SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3i9v'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CQP_B_803B311_1 (ANTIGEN CD11A (P180))	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	VAL 3 511 VAL 3 532 LEU 3 481 LEU 3 477	None	0.76A	1cqpA-3i9v3: 3.6 1cqpB-3i9v3: 3.3	1cqpA-3i9v3: 13.17 1cqpB-3i9v3: 13.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CRB_A_RTLA200_0 (CELLULAR RETINOL BINDING PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	LEU 4 133 ALA 4 149 ILE 4 290 ARG 4 200 ILE 4 201	None	1.14A	1crbA-3i9v4: undetectable	1crbA-3i9v4: 17.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E3V_A_DXCA801_0 (STEROID DELTA-ISOMERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	5 / 12	TYR 1 133 PHE 2  66 TYR 2  67 LEU 1 402 ALA 1 187	None None None SF4  1 439 ( 3.3A) None	1.45A	1e3vA-3i9v1: undetectable	1e3vA-3i9v1: 16.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E3V_B_DXCB801_0 (STEROID DELTA-ISOMERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	5 / 11	TYR 1 133 PHE 2  66 TYR 2  67 LEU 1 402 ALA 1 187	None None None SF4  1 439 ( 3.3A) None	1.41A	1e3vB-3i9v1: 0.0	1e3vB-3i9v1: 16.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7B_A_HLTA4001_1 (SERUM ALBUMIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 5	ARG 4 249 ALA 4 349 ASP 4 247 GLY 4 237	None	1.05A	1e7bA-3i9v4: undetectable	1e7bA-3i9v4: 22.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7C_A_HLTA4001_1 (SERUM ALBUMIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 5	ARG 4 249 ALA 4 349 ASP 4 247 GLY 4 237	None	0.97A	1e7cA-3i9v4: 1.9	1e7cA-3i9v4: 22.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_A_ACTA3003_0 (BETA-CARBONIC ANHYDRASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2 141 CYH 2  83 VAL 2 133 GLY 2 126	None FES  2 182 (-2.2A) None FES  2 182 (-4.3A)	0.80A	1ekjA-3i9v2: undetectable 1ekjB-3i9v2: undetectable	1ekjA-3i9v2: 21.59 1ekjB-3i9v2: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_C_ACTC3004_0 (BETA-CARBONIC ANHYDRASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	TYR 2 141 CYH 2  83 VAL 2 133 GLY 2 126	None FES  2 182 (-2.2A) None FES  2 182 (-4.3A)	0.85A	1ekjC-3i9v2: undetectable 1ekjD-3i9v2: undetectable	1ekjC-3i9v2: 21.59 1ekjD-3i9v2: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_C_ACTC3007_0 (BETA-CARBONIC ANHYDRASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	CYH 2  83 VAL 2 133 GLY 2 126 TYR 2 141	FES  2 182 (-2.2A) None FES  2 182 (-4.3A) None	0.84A	1ekjC-3i9v2: undetectable 1ekjD-3i9v2: undetectable	1ekjC-3i9v2: 21.59 1ekjD-3i9v2: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_C_ACTC3007_0 (BETA-CARBONIC ANHYDRASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	CYH 2  88 VAL 2 133 GLY 2 126 TYR 2 141	FES  2 182 (-2.3A) None FES  2 182 (-4.3A) None	1.29A	1ekjC-3i9v2: undetectable 1ekjD-3i9v2: undetectable	1ekjC-3i9v2: 21.59 1ekjD-3i9v2: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EKJ_F_ACTF3008_0 (BETA-CARBONIC ANHYDRASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2 141 CYH 2  83 VAL 2 133 GLY 2 126	None FES  2 182 (-2.2A) None FES  2 182 (-4.3A)	0.87A	1ekjE-3i9v2: undetectable 1ekjF-3i9v2: undetectable	1ekjE-3i9v2: 21.59 1ekjF-3i9v2: 21.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1G5Y_B_9CRB501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	ALA 3 357 LEU 3 641 LEU 3 664 ALA 3 663 LEU 3 351	None	1.23A	1g5yB-3i9v3: undetectable	1g5yB-3i9v3: 15.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_C_EAAC223_1 (GLUTATHIONE TRANSFERASE A1-1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	PHE 3 202 GLY 3 212 ARG 7  88 VAL 3 164	SF4  3 785 ( 4.8A) None None None	0.99A	1gsfC-3i9v3: undetectable	1gsfC-3i9v3: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JGS_A_SALA256_1 (MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN MARR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 7	VAL 4 187 LEU 4 294 LEU 4 123 VAL 4 163	None	0.95A	1jgsA-3i9v4: undetectable	1jgsA-3i9v4: 16.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1K6C_B_MK1B902_1 (POL POLYPROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 10	ALA 1 423 VAL 1 338 ILE 1 374 GLY 1 379 GLY 1 377	None	1.05A	1k6cA-3i9v1: undetectable	1k6cA-3i9v1: 14.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJL_B_SAMB400_0 (METHIONINE REPRESSOR PROTEIN METJ)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	5 / 9	ARG 9 167 GLU 9 105 HIS 9  41 LEU 9 115 PHE 9 173	None None SF4  9 183 (-4.5A) None None	1.48A	1mjlA-3i9v9: undetectable 1mjlB-3i9v9: undetectable	1mjlA-3i9v9: 20.32 1mjlB-3i9v9: 20.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MX8_A_RTLA135_0 (CELLULAR RETINOL-BINDING PROTEIN I, HOLO)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 12	TYR 4 246 LEU 4 239 ALA 4 229 LEU 4 232 PHE 5  89	None	1.30A	1mx8A-3i9v4: undetectable	1mx8A-3i9v4: 17.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MXD_A_ACRA732_1 (ALPHA AMYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 9	GLY 1 194 PRO 2  19 GLU 2  21 GLY 2  22 GLY 1 213	None	1.05A	1mxdA-3i9v1: undetectable	1mxdA-3i9v1: 19.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_A_AICA5001_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2  69 GLU 1 137 GLN 2  35 TYR 1 133	None	1.11A	1nx9A-3i9v2: undetectable	1nx9A-3i9v2: 14.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_A_AICA5001_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	ARG 3 469 TYR 3 759 GLU 3 472 SER 3 487	None	1.22A	1nx9A-3i9v3: undetectable	1nx9A-3i9v3: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_B_AICB5002_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2  69 GLU 1 137 GLN 2  35 TYR 1 133	None	1.11A	1nx9B-3i9v2: undetectable	1nx9B-3i9v2: 14.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_B_AICB5002_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	ARG 3 469 TYR 3 759 GLU 3 472 SER 3 487	None	1.24A	1nx9B-3i9v3: undetectable	1nx9B-3i9v3: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_C_AICC5003_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2  69 GLU 1 137 GLN 2  35 TYR 1 133	None	1.10A	1nx9C-3i9v2: undetectable	1nx9C-3i9v2: 14.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_C_AICC5003_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	ARG 3 469 TYR 3 759 GLU 3 472 SER 3 487	None	1.22A	1nx9C-3i9v3: undetectable	1nx9C-3i9v3: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_D_AICD5004_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	TYR 2  69 GLU 1 137 GLN 2  35 TYR 1 133	None	1.12A	1nx9D-3i9v2: undetectable	1nx9D-3i9v2: 14.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NX9_D_AICD5004_1 (ALPHA-AMINO ACID ESTER HYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	ARG 3 469 TYR 3 759 GLU 3 472 SER 3 487	None	1.21A	1nx9D-3i9v3: undetectable	1nx9D-3i9v3: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OLT_A_SAMA501_0 (OXYGEN-INDEPENDENT COPROPORPHYRINOGEN III OXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	5 / 12	CYH 9  98 ASP 9 118 GLY 9 116 ILE 9 113 ALA 9  60	SF4  9 183 (-2.2A) None None SF4  9 184 (-4.0A) None	1.19A	1oltA-3i9v9: undetectable	1oltA-3i9v9: 18.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_C_FUAC701_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 4	ALA 1 349 VAL 1 363 ALA 1 364 HIS 3 208	None	1.16A	1q23A-3i9v1: undetectable	1q23A-3i9v1: 18.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_E_FUAE706_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 4	ALA 1 349 VAL 1 363 ALA 1 364 HIS 3 208	None	1.22A	1q23F-3i9v1: undetectable	1q23F-3i9v1: 18.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_J_FUAJ711_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 4	ALA 1 349 VAL 1 363 ALA 1 364 HIS 3 208	None	1.18A	1q23K-3i9v1: undetectable	1q23K-3i9v1: 18.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QW6_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	ARG 3 455 VAL 3 748 TRP 3 717	None	1.00A	1qw6A-3i9v3: undetectable	1qw6A-3i9v3: 20.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1R30_A_SAMA501_0 (BIOTIN SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	GLY 3 294 ASN 3 225 ILE 3 226 LEU 3 200 VAL 3 199	SF4  3 786 (-3.4A) None None None None	1.08A	1r30A-3i9v3: undetectable	1r30A-3i9v3: 19.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1R30_B_SAMB501_0 (BIOTIN SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	GLY 3 294 ASN 3 225 ILE 3 226 LEU 3 200 VAL 3 199	SF4  3 786 (-3.4A) None None None None	1.08A	1r30B-3i9v3: undetectable	1r30B-3i9v3: 19.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RMT_C_ADNC1503_1 (CLASS B ACID PHOSPHATASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	LEU 3 602 TRP 3 322 GLY 3 636 TYR 3 567	None	0.87A	1rmtC-3i9v3: 2.6	1rmtC-3i9v3: 12.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS7_A_ACTA860_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1 234 ILE 1 230 TRP 1 237 SER 1  60	None	1.26A	1rs7A-3i9v1: undetectable	1rs7A-3i9v1: 23.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VAG_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	ARG 3 455 VAL 3 748 TRP 3 717	None	1.01A	1vagA-3i9v3: undetectable	1vagA-3i9v3: 20.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WSV_A_THHA3001_1 (AMINOMETHYLTRANSFERA SE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	ASP 4  86 GLU 4 282 TYR 4 257	None	0.83A	1wsvA-3i9v4: undetectable	1wsvA-3i9v4: 24.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XVA_A_ACTA294_0 (GLYCINE N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	ILE 3 506 LEU 3 617 ALA 3 406 GLU 3 405	None	1.09A	1xvaA-3i9v3: 3.2 1xvaB-3i9v3: 2.9	1xvaA-3i9v3: 16.82 1xvaB-3i9v3: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZVI_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	ARG 3 455 VAL 3 748 TRP 3 717	None	1.01A	1zviA-3i9v3: undetectable	1zviA-3i9v3: 20.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZ1_B_SHHB2552_1 (HISTONE DEACETYLASE-LIKE AMIDOHYDROLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	5 / 12	LEU 5 136 ILE 4  59 ASP 5 131 PHE 5 113 PHE 4 375	None	1.14A	1zz1B-3i9v5: undetectable 1zz1C-3i9v5: undetectable	1zz1B-3i9v5: 19.95 1zz1C-3i9v5: 19.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZQ_A_ACTA860_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 4	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.00A	1zzqA-3i9v1: 0.0	1zzqA-3i9v1: 22.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZQ_B_ACTB861_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.01A	1zzqB-3i9v1: undetectable	1zzqB-3i9v1: 22.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_A_ACTA860_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	0.99A	1zzuA-3i9v1: undetectable	1zzuA-3i9v1: 22.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A68_C_RBTC8001_1 (DNA-DIRECTED RNA POLYMERASE BETA CHAIN RNA POLYMERASE SIGMA FACTOR RPOD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	5 / 11	GLN 4 166 HIS 9  38 PRO 9  64 ILE 9  99 ASP 4  94	None None None SF4  9 183 (-4.3A) None	1.28A	2a68C-3i9v4: 0.4 2a68F-3i9v4: 1.5	2a68C-3i9v4: 18.34 2a68F-3i9v4: 22.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AB2_A_SNLA502_2 (MINERALOCORTICOID RECEPTOR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	LEU 3 355 LEU 3 351 LEU 3 544 LEU 3 369	None	1.03A	2ab2A-3i9v3: undetectable	2ab2A-3i9v3: 15.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOW_A_THAA400_1 (HISTAMINE N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	4 / 7	PHE 9 119 GLU 9 120 GLN 9 146 TYR 9 131	None	1.28A	2aowA-3i9v9: undetectable	2aowA-3i9v9: 20.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXG_A_IBPA2002_1 (SERUM ALBUMIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 8	ALA 1 425 GLU 1 427 SER 1 336 VAL 1 338	None	0.89A	2bxgA-3i9v1: undetectable	2bxgA-3i9v1: 22.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJG_A_ADNA1501_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	ARG 3 679 GLU 3 682 PRO 3 378 ALA 3 377	None	1.35A	2ejgA-3i9v3: undetectable	2ejgA-3i9v3: 14.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F7A_A_BEZA1003_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 9	LEU 4 105 LEU 4 104 ILE 4 357 ILE 4 175 TYR 4  97	None	1.29A	2f7aA-3i9v4: undetectable	2f7aA-3i9v4: 20.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HMA_A_SAMA375_0 (PROBABLE TRNA (5-METHYLAMINOMETHYL -2-THIOURIDYLATE)-ME THYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 11	GLY 1 294 SER 1 296 ASP 1  94 THR 1 325 GLY 1  67	None None FMN  1 440 (-4.4A) None None	1.22A	2hmaA-3i9v1: undetectable	2hmaA-3i9v1: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IGT_C_SAMC1003_0 (SAM DEPENDENT METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	PHE 3 740 ALA 3 762 SER 3 761 ALA 3 714 ALA 3 766	None	1.18A	2igtC-3i9v3: 2.4	2igtC-3i9v3: 19.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IVU_A_ZD6A3015_1 (PROTO-ONCOGENE TYROSINE-PROTEIN KINASE RECEPTOR RET PRECURSOR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	ALA 1 406 GLY 1 362 SER 1 398	None None SF4  1 439 ( 4.5A)	0.58A	2ivuA-3i9v1: undetectable	2ivuA-3i9v1: 23.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J2P_A_SC2A1290_1 (FICOLIN-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 5	ASP 5  19 LEU 5  22 GLY 5  23 ARG 5 193	None	1.23A	2j2pA-3i9v5: undetectable 2j2pB-3i9v5: undetectable	2j2pA-3i9v5: 20.92 2j2pB-3i9v5: 20.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J2P_E_SC2E1289_1 (FICOLIN-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	ASP 3 237 ARG 3 295 ASP 3 292 ASP 3 228	None	1.18A	2j2pE-3i9v3: undetectable 2j2pF-3i9v3: undetectable	2j2pE-3i9v3: 13.97 2j2pF-3i9v3: 13.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J2P_E_SC2E1291_1 (FICOLIN-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 4	ASP 5  19 LEU 5  22 GLY 5  23 ARG 5 193	None	1.27A	2j2pD-3i9v5: undetectable 2j2pE-3i9v5: undetectable	2j2pD-3i9v5: 20.92 2j2pE-3i9v5: 20.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J9C_A_ACTA1121_0 (HYPOTHETICAL NITROGEN REGULATORY PII-LIKE PROTEIN MJ0059)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	VAL 3  50 SER 3  18 VAL 3  87 SER 3  82	None	1.18A	2j9cA-3i9v3: undetectable 2j9cB-3i9v3: undetectable 2j9cC-3i9v3: undetectable	2j9cA-3i9v3: 11.23 2j9cB-3i9v3: 11.23 2j9cC-3i9v3: 11.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V2G_A_BEZA1222_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	THR 3 430 PRO 3 431 GLU 3 287 PRO 3 423	None	0.89A	2v2gA-3i9v3: undetectable 2v2gB-3i9v3: undetectable	2v2gA-3i9v3: 16.09 2v2gB-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V2G_B_BEZB1220_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	PRO 3 423 THR 3 430 PRO 3 431 GLU 3 287	None	0.87A	2v2gA-3i9v3: undetectable 2v2gB-3i9v3: undetectable	2v2gA-3i9v3: 16.09 2v2gB-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V2G_C_BEZC1222_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	THR 3 430 PRO 3 431 GLU 3 287 PRO 3 423	None	0.88A	2v2gC-3i9v3: undetectable 2v2gD-3i9v3: undetectable	2v2gC-3i9v3: 16.09 2v2gD-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V2G_D_BEZD1221_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	PRO 3 423 THR 3 430 PRO 3 431 GLU 3 287	None	0.90A	2v2gC-3i9v3: undetectable 2v2gD-3i9v3: undetectable	2v2gC-3i9v3: 16.09 2v2gD-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V32_A_BEZA1222_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	THR 3 430 PRO 3 431 GLU 3 287 PRO 3 423	None	0.84A	2v32A-3i9v3: undetectable 2v32B-3i9v3: undetectable	2v32A-3i9v3: 16.09 2v32B-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V32_B_BEZB1220_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	PRO 3 423 THR 3 430 PRO 3 431 GLU 3 287	None	0.84A	2v32A-3i9v3: undetectable 2v32B-3i9v3: undetectable	2v32A-3i9v3: 16.09 2v32B-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V32_D_BEZD1221_0 (PEROXIREDOXIN 6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	PRO 3 423 THR 3 430 PRO 3 431 GLU 3 287	None	0.82A	2v32C-3i9v3: undetectable 2v32D-3i9v3: undetectable	2v32C-3i9v3: 16.09 2v32D-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V41_E_BEZE1222_0 (PEROXIREDOXIN 6.)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	THR 3 430 PRO 3 431 GLU 3 287 PRO 3 423	None	0.89A	2v41E-3i9v3: undetectable 2v41F-3i9v3: undetectable	2v41E-3i9v3: 16.09 2v41F-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V41_F_BEZF1222_0 (PEROXIREDOXIN 6.)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	PRO 3 423 THR 3 430 PRO 3 431 GLU 3 287	None	0.97A	2v41E-3i9v3: undetectable 2v41F-3i9v3: undetectable	2v41E-3i9v3: 16.09 2v41F-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V41_G_BEZG1222_0 (PEROXIREDOXIN 6.)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	THR 3 430 PRO 3 431 GLU 3 287 PRO 3 423	None	0.83A	2v41G-3i9v3: undetectable 2v41H-3i9v3: undetectable	2v41G-3i9v3: 16.09 2v41H-3i9v3: 16.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VJ1_A_BEZA1303_0 (SARS CORONAVIRUS MAIN PROTEINASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	3 / 3	HIS 9  41 MET 9 136 MET 9  95	SF4  9 183 (-4.5A) None None	1.31A	2vj1A-3i9v9: undetectable	2vj1A-3i9v9: 17.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WEK_A_DIFA1376_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	LEU 3 355 LEU 3 664 ALA 3 660 HIS 3 613	None	1.08A	2wekA-3i9v3: 3.7	2wekA-3i9v3: 18.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XPV_A_MIYA1209_1 (TETRACYCLINE REPRESSOR PROTEIN CLASS D)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	HIS 4  89 ASN 4 121 HIS 4 129 THR 4 346 SER 4 286	None	1.26A	2xpvA-3i9v4: 1.2	2xpvA-3i9v4: 20.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XPW_A_OTCA222_1 (TETRACYCLINE REPRESSOR PROTEIN CLASS D)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	HIS 4  89 SER 4 124 ASN 4 121 HIS 4  93 ILE 4 173	None	1.48A	2xpwA-3i9v4: 1.2	2xpwA-3i9v4: 20.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZW9_A_SAMA801_1 (LEUCINE CARBOXYL METHYLTRANSFERASE 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	4 / 8	LYS 4 369 LEU 5  49 ASP 5 106 GLU 5 117	None	1.10A	2zw9A-3i9v4: undetectable	2zw9A-3i9v4: 21.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ADS_A_IMNA1_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 10	ARG 3 178 ILE 3 211 ARG 3 186 LEU 3  39 ILE 3 226	None SF4  3 785 ( 4.5A) None None None	1.46A	3adsA-3i9v3: undetectable	3adsA-3i9v3: 17.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AI8_B_HNQB255_1 (CATHEPSIN B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	GLN 3 703 GLY 3 297 HIS 3 702 HIS 3 589	None	1.26A	3ai8B-3i9v3: undetectable	3ai8B-3i9v3: 14.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AIA_A_SAMA206_0 (UPF0217 PROTEIN MJ1640)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	LEU 3 176 GLY 3 233 LEU 3 170 SER 3 171	None SF4  3 784 (-4.2A) None None	0.65A	3aiaA-3i9v3: undetectable	3aiaA-3i9v3: 12.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AV6_A_SAMA1_0 (DNA (CYTOSINE-5)-METHYLT RANSFERASE 1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	6 / 12	PHE 3 451 GLY 3 400 GLY 3 508 LEU 3 507 ALA 3 509 VAL 3 511	None	1.25A	3av6A-3i9v3: 2.3	3av6A-3i9v3: 20.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AXZ_A_ADNA401_1 (TRNA (GUANINE-N(1)-)-METH YLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	GLY 1 324 GLY 1  67 ILE 1 329 GLY 1 326 GLY 1 293	None	1.09A	3axzA-3i9v1: undetectable	3axzA-3i9v1: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_C_DHIC8_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	3 / 3	SER 4 359 GLY 4 362 GLY 5 191	None	0.55A	3bogA-3i9v4: undetectable 3bogC-3i9v4: undetectable	3bogA-3i9v4: undetectable 3bogC-3i9v4: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_D_DHID8_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	4 / 4	SER 4 359 GLY 4 340 GLY 4 362 GLY 5 191	None	0.72A	3bogB-3i9v4: undetectable 3bogD-3i9v4: undetectable	3bogB-3i9v4: undetectable 3bogD-3i9v4: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKP_C_478C200_1 (PROTEASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	6 / 10	LEU 3 617 ASP 3 348 GLY 3 294 ILE 3 290 PRO 3 407 ALA 3 406	None None SF4  3 786 (-3.4A) SF4  3 786 ( 4.1A) SF4  3 786 (-3.7A) None	1.44A	3ekpC-3i9v3: undetectable	3ekpC-3i9v3: 8.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FGR_A_ACTA22_0 (PUTATIVE PHOSPHOLIPASE B-LIKE 2 28 KDA FORM)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	4 / 4	TRP 1 212 ARG 2  24 GLU 1 193 LEU 1 195	None	1.09A	3fgrA-3i9v1: 0.0	3fgrA-3i9v1: 18.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHX_B_PXLB313_1 (PYRIDOXAL KINASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	VAL 3   6 VAL 3  30 PHE 3  24 VAL 3   4	None	1.01A	3fhxB-3i9v3: 3.2	3fhxB-3i9v3: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G8I_A_RO7A1_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR ALPHA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 7	LEU 2 154 LEU 2 125 VAL 2 142 LEU 2  96	None FES  2 182 (-4.8A) None None	0.88A	3g8iA-3i9v2: undetectable	3g8iA-3i9v2: 20.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HCN_A_CHDA3_0 (FERROCHELATASE, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	LEU 3 397 PRO 3 402 GLY 3 508 MET 3 535	None	1.12A	3hcnA-3i9v3: undetectable	3hcnA-3i9v3: 19.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3I45_A_NIOA500_1 (TWIN-ARGININE TRANSLOCATION PATHWAY SIGNAL PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	4 / 8	TYR 9 161 TYR 9 117 PHE 9 173 LEU 9 170	None	0.93A	3i45A-3i9v9: undetectable	3i45A-3i9v9: 20.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3I9J_B_NCAB302_0 (ADP-RIBOSYL CYCLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 6	LEU 1  17 GLU 1 265 SER 1 226 PHE 1 238	None	1.11A	3i9jB-3i9v1: undetectable	3i9jB-3i9v1: 21.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IA4_C_MTXC164_2 (DIHYDROFOLATE REDUCTASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	4 / 4	ILE 7  41 ARG 3 241 ILE 9  54 THR 7  53	None None SF4  9 184 (-4.5A) None	1.28A	3ia4C-3i9v7: undetectable	3ia4C-3i9v7: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQZ_A_LQZA586_1 (SERUM ALBUMIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	ARG 1 433 ASP 2  98 ARG 1 346 LYS 2 121	None	1.19A	3jqzA-3i9v1: 3.3	3jqzA-3i9v1: 22.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KU9_B_SPMB700_1 (POLYAMINE OXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 7	GLU 5  73 GLU 4 352 TYR 4 252 TYR 4 343	None	0.81A	3ku9B-3i9v5: undetectable	3ku9B-3i9v5: 20.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KU9_B_SPMB700_1 (POLYAMINE OXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 7	GLU 5 117 TYR 4 355 GLU 4  67 PHE 5 122	None	1.32A	3ku9B-3i9v5: undetectable	3ku9B-3i9v5: 20.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSF_B_PZIB802_0 (GLUTAMATE RECEPTOR 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	SER 4 128 ASP 4 401 ASN 4 377	None	0.94A	3lsfB-3i9v4: undetectable 3lsfE-3i9v4: undetectable	3lsfB-3i9v4: 20.62 3lsfE-3i9v4: 20.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSF_E_PZIE802_0 (GLUTAMATE RECEPTOR 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	ASP 4 401 ASN 4 377 SER 4 128	None	0.94A	3lsfB-3i9v4: undetectable 3lsfE-3i9v4: undetectable	3lsfB-3i9v4: 20.62 3lsfE-3i9v4: 20.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N62_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	GLY 1 396 TRP 1 408 VAL 1 407	None	0.64A	3n62B-3i9v1: undetectable	3n62B-3i9v1: 22.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N65_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	GLY 1 396 TRP 1 408 VAL 1 407	None	0.64A	3n65B-3i9v1: undetectable	3n65B-3i9v1: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N66_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	GLY 1 396 TRP 1 408 VAL 1 407	None	0.64A	3n66B-3i9v1: undetectable	3n66B-3i9v1: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NK7_A_SAMA770_0 (23S RRNA METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	LEU 1 251 GLY 1 326 GLU 1  97 GLY 1 327 ILE 1 106	None	0.97A	3nk7A-3i9v1: 2.3	3nk7A-3i9v1: 23.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OZW_A_KKKA413_1 (FLAVOHEMOGLOBIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 8	ALA 2 152 LEU 2 154 LEU 2  80 PRO 2 169	None	0.83A	3ozwA-3i9v2: undetectable	3ozwA-3i9v2: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OZW_B_KKKB413_1 (FLAVOHEMOGLOBIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 12	ALA 2 152 LEU 2 154 LEU 2  80 GLY 2 170 PRO 2 169	None	0.92A	3ozwB-3i9v2: undetectable	3ozwB-3i9v2: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PFG_A_SAMA264_1 (N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	3 / 3	TYR 5 184 TYR 3 137 GLU 3 129	None	0.77A	3pfgA-3i9v5: undetectable	3pfgA-3i9v5: 25.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SI7_A_ACTA5_0 (CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	LYS 1 250 SER 1 100 GLN 1 253	None	1.37A	3si7A-3i9v1: undetectable	3si7A-3i9v1: 20.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3R_A_9PLA501_1 (CYTOCHROME P450 2A6)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 11	ILE 3 211 GLY 3 212 THR 2  58 LEU 3 218 PHE 3 191	SF4  3 785 ( 4.5A) None None None None	1.05A	3t3rA-3i9v3: undetectable	3t3rA-3i9v3: 20.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TKD_A_CYZA266_2 (GLUTAMATE RECEPTOR 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 5	ILE 1 254 PRO 1 261 SER 2 127 GLY 1 262	None None FES  2 182 (-4.4A) None	1.14A	3tkdB-3i9v1: undetectable	3tkdB-3i9v1: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UJ6_A_SAMA300_1 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus; Thermus thermophilus)	4 / 4	SER 9  57 ASP 3 123 ASP 3 237 ALA 3 244	None	1.30A	3uj6A-3i9v9: undetectable	3uj6A-3i9v9: 19.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UJ7_B_SAMB302_1 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	TYR 1 180 SER 1 100 ASP 1  94 ILE 1 218	FMN  1 440 ( 4.1A) None FMN  1 440 (-4.4A) None	1.18A	3uj7B-3i9v1: undetectable	3uj7B-3i9v1: 20.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_A_ACTA503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus; Thermus thermophilus)	3 / 3	ARG 1 196 GLU 3 204 THR 3 209	None	0.79A	3v4tA-3i9v1: undetectable	3v4tA-3i9v1: 22.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VYW_A_SAMA501_1 (MNMC2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	4 / 6	HIS 2 174 ASP 1  30 ASP 1 109 GLU 1 151	None	1.28A	3vywA-3i9v2: undetectable	3vywA-3i9v2: 20.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VYW_C_SAMC401_0 (MNMC2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	HIS 3 468 GLY 3 510 LEU 3 399 GLY 3 400 ALA 3 376	None	1.10A	3vywC-3i9v3: 3.4	3vywC-3i9v3: 18.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VYW_D_SAMD401_0 (MNMC2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	TYR 1 313 GLY 1 248 GLY 1 242 LYS 1 250 LEU 1  62	None	1.09A	3vywD-3i9v1: undetectable	3vywD-3i9v1: 23.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_B_W9TB502_1 (HEMOLYTIC LECTIN CEL-III)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	GLU 3 273 GLY 3 272 LEU 3 275 GLU 3 250	None	0.84A	3w9tB-3i9v3: undetectable	3w9tB-3i9v3: 18.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_E_W9TE502_1 (HEMOLYTIC LECTIN CEL-III)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	GLU 3 273 GLY 3 272 LEU 3 275 GLU 3 250	None	0.84A	3w9tE-3i9v3: undetectable	3w9tE-3i9v3: 18.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_F_W9TF503_1 (HEMOLYTIC LECTIN CEL-III)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	GLU 3 273 GLY 3 272 LEU 3 275 GLU 3 250	None	0.84A	3w9tF-3i9v3: undetectable	3w9tF-3i9v3: 18.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A79_A_P1BA601_1 (AMINE OXIDASE [FLAVIN-CONTAINING] B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	LEU 4 126 LEU 4 133 ILE 4 201 TYR 4 204 PHE 4 208	None	1.45A	4a79A-3i9v4: undetectable	4a79A-3i9v4: 24.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A79_B_P1BB601_1 (AMINE OXIDASE [FLAVIN-CONTAINING] B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	LEU 4 126 LEU 4 133 ILE 4 201 TYR 4 204 PHE 4 208	None	1.43A	4a79B-3i9v4: undetectable	4a79B-3i9v4: 24.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A7A_A_RGZA601_1 (AMINE OXIDASE [FLAVIN-CONTAINING] B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 11	LEU 4 126 LEU 4 133 ILE 4 201 TYR 4 204 PHE 4 208	None	1.44A	4a7aA-3i9v4: undetectable	4a7aA-3i9v4: 24.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A7T_A_5FWA1000_1 (SUPEROXIDE DISMUTASE [CU-ZN])	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	4 / 6	GLU 7  98 LYS 7 101 PRO 7 109 LYS 7 107	None	1.39A	4a7tA-3i9v7: undetectable	4a7tA-3i9v7: 17.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ABZ_A_T1CA1209_1 (TETRACYCLINE REPRESSOR CLASS D)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	HIS 4  89 ASN 4 121 HIS 4 129 THR 4 346 SER 4 286	None	1.28A	4abzA-3i9v4: 1.2	4abzA-3i9v4: 20.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4APJ_A_ACTA1635_0 (ANGIOTENSIN-CONVERTI NG ENZYME BRADYKININ-POTENTIAT ING PEPTIDE B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus; Thermus thermophilus)	4 / 6	HIS 3 168 HIS 3 167 GLU 7  32 SER 7  60	CA  3 790 (-4.3A) MN  3 789 (-3.4A) CA  3 790 ( 3.4A) CA  3 790 ( 3.9A)	1.09A	4apjA-3i9v3: undetectable 4apjP-3i9v3: undetectable	4apjA-3i9v3: 20.85 4apjP-3i9v3: 4.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AZS_A_SAMA1475_0 (METHYLTRANSFERASE WBDD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 12	ALA 5 111 PHE 4 375 ARG 4 409 GLU 4  67 VAL 5 118	None	1.29A	4azsA-3i9v5: undetectable	4azsA-3i9v5: 16.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AZW_A_SAMA1451_0 (WBDD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 12	ALA 5 111 PHE 4 375 ARG 4 409 GLU 4  67 VAL 5 118	None	1.26A	4azwA-3i9v5: undetectable	4azwA-3i9v5: 19.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BLV_A_SAMA1281_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	LEU 3 477 GLY 3 471 GLY 3 690 LEU 3 399 GLY 3 508	None	1.16A	4blvA-3i9v3: 3.5	4blvA-3i9v3: 17.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_A_ACTA860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.09A	4d33A-3i9v1: undetectable	4d33A-3i9v1: 23.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_B_ACTB860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.07A	4d33B-3i9v1: undetectable	4d33B-3i9v1: 23.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D39_A_ACTA860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 4	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.08A	4d39A-3i9v1: 0.0	4d39A-3i9v1: 23.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D39_B_ACTB860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 6	GLY 1 396 TRP 1 408 VAL 1 407 SER 1 398	None None None SF4  1 439 ( 4.5A)	1.06A	4d39B-3i9v1: undetectable	4d39B-3i9v1: 23.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DA7_A_AC2A301_1 (PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	5 / 10	ARG 4 409 GLY 5  54 VAL 5 118 GLU 5 117 VAL 5  70	None	1.27A	4da7A-3i9v4: undetectable	4da7A-3i9v4: 19.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DAN_B_2FAB301_1 (PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	5 / 12	ARG 4 409 GLY 5  54 VAL 5 118 GLU 5 117 VAL 5  70	None	1.25A	4danA-3i9v4: undetectable 4danB-3i9v4: undetectable	4danA-3i9v4: 19.51 4danB-3i9v4: 19.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DF2_A_4CHA506_0 (NADPH DEHYDROGENASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	4 / 6	THR 2 130 HIS 2 174 HIS 2 175 TYR 1 105	None	1.43A	4df2A-3i9v2: undetectable	4df2A-3i9v2: 17.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E0F_A_RBFA301_1 (RIBOFLAVIN SYNTHASE SUBUNIT ALPHA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 11	VAL 3 615 LEU 3 351 THR 3 350 GLU 3 545 ALA 3 546	None	1.22A	4e0fA-3i9v3: undetectable	4e0fA-3i9v3: 12.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E7B_C_ACTC513_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	TYR 1  31 HIS 1  35 ARG 1  34	None	0.81A	4e7bC-3i9v1: undetectable	4e7bC-3i9v1: 22.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EJ1_A_FOLA201_1 (DIHYDROFOLATE REDUCTASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	4 / 4	GLU 4 333 ASP 3 132 ARG 3 245 THR 5 182	None	0.94A	4ej1A-3i9v4: undetectable	4ej1A-3i9v4: 16.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ENH_A_FVXA602_1 (CHOLESTEROL 24-HYDROXYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	LEU 2  31 ILE 2  49 ALA 2  50 GLY 3 212 ALA 2  64	None	0.96A	4enhA-3i9v2: undetectable	4enhA-3i9v2: 17.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FFW_A_715A801_1 (DIPEPTIDYL PEPTIDASE 4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	5 / 12	GLU 5 115 GLY 5 128 VAL 5  90 TYR 5  72 VAL 5  92	None	1.26A	4ffwA-3i9v5: undetectable	4ffwA-3i9v5: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FFW_B_715B801_2 (DIPEPTIDYL PEPTIDASE 4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	3 / 3	ARG 5 189 TYR 3 140 ASN 4 306	None	0.91A	4ffwB-3i9v5: undetectable	4ffwB-3i9v5: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FIM_A_CELA711_1 (LACTOTRANSFERRIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 9	GLU 4 341 GLY 4 340 PRO 4 338 GLU 4 102 GLY 4 106	None	1.07A	4fimA-3i9v4: undetectable	4fimA-3i9v4: 19.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FN9_A_STRA301_1 (STEROID RECEPTOR 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	LEU 3 638 LEU 3 641 LEU 3 644 ALA 3 645 ALA 3 361	None	0.96A	4fn9A-3i9v3: undetectable	4fn9A-3i9v3: 15.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FP9_A_SAMA401_1 (METHYLTRANSFERASE NSUN4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	3 / 3	ASP 7  39 ARG 7  75 ASP 7  36	None	0.80A	4fp9A-3i9v7: undetectable	4fp9A-3i9v7: 16.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FP9_C_SAMC401_1 (METHYLTRANSFERASE NSUN4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	3 / 3	ASP 7  39 ARG 7  75 ASP 7  36	None	0.68A	4fp9C-3i9v7: undetectable	4fp9C-3i9v7: 16.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FP9_F_SAMF401_1 (METHYLTRANSFERASE NSUN4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	3 / 3	ASP 7  39 ARG 7  75 ASP 7  36	None	0.69A	4fp9F-3i9v7: undetectable	4fp9F-3i9v7: 16.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_0 (S-ADENOSYLMETHIONINE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	4 / 8	HIS 4 336 ASP 5 178 LEU 5 174 ASP 3 132	None	1.00A	4k0bA-3i9v4: undetectable	4k0bA-3i9v4: 23.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KLR_B_CHDB504_0 (FERROCHELATASE, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus; Thermus thermophilus)	3 / 3	LEU 1 393 PRO 1 392 ARG 3 101	None	0.53A	4klrB-3i9v1: 2.2	4klrB-3i9v1: 22.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOE_F_TR6F101_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B E-SITE DNA2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 6	SER 1 413 GLY 1 379 ASP 1 383 GLY 1 375	None	0.99A	4koeA-3i9v1: undetectable 4koeB-3i9v1: undetectable 4koeC-3i9v1: 1.8	4koeA-3i9v1: 23.54 4koeB-3i9v1: 23.54 4koeC-3i9v1: 21.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L7I_B_SAMB501_0 (S-ADENOSYLMETHIONINE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	4 / 8	HIS 4 336 ASP 5 178 LEU 5 174 ASP 3 132	None	1.04A	4l7iA-3i9v4: undetectable	4l7iA-3i9v4: 23.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNW_A_T3A501_2 (THYROID HORMONE RECEPTOR ALPHA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	ILE 4  79 MET 4  70 ARG 4  73	None	0.91A	4lnwA-3i9v4: undetectable	4lnwA-3i9v4: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNX_A_T3A502_2 (THYROID HORMONE RECEPTOR ALPHA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	ILE 4  79 MET 4  70 ARG 4  73	None	0.89A	4lnxA-3i9v4: undetectable	4lnxA-3i9v4: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MJQ_A_27RA401_1 (DNA POLYMERASE III SUBUNIT BETA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	ARG 3 695 TYR 3 454 THR 3 403 PRO 3 457	None	1.35A	4mjqA-3i9v3: undetectable	4mjqA-3i9v3: 17.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N09_A_ADNA401_1 (ADENOSINE KINASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	GLY 3 294 CYH 3 263 ASN 3 225 GLY 3 224 ASP 3 292	SF4  3 786 (-3.4A) SF4  3 786 (-2.2A) None None None	1.20A	4n09A-3i9v3: 3.8	4n09A-3i9v3: 19.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NKV_A_AERA601_2 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 5	TYR 1  88 LEU 1 188 GLU 1 193 VAL 2  63	None	1.04A	4nkvA-3i9v1: undetectable	4nkvA-3i9v1: 23.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NKV_C_AERC601_2 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	TYR 1  88 LEU 1 188 GLU 1 193 VAL 2  63	None	1.05A	4nkvC-3i9v1: undetectable	4nkvC-3i9v1: 23.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4O8Z_A_BBIA402_1 (NAD-DEPENDENT PROTEIN DEACETYLASE SIRTUIN-3, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 5	HIS 4  63 PHE 4  66 LEU 5 121 PRO 5 145	None	1.38A	4o8zA-3i9v4: undetectable	4o8zA-3i9v4: 21.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OBW_A_SAMA602_0 (2-METHOXY-6-POLYPREN YL-1,4-BENZOQUINOL METHYLASE, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	ASN 1 343 GLY 1  99 SER 1 295 ILE 1 254 GLY 1 262	None FES  2 182 ( 4.8A) None None None	0.99A	4obwA-3i9v1: 2.6	4obwA-3i9v1: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OBW_C_SAMC601_0 (2-METHOXY-6-POLYPREN YL-1,4-BENZOQUINOL METHYLASE, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	ASN 1 343 GLY 1  99 SER 1 295 ILE 1 254 GLY 1 262	None FES  2 182 ( 4.8A) None None None	1.07A	4obwC-3i9v1: undetectable	4obwC-3i9v1: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODO_A_FK5A205_1 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 10	TYR 2  78 LEU 2 116 LEU 2 163 LEU 2 153 PHE 2 117	None	1.05A	4odoA-3i9v2: undetectable	4odoA-3i9v2: 25.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODO_B_FK5B203_1 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 10	TYR 2  78 LEU 2 116 LEU 2 163 LEU 2 153 PHE 2 117	None	1.02A	4odoB-3i9v2: undetectable	4odoB-3i9v2: 25.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODO_C_FK5C204_1 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 10	TYR 2  78 LEU 2 116 LEU 2 163 LEU 2 153 PHE 2 117	None	1.06A	4odoC-3i9v2: undetectable	4odoC-3i9v2: 25.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODR_B_FK5B201_1 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD, PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP1A CHIMERA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	5 / 11	TYR 2  78 LEU 2 116 LEU 2 163 LEU 2 153 PHE 2 117	None	1.00A	4odrA-3i9v2: undetectable 4odrB-3i9v2: undetectable	4odrA-3i9v2: 25.70 4odrB-3i9v2: 25.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P65_C_IPHC101_0 (INSULIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 11	LEU 3 641 LEU 3 360 ALA 3 357 LEU 3 345 VAL 3 341	None	1.09A	4p65C-3i9v3: undetectable 4p65D-3i9v3: undetectable 4p65J-3i9v3: undetectable 4p65L-3i9v3: undetectable	4p65C-3i9v3: 2.44 4p65D-3i9v3: 3.60 4p65J-3i9v3: 3.60 4p65L-3i9v3: 3.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PEV_B_ADNB501_2 (MEMBRANE LIPOPROTEIN FAMILY PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	PRO 4 337 LEU 4 105 GLN 4 308	None	0.71A	4pevB-3i9v4: undetectable	4pevB-3i9v4: 23.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PUO_C_NVPC901_1 (HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 8	LEU 3 728 VAL 3 736 VAL 3 777 LEU 3 758	None	0.97A	4puoC-3i9v3: undetectable	4puoC-3i9v3: 21.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QYQ_A_3CJA607_1 (LACTOPEROXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	GLN 3 661 HIS 3 657 ARG 3 611	None	1.15A	4qyqA-3i9v3: undetectable	4qyqA-3i9v3: 22.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QYQ_B_3CJB607_1 (LACTOPEROXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	GLN 3 661 HIS 3 657 ARG 3 611	None	1.12A	4qyqB-3i9v3: undetectable	4qyqB-3i9v3: 22.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R20_A_AERA602_1 (CYTOCHROME P450 FAMILY 17 POLYPEPTIDE 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	4 / 8	ILE 9  68 GLU 9 105 THR 9  44 VAL 9 138	SF4  9 183 (-4.8A) None None None	0.84A	4r20A-3i9v9: undetectable	4r20A-3i9v9: 15.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RZV_A_032A801_2 (SERINE/THREONINE-PRO TEIN KINASE B-RAF)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	4 / 5	ILE 9  68 VAL 9  70 CYH 9 108 HIS 9  41	SF4  9 183 (-4.8A) None SF4  9 184 (-2.3A) SF4  9 183 (-4.5A)	1.09A	4rzvA-3i9v9: undetectable	4rzvA-3i9v9: 20.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_C_377C401_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 6	ASN 4 377 TYR 4 246 LEU 4 239 PHE 5  48	None	1.10A	4twdB-3i9v4: undetectable 4twdC-3i9v4: undetectable	4twdB-3i9v4: 23.08 4twdC-3i9v4: 23.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_E_377E401_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus)	4 / 6	ASN 4 377 TYR 4 246 LEU 4 239 PHE 5  48	None	1.17A	4twdD-3i9v4: undetectable 4twdE-3i9v4: 2.2	4twdD-3i9v4: 23.08 4twdE-3i9v4: 23.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_F_377F401_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 7	GLU 1 232 GLU 1 116 TYR 1  32 LEU 1  33	None	1.18A	4twdF-3i9v1: undetectable 4twdJ-3i9v1: undetectable	4twdF-3i9v1: 20.74 4twdJ-3i9v1: 20.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UDC_A_DEXA1778_2 (GLUCOCORTICOID RECEPTOR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	3 / 3	MET 2  61 GLN 2  35 TYR 2  69	None	0.93A	4udcA-3i9v2: undetectable	4udcA-3i9v2: 18.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UIN_H_QI9H1226_0 (FAB 314.3)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	ARG 1 415 PHE 1 417 GLY 1 412 LEU 1 300 PRO 1 299	None	1.44A	4uinH-3i9v1: undetectable 4uinL-3i9v1: undetectable	4uinH-3i9v1: 20.54 4uinL-3i9v1: 18.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XZK_A_AG2A700_1 (PUTATIVE NAD(+)--ARGININE ADP-RIBOSYLTRANSFERA SE VIS)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	SER 7  58 ARG 3 178 GLU 7  32 GLU 7  34	None None CA  3 790 ( 3.4A) CA  3 790 ( 4.3A)	1.34A	4xzkA-3i9v7: undetectable	4xzkA-3i9v7: 23.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YDQ_A_HFGA802_0 (PROLINE--TRNA LIGASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus; Thermus thermophilus)	5 / 12	LEU 2  31 GLU 2  59 VAL 2  60 ARG 1 196 GLY 1 354	None None None None SF4  1 439 (-4.1A)	1.35A	4ydqA-3i9v2: undetectable	4ydqA-3i9v2: 16.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YDQ_A_HFGA802_0 (PROLINE--TRNA LIGASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	5 / 12	LEU 2  31 GLU 2  59 VAL 2  60 ARG 1 196 GLY 3 206	None	1.24A	4ydqA-3i9v2: undetectable	4ydqA-3i9v2: 16.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YOA_A_017A100_1 (HIV-1 PROTEASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	THR 2  56 PRO 2  57 THR 2  58 VAL 3 199	None	0.74A	4yoaA-3i9v2: undetectable	4yoaA-3i9v2: 19.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YVG_A_SAMA301_0 (TRNA (GUANINE-N(1)-)-METH YLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 12	GLY 1 324 GLY 1  67 ILE 1 329 GLY 1 326 GLY 1 293	None	1.08A	4yvgA-3i9v1: undetectable	4yvgA-3i9v1: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z2E_F_TR6F101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B SYMMETRIZED E-SITE DNA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	GLY 1  64 ARG 1  65 GLY 1  66 GLU 1 222	FMN  1 440 (-3.5A) None FMN  1 440 (-3.6A) None	1.24A	4z2eB-3i9v1: undetectable 4z2eC-3i9v1: undetectable	4z2eB-3i9v1: 22.12 4z2eC-3i9v1: 21.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4C_A_IPHA905_0 (PROTEIN ARGONAUTE-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	PHE 3 382 PRO 3 384 VAL 3 532 ALA 3 379	None	1.24A	4z4cA-3i9v3: 3.5	4z4cA-3i9v3: 22.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4D_A_IPHA904_0 (PROTEIN ARGONAUTE-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	PHE 3 382 PRO 3 384 VAL 3 532 ALA 3 379	None	1.22A	4z4dA-3i9v3: 4.0	4z4dA-3i9v3: 22.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4E_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	PHE 3 382 PRO 3 384 VAL 3 532 ALA 3 379	None	1.21A	4z4eA-3i9v3: 2.7	4z4eA-3i9v3: 22.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z53_F_TR6F101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,DNA TOPOISOMERASE 4 SUBUNIT A E-SITE DNA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 6	GLY 1 379 ASP 1 383 GLY 1 375 SER 1 413	None	1.02A	4z53A-3i9v1: undetectable 4z53B-3i9v1: undetectable	4z53A-3i9v1: 20.56 4z53B-3i9v1: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z90_A_4LEA401_1 (GAMMA-AMINOBUTYRIC-A CID RECEPTOR SUBUNIT BETA-1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 8	ALA 3 493 LEU 3 480 LEU 3 524 LEU 3 505 ALA 3 449	None	0.95A	4z90A-3i9v3: undetectable 4z90B-3i9v3: undetectable 4z90C-3i9v3: undetectable 4z90D-3i9v3: undetectable 4z90E-3i9v3: undetectable	4z90A-3i9v3: 15.34 4z90B-3i9v3: 15.34 4z90C-3i9v3: 15.34 4z90D-3i9v3: 15.34 4z90E-3i9v3: 15.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZDZ_A_TPFA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 7	ILE 1 149 PHE 1 169 GLY 1 130 LEU 1 224	None	0.94A	4zdzA-3i9v1: undetectable	4zdzA-3i9v1: 21.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE3_A_TPFA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 7	ILE 1 149 PHE 1 169 GLY 1 130 LEU 1 224	None	0.85A	4ze3A-3i9v1: undetectable	4ze3A-3i9v1: 21.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A7M_A_ACTA1923_0 (BETA-XYLOSIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	ASP 3 752 ARG 3 455 TYR 3 454	None	0.82A	5a7mA-3i9v3: 3.7	5a7mA-3i9v3: 21.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A7M_B_ACTB1924_0 (BETA-XYLOSIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	ASP 3 752 ARG 3 455 TYR 3 454	None	0.85A	5a7mB-3i9v3: 3.4	5a7mB-3i9v3: 21.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	SER 2  68 GLY 1 183 THR 1 325 ARG 3 205	MN  2 206 (-3.2A) FMN  1 440 (-3.3A) None None	1.10A	5btaA-3i9v2: 2.3 5btaB-3i9v2: undetectable 5btaC-3i9v2: 2.2	5btaA-3i9v2: 15.90 5btaB-3i9v2: 20.85 5btaC-3i9v2: 15.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	ARG 3 205 SER 2  68 GLY 1 183 THR 1 325	None MN  2 206 (-3.2A) FMN  1 440 (-3.3A) None	1.07A	5btcA-3i9v3: undetectable 5btcC-3i9v3: undetectable 5btcD-3i9v3: undetectable	5btcA-3i9v3: 21.71 5btcC-3i9v3: 21.71 5btcD-3i9v3: 15.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 6	SER 2  68 GLY 1 183 THR 1 325 ARG 3 205	MN  2 206 (-3.2A) FMN  1 440 (-3.3A) None None	1.10A	5btcA-3i9v2: 2.2 5btcB-3i9v2: undetectable 5btcC-3i9v2: 2.3	5btcA-3i9v2: 15.90 5btcB-3i9v2: 20.85 5btcC-3i9v2: 15.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDN_G_EVPG2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 6	SER 1 413 GLY 1 379 ASP 1 383 GLY 1 375	None	0.87A	5cdnA-3i9v1: undetectable 5cdnB-3i9v1: 2.0	5cdnA-3i9v1: 22.01 5cdnB-3i9v1: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EAJ_B_FOLB201_0 (DIHYDROFOLATE REDUCTASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	LEU 4 190 THR 4 115 ILE 4 116 LEU 4 182 PRO 4 183	None	1.05A	5eajB-3i9v4: undetectable	5eajB-3i9v4: 16.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESJ_A_TPFA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 8	ILE 1 149 PHE 1 169 GLY 1 130 LEU 1 224	None	0.92A	5esjA-3i9v1: undetectable	5esjA-3i9v1: 23.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESM_A_TPFA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 7	ILE 1 149 PHE 1 169 GLY 1 130 LEU 1 224	None	0.94A	5esmA-3i9v1: undetectable	5esmA-3i9v1: 23.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FCT_B_C2FB402_0 (THYMIDYLATE SYNTHASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus; Thermus thermophilus)	5 / 12	VAL 4 324 ILE 9  54 LEU 9  43 LEU 9  58 ALA 9  60	None SF4  9 184 (-4.5A) None SF4  9 184 ( 4.7A) None	1.41A	5fctB-3i9v4: undetectable	5fctB-3i9v4: 23.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FSA_B_X2NB590_2 (CYP51 VARIANT1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	3 / 3	PRO 3 551 LEU 3 345 SER 3 557	None	0.74A	5fsaB-3i9v3: undetectable	5fsaB-3i9v3: 19.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGT_A_ERYA402_0 (MACROLIDE 2'-PHOSPHOTRANSFERAS E)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	6 / 12	ILE 1 115 VAL 1 173 HIS 1 172 VAL 1 134 LEU 1 188 THR 1 216	None	1.25A	5igtA-3i9v1: undetectable	5igtA-3i9v1: 23.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKT_B_TLFB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	3 / 3	TYR 4 326 TYR 3 143 SER 5 194	None	0.79A	5iktB-3i9v4: undetectable	5iktB-3i9v4: 21.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M54_B_TA1B502_1 (TUBULIN BETA-2B CHAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	5 / 12	GLU 4 318 HIS 4 327 ALA 4 323 ARG 4 303 ARG 7  46	MN  7 202 (-3.0A) None None None None	1.47A	5m54B-3i9v4: undetectable	5m54B-3i9v4: 21.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_A_SAMA501_1 (PEPTIDE N-METHYLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 5	SER 3 380 ALA 3 379 GLN 3 513 THR 3 536	None	1.41A	5n0tA-3i9v3: 3.5	5n0tA-3i9v3: 19.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NKN_A_LOCA201_2 (NEUTROPHIL GELATINASE-ASSOCIATE D LIPOCALIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	VAL 1  57 LYS 1 247 MET 1 268	None	0.62A	5nknA-3i9v1: undetectable	5nknA-3i9v1: 11.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NWV_A_ACAA18_1 (SCRFP-TAG,GP41)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	5 / 12	GLY 7 100 LYS 7 101 GLU 7   6 LEU 7   9 GLU 7   8	None	1.27A	5nwvA-3i9v7: undetectable	5nwvA-3i9v7: 12.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ODC_A_ACTA703_0 (HETERODISULFIDE REDUCTASE, SUBUNIT A)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 4	GLN 1 420 GLN 1 288 PRO 1 301 ALA 1 289	None	1.47A	5odcA-3i9v1: 2.0 5odcG-3i9v1: 1.3	5odcA-3i9v1: 23.69 5odcG-3i9v1: 23.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ODC_G_ACTG704_0 (HETERODISULFIDE REDUCTASE, SUBUNIT A)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	PRO 1 301 ALA 1 289 GLN 1 420 GLN 1 288	None	1.47A	5odcA-3i9v1: 2.0 5odcG-3i9v1: 1.1	5odcA-3i9v1: 23.69 5odcG-3i9v1: 23.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SXQ_B_NIZB808_1 (CATALASE-PEROXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 8	GLU 4 282 VAL 4 264 GLY 4 236 LEU 4 239	None	1.08A	5sxqB-3i9v4: undetectable	5sxqB-3i9v4: 19.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SYE_B_TA1B502_1 (TUBULIN BETA CHAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	LEU 3 477 HIS 3 468 ALA 3 452 PRO 3 696 GLY 3 768	None	1.05A	5syeB-3i9v3: undetectable	5syeB-3i9v3: 21.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SYJ_A_NIZA809_1 (CATALASE-PEROXIDASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 8	GLU 4 282 VAL 4 264 GLY 4 236 LEU 4 239	None	1.08A	5syjA-3i9v4: undetectable	5syjA-3i9v4: 19.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5U4S_A_BEZA301_0 (PUTATIVE SHORT CHAIN DEHYDROGENASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	4 / 7	ILE 7  82 LEU 7  16 MET 7  20 LEU 7  17	None	0.97A	5u4sA-3i9v7: undetectable	5u4sA-3i9v7: 21.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5U4S_B_BEZB301_0 (PUTATIVE SHORT CHAIN DEHYDROGENASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 15 (Thermus thermophilus)	4 / 8	ILE 7  82 LEU 7  16 MET 7  20 LEU 7  17	None	0.99A	5u4sB-3i9v7: undetectable	5u4sB-3i9v7: 21.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VCG_A_08YA602_2 (CYTOCHROME P450 3A4)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	3 / 3	ARG 4 409 ARG 4 371 ARG 4 350	None	0.96A	5vcgA-3i9v4: undetectable	5vcgA-3i9v4: 21.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VUO_B_ACTB804_0 (NITRIC OXIDE SYNTHASE, BRAIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	3 / 3	GLY 1 396 TRP 1 408 VAL 1 407	None	0.64A	5vuoB-3i9v1: undetectable	5vuoB-3i9v1: 23.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WEA_A_IPHA901_0 (PROTEIN ARGONAUTE-2)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 5	LEU 2  11 LYS 2   3 LEU 2  52 GLU 2  48	None	1.26A	5weaA-3i9v2: undetectable	5weaA-3i9v2: 12.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WYQ_B_SAMB301_0 (TRNA (GUANINE-N(1)-)-METH YLTRANSFERASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	5 / 12	LEU 3 399 PRO 3 453 GLY 3 508 ILE 3 476 GLY 3 510	None	1.01A	5wyqB-3i9v3: undetectable	5wyqB-3i9v3: 17.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z85_P_CHDP307_0 (CYTOCHROME C OXIDASE SUBUNIT 3 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 2 (Thermus thermophilus)	4 / 6	GLN 2  36 PHE 2   4 LEU 2  11 PHE 2  15	None	1.14A	5z85P-3i9v2: undetectable 5z85W-3i9v2: undetectable	5z85P-3i9v2: 19.01 5z85W-3i9v2: 17.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZMQ_I_PACI1_0 (SERINE PROTEASE NS3 SERINE PROTEASE SUBUNIT NS2B PEPTIDE PAC-DLY-DLY-DAR)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 9 (Thermus thermophilus)	3 / 3	VAL 9 166 TYR 9 165 GLU 9 171	None	0.96A	5zmqD-3i9v9: undetectable 5zmqE-3i9v9: undetectable	5zmqD-3i9v9: 22.64 5zmqE-3i9v9: 17.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AG0_A_ACRA606_0 (ALPHA-AMYLASE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	5 / 7	GLY 1  66 GLY 1  67 GLY 1 324 GLY 1 327 GLY 1 326	FMN  1 440 (-3.6A) None None None None	0.92A	6ag0A-3i9v1: undetectable	6ag0A-3i9v1: 11.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CZM_C_HISC402_0 (ATP PHOSPHORIBOSYLTRANSF ERASE CATALYTIC SUBUNIT)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 9	VAL 4 264 LEU 5  77 GLY 4 237 LEU 4 239 VAL 4 248	None	1.26A	6czmB-3i9v4: undetectable 6czmC-3i9v4: undetectable	6czmB-3i9v4: 22.50 6czmC-3i9v4: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CZM_E_HISE402_0 (ATP PHOSPHORIBOSYLTRANSF ERASE CATALYTIC SUBUNIT)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 9	VAL 4 264 LEU 5  77 GLY 4 237 LEU 4 239 VAL 4 248	None	1.25A	6czmD-3i9v4: undetectable 6czmE-3i9v4: undetectable	6czmD-3i9v4: 22.50 6czmE-3i9v4: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CZM_F_HISF402_0 (ATP PHOSPHORIBOSYLTRANSF ERASE CATALYTIC SUBUNIT)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 5 (Thermus thermophilus; Thermus thermophilus)	5 / 10	VAL 4 264 LEU 5  77 GLY 4 237 LEU 4 239 VAL 4 248	None	1.29A	6czmE-3i9v4: undetectable 6czmF-3i9v4: undetectable	6czmE-3i9v4: 22.50 6czmF-3i9v4: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DWN_B_AQ4B602_1 (CYTOCHROME P450 1A1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	PHE 3 654 GLY 3 548 VAL 3 615 LEU 3 351	None	0.75A	6dwnB-3i9v3: undetectable	6dwnB-3i9v3: 7.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6F32_B_ACTB602_0 (AMINE OXIDASE LKCE)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus)	4 / 6	ASN 4  78 TYR 4  81 VAL 4 368 THR 4  69	None	1.35A	6f32B-3i9v4: undetectable	6f32B-3i9v4: 22.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6G9B_A_IXXA609_1 (ENVELOPE GLYCOPROTEIN,ENVELOP E GLYCOPROTEIN ENVELOPE GLYCOPROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 (Thermus thermophilus)	4 / 7	LEU 3 477 VAL 3 532 LEU 3 507 LEU 3 512	None	0.74A	6g9bA-3i9v3: undetectable 6g9bB-3i9v3: undetectable	6g9bA-3i9v3: 6.74 6g9bB-3i9v3: 7.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HD6_A_STIA603_1 (TYROSINE-PROTEIN KINASE ABL1)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 (Thermus thermophilus)	4 / 5	LEU 1 300 ILE 1 394 MET 1 322 GLY 1 293	None	0.95A	6hd6A-3i9v1: undetectable	6hd6A-3i9v1: 11.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MVX_A_K4DA1304_0 (ION TRANSPORT PROTEIN)	3i9v	NADH-QUINONE OXIDOREDUCTASE SUBUNIT 1 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 3 NADH-QUINONE OXIDOREDUCTASE SUBUNIT 4 (Thermus thermophilus; Thermus thermophilus; Thermus thermophilus)	4 / 6	THR 3 111 MET 4 321 THR 3 134 LEU 1 393	None SF4  3 784 ( 4.8A) None None	0.99A	6mvxA-3i9v3: undetectable 6mvxB-3i9v3: undetectable 6mvxC-3i9v3: undetectable	6mvxA-3i9v3: 14.25 6mvxB-3i9v3: 14.25 6mvxC-3i9v3: 14.25