A 515;ILE A 511;ARG A 507;TYR A 508","None","1.33A","1e73M-3gdnA:undetectable","1e73M-3gdnA:23.55"],["1EIZ_A_SAMA301_0","FTSJ","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"GLY A 261;GLY A 463;GLY A 462;LEU A 265;LEU A 266","FAD A 522 ( 4.0A);None;None;None;None","1.01A","1eizA-3gdnA:2.3","1eizA-3gdnA:16.37"],["1EJ0_A_SAMA301_0","FTSJ","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"GLY A 261;GLY A 463;GLY A 462;LEU A 265;LEU A 266","FAD A 522 ( 4.0A);None;None;None;None","1.01A","1ej0A-3gdnA:undetectable","1ej0A-3gdnA:16.37"],["1LWE_A_NVPA999_1","HIV-1 REVERSE TRANSCRIPTASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A 201;VAL A 213;GLY A 212;TYR A  11","None","1.03A","1lweA-3gdnA:undetectable","1lweA-3gdnA:19.26"],["1MX1_F_THAF6_1","LIVER CARBOXYLESTERASE I","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",6,"GLY A  35;GLY A 104;SER A 107;LEU A 201;LEU A 103;LEU A 200","FAD A 522 (-3.3A);None;None;None;None;None","1.48A","1mx1F-3gdnA:undetectable","1mx1F-3gdnA:22.24"],["1ONI_A_BEZA502_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"PHE A 302;ASN A 304;ILE A 434;GLY A 433","None","0.77A","1oniA-3gdnA:undetectable;1oniB-3gdnA:undetectable","1oniA-3gdnA:16.91;1oniB-3gdnA:16.91"],["1ONI_D_BEZD508_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"PHE A 302;ASN A 304;ILE A 434;GLY A 433","None","0.77A","1oniD-3gdnA:undetectable;1oniF-3gdnA:undetectable","1oniD-3gdnA:16.91;1oniF-3gdnA:16.91"],["1ONI_I_BEZI518_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"ILE A 434;GLY A 433;PHE A 302;ASN A 304","None","0.67A","1oniG-3gdnA:undetectable;1oniI-3gdnA:undetectable","1oniG-3gdnA:16.91;1oniI-3gdnA:16.91"],["1UOB_A_PNNA1311_0","DEACETOXYCEPHALOSPORIN C SYNTHETASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"SER A 488;LEU A 470;LEU A 277;VAL A 291;ILE A 479","None","1.12A","1uobA-3gdnA:undetectable","1uobA-3gdnA:20.84"],["1YA4_A_CTXA1_1","CES1 PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"ALA A  42;GLY A  35;GLY A 104;SER A 107;LEU A 201","None;FAD A 522 (-3.3A);None;None;None","0.85A","1ya4A-3gdnA:undetectable","1ya4A-3gdnA:22.40"],["2AQU_B_DR7B300_2","HIV-1 PROTEASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",6,"ARG A 380;GLY A 261;ALA A 257;ASP A 486;ILE A  31;ILE A 220","None;FAD A 522 ( 4.0A);FAD A 522 (-3.6A);FAD A 522 (-4.7A);None;None","1.38A","2aquB-3gdnA:undetectable","2aquB-3gdnA:10.08"],["2BDM_A_TMIA503_1","CYTOCHROME P450 2B4","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A 482;VAL A 285;VAL A 291;VAL A 255","None","0.93A","2bdmA-3gdnA:undetectable","2bdmA-3gdnA:22.43"],["2FL5_F_RBFF204_1","IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN;IMMUNOGLOBULIN IGG1 HEAVY CHAIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"TYR A  63;ASN A  75;ARG A  88;TYR A  74","None","1.08A","2fl5E-3gdnA:undetectable;2fl5F-3gdnA:undetectable","2fl5E-3gdnA:18.27;2fl5F-3gdnA:22.27"],["2QX4_A_ML1A233_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"ILE A 260;PHE A 387;GLY A 463;GLY A 462","None","0.80A","2qx4A-3gdnA:undetectable;2qx4B-3gdnA:2.9","2qx4A-3gdnA:18.67;2qx4B-3gdnA:18.67"],["2QX6_A_ML1A233_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"ILE A 260;PHE A 387;GLY A 463;GLY A 462","None","0.81A","2qx6A-3gdnA:3.0;2qx6B-3gdnA:2.7","2qx6A-3gdnA:18.67;2qx6B-3gdnA:18.67"],["2RK8_A_PPFA3969_1","PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP]","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"HIS A 214;SER A  58;ASP A  17;ALA A  62","None","1.15A","2rk8A-3gdnA:undetectable","2rk8A-3gdnA:21.67"],["2YY8_B_SAMB500_0","UPF0106 PROTEIN PH0461","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"LEU A 410;VAL A 426;GLY A 425;ILE A 305;GLU A 427","None","1.18A","2yy8A-3gdnA:undetectable;2yy8B-3gdnA:undetectable","2yy8A-3gdnA:15.85;2yy8B-3gdnA:15.85"],["3HUO_B_PNNB301_0","CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"CYH A  39;GLY A  38;GLY A  34;GLY A 104;ARG A  56","None;None;None;None;FAD A 522 (-4.2A)","0.92A","3huoB-3gdnA:undetectable","3huoB-3gdnA:19.81"],["3IHZ_A_FK5A501_2","70 KDA PEPTIDYLPROLYL ISOMERASE, PUTATIVE;70 KDA PEPTIDYLPROLYL ISOMERASE, PUTATIVE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"TYR A 457;GLY A 180;SER A 322;ILE A 321","HBX A 530 (-4.3A);None;None;None","0.84A","3ihzB-3gdnA:undetectable","3ihzB-3gdnA:12.45"],["3IJD_B_C2FB314_1","UNCHARACTERIZED PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"THR A 119;LYS A   1;GLU A 178","NAG A 525 (-3.5A);None;NAG A 525 (-3.7A)","0.90A","3ijdB-3gdnA:undetectable","3ijdB-3gdnA:21.97"],["3JQA_C_DX4C270_0","PTERIDINE REDUCTASE 1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"SER A  91;ASP A 297;TYR A 389;PRO A 344","None","1.18A","3jqaC-3gdnA:3.3","3jqaC-3gdnA:20.50"],["3JQA_D_DX4D270_0","PTERIDINE REDUCTASE 1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"SER A  91;ASP A 297;TYR A 389;PRO A 344","None","1.21A","3jqaD-3gdnA:3.4","3jqaD-3gdnA:20.50"],["3LN1_A_CELA682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.92A","3ln1A-3gdnA:undetectable","3ln1A-3gdnA:21.42"],["3LN1_B_CELB682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.93A","3ln1B-3gdnA:undetectable","3ln1B-3gdnA:21.42"],["3LN1_C_CELC682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.92A","3ln1C-3gdnA:undetectable","3ln1C-3gdnA:21.42"],["3LN1_D_CELD682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.92A","3ln1D-3gdnA:undetectable","3ln1D-3gdnA:21.42"],["3O9M_B_BEZB999_0","CHOLINESTERASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"GLY A 105;GLY A 104;SER A 107;LEU A 200","FAD A 522 (-3.1A);None;None;None","0.77A","3o9mB-3gdnA:undetectable","3o9mB-3gdnA:22.24"],["3OU6_B_SAMB300_1","SAM-DEPENDENT METHYLTRANSFERASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"TYR A 368;ASP A 395;ASP A 324","None","0.85A","3ou6B-3gdnA:2.4","3ou6B-3gdnA:18.34"],["3SMT_A_ACTA500_0","HISTONE-LYSINE N-METHYLTRANSFERASE SETD3","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"PHE A 162;SER A 322;GLN A 327","None","0.82A","3smtA-3gdnA:undetectable","3smtA-3gdnA:20.86"],["3SOA_A_DB8A445_1","CALCIUM\/CALMODULIN-DEPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A  76;VAL A  73;PHE A 330;PHE A 355","None;None;HBX A 530 (-4.0A);None","1.01A","3soaA-3gdnA:undetectable","3soaA-3gdnA:21.84"],["3W67_A_VIVA301_0","ALPHA-TOCOPHEROL TRANSFER PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"LEU A 228;ILE A 220;VAL A 271;LEU A 266;VAL A 469","None","1.15A","3w67A-3gdnA:undetectable","3w67A-3gdnA:19.20"],["4EVR_A_BEZA401_0","PUTATIVE ABC TRANSPORTER SUBUNIT, SUBSTRATE-BINDING COMPONENT","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"LEU A 265;VAL A 255;ALA A 230;PHE A 222;SER A 269","None","1.31A","4evrA-3gdnA:3.7","4evrA-3gdnA:22.33"],["4K50_B_ACTB701_0","RNA (33-MER);RNA POLYMERASE 3D-POL","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"HIS A   7;GLY A 104;ILE A 108","None","0.60A","4k50A-3gdnA:undetectable","4k50A-3gdnA:22.36"],["4K50_J_ACTJ701_0","RNA (33-MER);RNA POLYMERASE 3D-POL","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"HIS A   7;GLY A 104;ILE A 108","None","0.60A","4k50I-3gdnA:undetectable","4k50I-3gdnA:22.36"],["4KOT_A_CE3A205_1","UNCHARACTERIZED PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"PHE A 342;ARG A 194;GLY A 112;ASN A 110;PHE A 330","HBX A 530 ( 4.7A);None;FAD A 522 (-3.9A);FAD A 522 (-4.2A);HBX A 530 (-4.0A)","1.43A","4kotA-3gdnA:undetectable","4kotA-3gdnA:14.75"],["4KOU_A_C04A206_1","UNCHARACTERIZED PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"PHE A 342;ARG A 194;GLY A 112;ASN A 110;PHE A 330","HBX A 530 ( 4.7A);None;FAD A 522 (-3.9A);FAD A 522 (-4.2A);HBX A 530 (-4.0A)","1.41A","4kouA-3gdnA:undetectable","4kouA-3gdnA:14.75"],["4KOW_A_CFXA204_1","UNCHARACTERIZED PROTEIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"PHE A 342;ARG A 194;GLY A 112;ASN A 110;PHE A 330","HBX A 530 ( 4.7A);None;FAD A 522 (-3.9A);FAD A 522 (-4.2A);HBX A 530 (-4.0A)","1.41A","4kowA-3gdnA:undetectable","4kowA-3gdnA:14.75"],["4LNX_A_T44A501_1","THYROID HORMONE RECEPTOR ALPHA","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"SER A 107;GLN A 499;VAL A 141;THR A 144","None;FAD A 522 (-4.6A);None;None","1.29A","4lnxA-3gdnA:undetectable","4lnxA-3gdnA:18.08"],["4MWR_A_ZMRA513_2","NEURAMINIDASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A 470;ASP A 473;ARG A 483;ILE A 513","None","1.20A","4mwrA-3gdnA:undetectable","4mwrA-3gdnA:21.77"],["4MWZ_A_SAMA301_0","PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"ILE A 108;GLY A  34;GLY A 105;ILE A  31;LEU A 209","None;None;FAD A 522 (-3.1A);None;None","1.08A","4mwzA-3gdnA:undetectable","4mwzA-3gdnA:19.15"],["4QOI_B_ML1B303_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"GLY A 506;ILE A 254;GLY A 472;PHE A 490;PHE A 501","None;None;None;MXN A 531 (-3.7A);MXN A 531 (-3.8A)","1.11A","4qoiA-3gdnA:undetectable;4qoiB-3gdnA:2.5","4qoiA-3gdnA:18.60;4qoiB-3gdnA:18.60"],["4QVY_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"HIS A 177;SER A 496;THR A 158;THR A 181;SER A 329","NAG A 523 (-4.0A);None;None;None;None","1.38A","4qvyV-3gdnA:0.6;4qvyb-3gdnA:undetectable","4qvyV-3gdnA:16.92;4qvyb-3gdnA:18.31"],["4QVY_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"HIS A 177;SER A 496;THR A 158;THR A 181;SER A 329","NAG A 523 (-4.0A);None;None;None;None","1.38A","4qvyH-3gdnA:undetectable;4qvyN-3gdnA:undetectable","4qvyH-3gdnA:16.92;4qvyN-3gdnA:18.31"],["4TVT_A_ASCA303_0","THAUMATIN-1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"LEU A 266;SER A 269;ILE A 220;VAL A 233","None","1.03A","4tvtA-3gdnA:undetectable","4tvtA-3gdnA:18.35"],["4UYM_A_VORA590_1","14-ALPHA STEROL DEMETHYLASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"TYR A 348;SER A 332;LEU A 432;PHE A 355","None","1.03A","4uymA-3gdnA:undetectable","4uymA-3gdnA:20.99"],["4XO7_B_ASDB402_1","ALDO-KETO REDUCTASE FAMILY 1 MEMBER C2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"TYR A 457;ILE A 406;HIS A 497;LEU A 319","HBX A 530 (-4.3A);None;HBX A 530 ( 3.9A);None","1.24A","4xo7B-3gdnA:undetectable","4xo7B-3gdnA:20.34"],["4Y8W_B_STRB603_1","CYTOCHROME P450 21-HYDROXYLASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"VAL A 469;SER A 488;VAL A 271;LEU A 267;LEU A 295","None","1.12A","4y8wB-3gdnA:undetectable","4y8wB-3gdnA:21.26"],["5BTI_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"SER A 269;ARG A  56;GLY A  33;GLU A  55","None;FAD A 522 (-4.2A);FAD A 522 (-3.3A);FAD A 522 (-2.8A)","1.21A","5btiA-3gdnA:undetectable;5btiB-3gdnA:undetectable","5btiA-3gdnA:22.07;5btiB-3gdnA:21.18"],["5BTI_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"SER A 269;ARG A  56;GLY A  33;GLU A  55","None;FAD A 522 (-4.2A);FAD A 522 (-3.3A);FAD A 522 (-2.8A)","1.21A","5btiC-3gdnA:undetectable;5btiD-3gdnA:undetectable","5btiC-3gdnA:22.07;5btiD-3gdnA:21.18"],["5DBY_A_NPSA602_1","SERUM ALBUMIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"LEU A 465;PHE A 474;LEU A 505;TYR A 502;SER A 125","None;None;None;FAD A 522 (-4.5A);MXN A 531 (-4.1A)","1.44A","5dbyA-3gdnA:0.5","5dbyA-3gdnA:20.31"],["5EB5_A_010A609_0","HNL ISOENZYME 5","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",6,"ALA A 111;ARG A 300;HIS A 357;TYR A 457;TRP A 458;HIS A 497","FAD A 522 ( 3.0A);None;HBX A 530 (-4.5A);HBX A 530 (-4.3A);FAD A 522 (-3.9A);HBX A 530 ( 3.9A)","0.35A","5eb5A-3gdnA:64.6","5eb5A-3gdnA:74.44"],["5EB5_B_010B607_0","HNL ISOENZYME 5","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",6,"ALA A 111;ARG A 300;HIS A 357;TYR A 457;TRP A 458;HIS A 497","FAD A 522 ( 3.0A);None;HBX A 530 (-4.5A);HBX A 530 (-4.3A);FAD A 522 (-3.9A);HBX A 530 ( 3.9A)","0.36A","5eb5B-3gdnA:64.8","5eb5B-3gdnA:74.44"],["5HNX_B_TA1B902_1","TUBULIN BETA-2B CHAIN","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"VAL A 291;HIS A 288;LEU A 228;THR A 229;ARG A 475","None","1.30A","5hnxB-3gdnA:undetectable","5hnxB-3gdnA:21.59"],["5IGJ_A_CTYA402_2","MACROLIDE 2'-PHOSPHOTRANSFERASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"PRO A 299;HIS A 497;LEU A 409;PHE A 330","None;HBX A 530 ( 3.9A);None;HBX A 530 (-4.0A)","1.46A","5igjA-3gdnA:undetectable","5igjA-3gdnA:20.93"],["5IKT_B_TLFB601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",3,"TYR A  11;TYR A 147;SER A   5","None","0.80A","5iktB-3gdnA:undetectable","5iktB-3gdnA:22.85"],["5JW1_A_CELA602_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.92A","5jw1A-3gdnA:undetectable","5jw1A-3gdnA:20.94"],["5JW1_B_CELB602_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.96A","5jw1B-3gdnA:undetectable","5jw1B-3gdnA:20.94"],["5KIR_A_RCXA601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.93A","5kirA-3gdnA:undetectable","5kirA-3gdnA:22.41"],["5KIR_B_RCXB601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 457;ALA A 495;VAL A 113;GLY A 112;ALA A 111","HBX A 530 (-4.3A);None;FAD A 522 (-3.7A);FAD A 522 (-3.9A);FAD A 522 ( 3.0A)","0.93A","5kirB-3gdnA:undetectable","5kirB-3gdnA:22.41"],["5L5F_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"HIS A 177;SER A 496;THR A 158;THR A 181;SER A 329","NAG A 523 (-4.0A);None;None;None;None","1.37A","5l5fV-3gdnA:undetectable;5l5fb-3gdnA:undetectable","5l5fV-3gdnA:16.92;5l5fb-3gdnA:18.31"],["5L5F_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"HIS A 177;SER A 496;THR A 158;THR A 181;SER A 329","NAG A 523 (-4.0A);None;None;None;None","1.37A","5l5fH-3gdnA:undetectable;5l5fN-3gdnA:undetectable","5l5fH-3gdnA:16.92;5l5fN-3gdnA:18.31"],["5VKQ_A_PCFA1803_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"TYR A 418;ILE A 305;ILE A 431;ILE A 311;ASN A 309","None","1.24A","5vkqA-3gdnA:undetectable;5vkqD-3gdnA:undetectable","5vkqA-3gdnA:15.43;5vkqD-3gdnA:15.43"],["5VKQ_B_PCFB1808_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"ILE A 311;ASN A 309;TYR A 418;ILE A 305;ILE A 431","None","1.25A","5vkqA-3gdnA:undetectable;5vkqB-3gdnA:undetectable","5vkqA-3gdnA:15.43;5vkqB-3gdnA:15.43"],["5VKQ_D_PCFD1801_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",5,"ILE A 311;ASN A 309;TYR A 418;ILE A 305;ILE A 431","None","1.20A","5vkqC-3gdnA:undetectable;5vkqD-3gdnA:undetectable","5vkqC-3gdnA:15.43;5vkqD-3gdnA:15.43"],["6GTQ_A_ACTA204_0","N-ACETYLTRANSFERASE","3gdn","R-OXYNITRILE LYASE ISOENZYME 1","Prunus dulcis",4,"THR A 259;CYH A 464;THR A 489;GLY A 487","None;None;None;FAD A 522 (-3.6A)","1.18A","6gtqA-3gdnA:1.8","6gtqA-3gdnA:15.74"]]