SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3iha'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_J_TRPJ81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	1c9sI-3ihaA: undetectable 1c9sJ-3ihaA: undetectable	1c9sI-3ihaA: 7.68 1c9sJ-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_T_TRPT81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.58A	1c9sT-3ihaA: undetectable 1c9sU-3ihaA: undetectable	1c9sT-3ihaA: 7.68 1c9sU-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_U_TRPU81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.61A	1c9sU-3ihaA: undetectable 1c9sV-3ihaA: undetectable	1c9sU-3ihaA: 7.68 1c9sV-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D4S_A_TPVA201_1 (PROTEIN (HIV-1 PROTEASE))	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 10	LEU A 409 ALA A 346 ASP A 349 VAL A 320 GLY A 314	None	1.25A	1d4sA-3ihaA: undetectable	1d4sA-3ihaA: 11.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7A_A_PFLA4001_1 (SERUM ALBUMIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 9	LEU A 304 ILE A 255 LEU A 9 VAL A 277 GLY A 276	None	1.28A	1e7aA-3ihaA: undetectable	1e7aA-3ihaA: 20.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FPQ_A_SAMA1699_0 (ISOLIQUIRITIGENIN 2'-O-METHYLTRANSFERA SE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 10	GLY A 428 LEU A 432 VAL A 439 ASP A 435 ALA A 340	None	1.42A	1fpqA-3ihaA: undetectable	1fpqA-3ihaA: 21.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GHM_A_CEDA1_1 (BETA-LACTAMASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	6 / 12	SER A 64 LYS A 67 ASN A 114 LYS A 258 SER A 259 GLY A 260	GLU A 500 (-2.6A) GLU A 500 ( 4.6A) GLU A 500 (-3.7A) GLU A 500 ( 4.7A) None GLU A 500 ( 3.8A)	0.81A	1ghmA-3ihaA: 12.5	1ghmA-3ihaA: 20.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_L_TRPL81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.61A	1gtfL-3ihaA: undetectable 1gtfM-3ihaA: undetectable	1gtfL-3ihaA: 7.68 1gtfM-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_N_TRPN81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.64A	1gtfN-3ihaA: undetectable 1gtfO-3ihaA: undetectable	1gtfN-3ihaA: 7.68 1gtfO-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTI_B_CCSB47_0 (GLUTATHIONE S-TRANSFERASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	LEU A 211 LEU A 269 GLY A 274 LEU A 266	None	0.79A	1gtiB-3ihaA: undetectable	1gtiB-3ihaA: 18.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_B_TRPB81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.68A	1gtnA-3ihaA: undetectable 1gtnB-3ihaA: undetectable	1gtnA-3ihaA: 7.68 1gtnB-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_B_BEZB504_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	LEU A 180 ALA A 119 ILE A 113 PRO A 108	None	0.99A	1oniB-3ihaA: undetectable 1oniC-3ihaA: undetectable	1oniB-3ihaA: 14.07 1oniC-3ihaA: 14.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_B_TRPB81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.60A	1utdB-3ihaA: undetectable 1utdC-3ihaA: undetectable	1utdB-3ihaA: 7.68 1utdC-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_F_TRPF81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.60A	1utdF-3ihaA: undetectable 1utdG-3ihaA: undetectable	1utdF-3ihaA: 7.68 1utdG-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_I_TRPI81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.61A	1utdI-3ihaA: undetectable 1utdJ-3ihaA: undetectable	1utdI-3ihaA: 7.68 1utdJ-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_J_TRPJ81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	GLY A 116 THR A 70 HIS A 121 SER A 66	None	0.59A	1utdJ-3ihaA: undetectable 1utdK-3ihaA: undetectable	1utdJ-3ihaA: 7.68 1utdK-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_B_ACTB861_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 5	GLY A 260 GLN A 63 VAL A 199 SER A 66	GLU A 500 ( 3.8A) GLU A 500 (-3.4A) None None	1.06A	1zzuB-3ihaA: undetectable	1zzuB-3ihaA: 20.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AIA_B_SAMB206_0 (UPF0217 PROTEIN MJ1640)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 5	LEU A 145 GLY A 147 GLU A 222 CYH A 210	None	1.15A	3aiaA-3ihaA: undetectable 3aiaB-3ihaA: undetectable	3aiaA-3ihaA: 17.72 3aiaB-3ihaA: 17.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_E_SVRE510_3 (PHOSPHOLIPASE A2)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 5	VAL A 234 VAL A 233 THR A 213 THR A 238	None	1.25A	3bjwG-3ihaA: undetectable	3bjwG-3ihaA: 12.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_H_SVRH511_2 (PHOSPHOLIPASE A2)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 5	VAL A 234 VAL A 233 THR A 213 THR A 238	None	1.21A	3bjwD-3ihaA: undetectable	3bjwD-3ihaA: 12.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LP9_D_SPMD230_1 (LS-24)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	3 / 3	GLU A 94 GLU A 160 ASN A 167	None GLU A 500 (-3.7A) GLU A 500 (-3.6A)	0.91A	3lp9B-3ihaA: undetectable 3lp9D-3ihaA: undetectable	3lp9B-3ihaA: 18.24 3lp9D-3ihaA: 18.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NUJ_B_478B401_2 (PROTEASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 9	LEU A 12 GLY A 291 GLY A 267 ILE A 255 ILE A 41	None	0.92A	3nujB-3ihaA: undetectable	3nujB-3ihaA: 12.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OGQ_A_AB1A200_1 (FIV PROTEASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	6 / 10	LEU A 409 ALA A 346 ASP A 349 VAL A 320 GLY A 314 LEU A 329	None	1.27A	3ogqA-3ihaA: undetectable	3ogqA-3ihaA: 13.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_A_SAMA401_0 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	ALA A 73 LEU A 75 ALA A 268 PRO A 68 LEU A 266	None	1.19A	3tm4A-3ihaA: undetectable	3tm4A-3ihaA: 22.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_B_SAMB401_0 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	ALA A 73 LEU A 75 ALA A 268 PRO A 68 LEU A 266	None	1.18A	3tm4B-3ihaA: undetectable	3tm4B-3ihaA: 22.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FR0_A_SAMA401_0 (ARSENIC METHYLTRANSFERASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	GLY A 291 ASP A 283 LEU A 298 ASN A 287 VAL A 265	None	1.15A	4fr0A-3ihaA: undetectable	4fr0A-3ihaA: 23.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KLR_A_CHDA504_0 (FERROCHELATASE, MITOCHONDRIAL)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	LEU A 174 ARG A 134 SER A 105 VAL A 83	None	1.18A	4klrA-3ihaA: undetectable	4klrA-3ihaA: 20.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UBE_A_2FAA401_2 (ADENOSINE KINASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 4	ALA A 42 VAL A 206 GLY A 48 THR A 45	None	1.08A	4ubeA-3ihaA: undetectable	4ubeA-3ihaA: 24.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZJZ_A_BEZA1001_0 (BENZOATE-COENZYME A LIGASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	ALA A 119 VAL A 179 GLY A 116 ALA A 111	None	0.65A	4zjzA-3ihaA: undetectable	4zjzA-3ihaA: 24.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	ALA A 391 ARG A 431 GLY A 428 GLU A 427	None	0.86A	5bs8A-3ihaA: undetectable 5bs8C-3ihaA: undetectable 5bs8D-3ihaA: undetectable	5bs8A-3ihaA: 23.84 5bs8C-3ihaA: 23.84 5bs8D-3ihaA: 21.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 6	ALA A 391 ARG A 431 GLY A 428 GLU A 427	None	0.83A	5btgA-3ihaA: undetectable 5btgB-3ihaA: undetectable 5btgC-3ihaA: undetectable	5btgA-3ihaA: 23.84 5btgB-3ihaA: 21.90 5btgC-3ihaA: 23.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 7	ALA A 391 ARG A 431 GLY A 428 GLU A 427	None	0.93A	5btgA-3ihaA: undetectable 5btgC-3ihaA: undetectable 5btgD-3ihaA: undetectable	5btgA-3ihaA: 23.84 5btgC-3ihaA: 23.84 5btgD-3ihaA: 21.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_G_SAMG301_0 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	6 / 12	ALA A 44 PRO A 46 THR A 213 GLY A 208 GLY A 274 GLY A 271	None	1.32A	5c0oG-3ihaA: undetectable	5c0oG-3ihaA: 22.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_G_SAMG301_0 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	6 / 12	ALA A 44 PRO A 46 THR A 213 GLY A 274 GLY A 271 LEU A 145	None	1.43A	5c0oG-3ihaA: undetectable	5c0oG-3ihaA: 22.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CYM_A_T27A601_1 (HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	PRO A 108 LEU A 174 VAL A 188 TYR A 191 LEU A 170	None None None GLU A 500 (-4.1A) None	1.17A	5cymA-3ihaA: undetectable	5cymA-3ihaA: 21.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.62A	5eevL-3ihaA: undetectable 5eevV-3ihaA: undetectable	5eevL-3ihaA: 7.68 5eevV-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	5eewL-3ihaA: undetectable 5eewV-3ihaA: undetectable	5eewL-3ihaA: 7.68 5eewV-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	5eezL-3ihaA: undetectable 5eezV-3ihaA: undetectable	5eezL-3ihaA: 7.68 5eezV-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	5ef1L-3ihaA: undetectable 5ef1V-3ihaA: undetectable	5ef1L-3ihaA: 7.68 5ef1V-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	5ef2L-3ihaA: undetectable 5ef2V-3ihaA: undetectable	5ef2L-3ihaA: 7.68 5ef2V-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF3_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	SER A 66 GLY A 116 THR A 70 HIS A 121	None	0.63A	5ef3L-3ihaA: undetectable 5ef3V-3ihaA: undetectable	5ef3L-3ihaA: 7.68 5ef3V-3ihaA: 7.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EQB_A_1YNA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 4	TYR A 243 TYR A 191 PRO A 68 THR A 61	None GLU A 500 (-4.1A) None None	1.22A	5eqbA-3ihaA: 0.0	5eqbA-3ihaA: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TWJ_A_SAMA201_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE H)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	GLY A 276 SER A 299 LEU A 304 LEU A 269 VAL A 273	None	0.85A	5twjA-3ihaA: undetectable	5twjA-3ihaA: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TWJ_C_SAMC201_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE H)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	GLY A 276 SER A 299 LEU A 304 LEU A 269 VAL A 273	None	0.83A	5twjC-3ihaA: undetectable	5twjC-3ihaA: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XPR_A_K86A1201_1 (ENDOTHELIN B RECEPTOR,ENDOLYSIN,E NDOTHELIN B RECEPTOR)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	VAL A 273 LEU A 50 LEU A 9 HIS A 51 ILE A 41	None	1.43A	5xprA-3ihaA: undetectable	5xprA-3ihaA: 21.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CP4_A_CAMA422_0 (CYTOCHROME P450CAM)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	4 / 8	LEU A 225 VAL A 229 ASP A 77 VAL A 83	None	1.08A	6cp4A-3ihaA: undetectable	6cp4A-3ihaA: 25.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DM0_B_CYZB1302_0 (GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 10	SER A 288 LEU A 298 LEU A 16 ILE A 275 GLY A 276	None	1.19A	6dm0B-3ihaA: undetectable 6dm0C-3ihaA: undetectable	6dm0B-3ihaA: 9.43 6dm0C-3ihaA: 9.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6ELI_A_T27A701_1 (REVERSE TRANSCRIPTASE)	3iha	SALT-TOLERANT GLUTAMINASE (Micrococcus luteus)	5 / 12	PRO A 108 LEU A 174 VAL A 188 TYR A 191 LEU A 170	None None None GLU A 500 (-4.1A) None	1.22A	6eliA-3ihaA: undetectable	6eliA-3ihaA: 9.51

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_J_TRPJ81_0","TRP RNA-BINDING ATTENUATION PROTEIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","1c9sI-3ihaA:undetectable;1c9sJ-3ihaA:undetectable","1c9sI-3ihaA:7.68;1c9sJ-3ihaA:7.68"],["1C9S_T_TRPT81_0","TRP RNA-BINDING ATTENUATION PROTEIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.58A","1c9sT-3ihaA:undetectable;1c9sU-3ihaA:undetectable","1c9sT-3ihaA:7.68;1c9sU-3ihaA:7.68"],["1C9S_U_TRPU81_0","TRP RNA-BINDING ATTENUATION PROTEIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.61A","1c9sU-3ihaA:undetectable;1c9sV-3ihaA:undetectable","1c9sU-3ihaA:7.68;1c9sV-3ihaA:7.68"],["1D4S_A_TPVA201_1","PROTEIN (HIV-1 PROTEASE)","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"LEU A 409;ALA A 346;ASP A 349;VAL A 320;GLY A 314","None","1.25A","1d4sA-3ihaA:undetectable","1d4sA-3ihaA:11.56"],["1E7A_A_PFLA4001_1","SERUM ALBUMIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"LEU A 304;ILE A 255;LEU A   9;VAL A 277;GLY A 276","None","1.28A","1e7aA-3ihaA:undetectable","1e7aA-3ihaA:20.78"],["1FPQ_A_SAMA1699_0","ISOLIQUIRITIGENIN 2'-O-METHYLTRANSFERASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"GLY A 428;LEU A 432;VAL A 439;ASP A 435;ALA A 340","None","1.42A","1fpqA-3ihaA:undetectable","1fpqA-3ihaA:21.90"],["1GHM_A_CEDA1_1","BETA-LACTAMASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",6,"SER A  64;LYS A  67;ASN A 114;LYS A 258;SER A 259;GLY A 260","GLU A 500 (-2.6A);GLU A 500 ( 4.6A);GLU A 500 (-3.7A);GLU A 500 ( 4.7A);None;GLU A 500 ( 3.8A)","0.81A","1ghmA-3ihaA:12.5","1ghmA-3ihaA:20.05"],["1GTF_L_TRPL81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.61A","1gtfL-3ihaA:undetectable;1gtfM-3ihaA:undetectable","1gtfL-3ihaA:7.68;1gtfM-3ihaA:7.68"],["1GTF_N_TRPN81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.64A","1gtfN-3ihaA:undetectable;1gtfO-3ihaA:undetectable","1gtfN-3ihaA:7.68;1gtfO-3ihaA:7.68"],["1GTI_B_CCSB47_0","GLUTATHIONE S-TRANSFERASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"LEU A 211;LEU A 269;GLY A 274;LEU A 266","None","0.79A","1gtiB-3ihaA:undetectable","1gtiB-3ihaA:18.12"],["1GTN_B_TRPB81_0","TRP RNA-BINDING ATTENUATION PROTEIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.68A","1gtnA-3ihaA:undetectable;1gtnB-3ihaA:undetectable","1gtnA-3ihaA:7.68;1gtnB-3ihaA:7.68"],["1ONI_B_BEZB504_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"LEU A 180;ALA A 119;ILE A 113;PRO A 108","None","0.99A","1oniB-3ihaA:undetectable;1oniC-3ihaA:undetectable","1oniB-3ihaA:14.07;1oniC-3ihaA:14.07"],["1UTD_B_TRPB81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.60A","1utdB-3ihaA:undetectable;1utdC-3ihaA:undetectable","1utdB-3ihaA:7.68;1utdC-3ihaA:7.68"],["1UTD_F_TRPF81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.60A","1utdF-3ihaA:undetectable;1utdG-3ihaA:undetectable","1utdF-3ihaA:7.68;1utdG-3ihaA:7.68"],["1UTD_I_TRPI81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.61A","1utdI-3ihaA:undetectable;1utdJ-3ihaA:undetectable","1utdI-3ihaA:7.68;1utdJ-3ihaA:7.68"],["1UTD_J_TRPJ81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 116;THR A  70;HIS A 121;SER A  66","None","0.59A","1utdJ-3ihaA:undetectable;1utdK-3ihaA:undetectable","1utdJ-3ihaA:7.68;1utdK-3ihaA:7.68"],["1ZZU_B_ACTB861_0","NITRIC-OXIDE SYNTHASE, BRAIN","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"GLY A 260;GLN A  63;VAL A 199;SER A  66","GLU A 500 ( 3.8A);GLU A 500 (-3.4A);None;None","1.06A","1zzuB-3ihaA:undetectable","1zzuB-3ihaA:20.08"],["3AIA_B_SAMB206_0","UPF0217 PROTEIN MJ1640","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"LEU A 145;GLY A 147;GLU A 222;CYH A 210","None","1.15A","3aiaA-3ihaA:undetectable;3aiaB-3ihaA:undetectable","3aiaA-3ihaA:17.72;3aiaB-3ihaA:17.72"],["3BJW_E_SVRE510_3","PHOSPHOLIPASE A2;PHOSPHOLIPASE A2","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"VAL A 234;VAL A 233;THR A 213;THR A 238","None","1.25A","3bjwG-3ihaA:undetectable","3bjwG-3ihaA:12.81"],["3BJW_H_SVRH511_2","PHOSPHOLIPASE A2;PHOSPHOLIPASE A2","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"VAL A 234;VAL A 233;THR A 213;THR A 238","None","1.21A","3bjwD-3ihaA:undetectable","3bjwD-3ihaA:12.81"],["3LP9_D_SPMD230_1","LS-24;LS-24","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",3,"GLU A  94;GLU A 160;ASN A 167","None;GLU A 500 (-3.7A);GLU A 500 (-3.6A)","0.91A","3lp9B-3ihaA:undetectable;3lp9D-3ihaA:undetectable","3lp9B-3ihaA:18.24;3lp9D-3ihaA:18.24"],["3NUJ_B_478B401_2","PROTEASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"LEU A  12;GLY A 291;GLY A 267;ILE A 255;ILE A  41","None","0.92A","3nujB-3ihaA:undetectable","3nujB-3ihaA:12.17"],["3OGQ_A_AB1A200_1","FIV PROTEASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",6,"LEU A 409;ALA A 346;ASP A 349;VAL A 320;GLY A 314;LEU A 329","None","1.27A","3ogqA-3ihaA:undetectable","3ogqA-3ihaA:13.43"],["3TM4_A_SAMA401_0","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"ALA A  73;LEU A  75;ALA A 268;PRO A  68;LEU A 266","None","1.19A","3tm4A-3ihaA:undetectable","3tm4A-3ihaA:22.43"],["3TM4_B_SAMB401_0","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"ALA A  73;LEU A  75;ALA A 268;PRO A  68;LEU A 266","None","1.18A","3tm4B-3ihaA:undetectable","3tm4B-3ihaA:22.43"],["4FR0_A_SAMA401_0","ARSENIC METHYLTRANSFERASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"GLY A 291;ASP A 283;LEU A 298;ASN A 287;VAL A 265","None","1.15A","4fr0A-3ihaA:undetectable","4fr0A-3ihaA:23.76"],["4KLR_A_CHDA504_0","FERROCHELATASE, MITOCHONDRIAL","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"LEU A 174;ARG A 134;SER A 105;VAL A  83","None","1.18A","4klrA-3ihaA:undetectable","4klrA-3ihaA:20.36"],["4UBE_A_2FAA401_2","ADENOSINE KINASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"ALA A  42;VAL A 206;GLY A  48;THR A  45","None","1.08A","4ubeA-3ihaA:undetectable","4ubeA-3ihaA:24.03"],["4ZJZ_A_BEZA1001_0","BENZOATE-COENZYME A LIGASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"ALA A 119;VAL A 179;GLY A 116;ALA A 111","None","0.65A","4zjzA-3ihaA:undetectable","4zjzA-3ihaA:24.06"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"ALA A 391;ARG A 431;GLY A 428;GLU A 427","None","0.86A","5bs8A-3ihaA:undetectable;5bs8C-3ihaA:undetectable;5bs8D-3ihaA:undetectable","5bs8A-3ihaA:23.84;5bs8C-3ihaA:23.84;5bs8D-3ihaA:21.90"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"ALA A 391;ARG A 431;GLY A 428;GLU A 427","None","0.83A","5btgA-3ihaA:undetectable;5btgB-3ihaA:undetectable;5btgC-3ihaA:undetectable","5btgA-3ihaA:23.84;5btgB-3ihaA:21.90;5btgC-3ihaA:23.84"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"ALA A 391;ARG A 431;GLY A 428;GLU A 427","None","0.93A","5btgA-3ihaA:undetectable;5btgC-3ihaA:undetectable;5btgD-3ihaA:undetectable","5btgA-3ihaA:23.84;5btgC-3ihaA:23.84;5btgD-3ihaA:21.90"],["5C0O_G_SAMG301_0","TRNA (ADENINE(58)-N(1))-METHYLTRANSFERASE TRMI","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",6,"ALA A  44;PRO A  46;THR A 213;GLY A 208;GLY A 274;GLY A 271","None","1.32A","5c0oG-3ihaA:undetectable","5c0oG-3ihaA:22.27"],["5C0O_G_SAMG301_0","TRNA (ADENINE(58)-N(1))-METHYLTRANSFERASE TRMI","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",6,"ALA A  44;PRO A  46;THR A 213;GLY A 274;GLY A 271;LEU A 145","None","1.43A","5c0oG-3ihaA:undetectable","5c0oG-3ihaA:22.27"],["5CYM_A_T27A601_1","HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"PRO A 108;LEU A 174;VAL A 188;TYR A 191;LEU A 170","None;None;None;GLU A 500 (-4.1A);None","1.17A","5cymA-3ihaA:undetectable","5cymA-3ihaA:21.51"],["5EEV_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.62A","5eevL-3ihaA:undetectable;5eevV-3ihaA:undetectable","5eevL-3ihaA:7.68;5eevV-3ihaA:7.68"],["5EEW_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","5eewL-3ihaA:undetectable;5eewV-3ihaA:undetectable","5eewL-3ihaA:7.68;5eewV-3ihaA:7.68"],["5EEZ_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","5eezL-3ihaA:undetectable;5eezV-3ihaA:undetectable","5eezL-3ihaA:7.68;5eezV-3ihaA:7.68"],["5EF1_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","5ef1L-3ihaA:undetectable;5ef1V-3ihaA:undetectable","5ef1L-3ihaA:7.68;5ef1V-3ihaA:7.68"],["5EF2_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","5ef2L-3ihaA:undetectable;5ef2V-3ihaA:undetectable","5ef2L-3ihaA:7.68;5ef2V-3ihaA:7.68"],["5EF3_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"SER A  66;GLY A 116;THR A  70;HIS A 121","None","0.63A","5ef3L-3ihaA:undetectable;5ef3V-3ihaA:undetectable","5ef3L-3ihaA:7.68;5ef3V-3ihaA:7.68"],["5EQB_A_1YNA602_2","LANOSTEROL 14-ALPHA DEMETHYLASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"TYR A 243;TYR A 191;PRO A  68;THR A  61","None;GLU A 500 (-4.1A);None;None","1.22A","5eqbA-3ihaA:0.0","5eqbA-3ihaA:21.39"],["5TWJ_A_SAMA201_0","RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE H","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"GLY A 276;SER A 299;LEU A 304;LEU A 269;VAL A 273","None","0.85A","5twjA-3ihaA:undetectable","5twjA-3ihaA:17.98"],["5TWJ_C_SAMC201_0","RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE H","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"GLY A 276;SER A 299;LEU A 304;LEU A 269;VAL A 273","None","0.83A","5twjC-3ihaA:undetectable","5twjC-3ihaA:17.98"],["5XPR_A_K86A1201_1","ENDOTHELIN B RECEPTOR,ENDOLYSIN,ENDOTHELIN B RECEPTOR","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"VAL A 273;LEU A  50;LEU A   9;HIS A  51;ILE A  41","None","1.43A","5xprA-3ihaA:undetectable","5xprA-3ihaA:21.91"],["6CP4_A_CAMA422_0","CYTOCHROME P450CAM","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",4,"LEU A 225;VAL A 229;ASP A  77;VAL A  83","None","1.08A","6cp4A-3ihaA:undetectable","6cp4A-3ihaA:25.05"],["6DM0_B_CYZB1302_0","GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"SER A 288;LEU A 298;LEU A  16;ILE A 275;GLY A 276","None","1.19A","6dm0B-3ihaA:undetectable;6dm0C-3ihaA:undetectable","6dm0B-3ihaA:9.43;6dm0C-3ihaA:9.43"],["6ELI_A_T27A701_1","REVERSE TRANSCRIPTASE","3iha","SALT-TOLERANT GLUTAMINASE","Micrococcus luteus",5,"PRO A 108;LEU A 174;VAL A 188;TYR A 191;LEU A 170","None;None;None;GLU A 500 (-4.1A);None","1.22A","6eliA-3ihaA:undetectable","6eliA-3ihaA:9.51"]]