SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3kfl'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AV2_C_DVAC6_0 (GRAMICIDIN A)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ALA A 695 VAL A 698 TRP A 596	None	0.86A	1av2C-3kflA: undetectable 1av2D-3kflA: undetectable	1av2C-3kflA: 4.38 1av2D-3kflA: 4.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FFY_A_MRCA1993_1 (ISOLEUCYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 225 GLY A 227 GLY A 484 ASP A 486 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.6A)	0.80A	1ffyA-3kflA: 21.6	1ffyA-3kflA: 21.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FFY_A_MRCA1993_1 (ISOLEUCYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 228 GLY A 227 GLY A 484 ASP A 486 HIS A 513	POP A 802 ( 3.8A) ME8 A 801 (-3.4A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.6A)	1.05A	1ffyA-3kflA: 21.6	1ffyA-3kflA: 21.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IWH_A_PEMA501_1 (HEMOGLOBIN ALPHA CHAIN)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 6	LYS A 690 ASP A 694 ALA A 695 LEU A 723	None EDO A 816 (-4.4A) None None	0.39A	1iwhA-3kflA: undetectable	1iwhA-3kflA: 13.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NT2_A_SAMA301_1 (FIBRILLARIN-LIKE PRE-RRNA PROCESSING PROTEIN)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	THR A 367 GLU A 337 ASP A 445	None	0.86A	1nt2A-3kflA: 2.7	1nt2A-3kflA: 18.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NT5_A_DVAA6_0 (GRAMICIDIN A)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ALA A 695 VAL A 698 TRP A 596	None	0.78A	1nt5A-3kflA: undetectable	1nt5A-3kflA: 4.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NT5_B_DVAB6_0 (GRAMICIDIN A)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ALA A 695 VAL A 698 TRP A 596	None	0.78A	1nt5B-3kflA: undetectable	1nt5B-3kflA: 4.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PG2_A_ADNA552_1 (METHIONYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	7 / 11	HIS A 225 GLY A 227 HIS A 228 GLY A 484 ASP A 486 ILE A 487 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.0A) ME8 A 801 (-4.6A)	0.66A	1pg2A-3kflA: 35.5	1pg2A-3kflA: 26.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QU2_A_MRCA1993_1 (ISOLEUCYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	6 / 12	HIS A 225 GLY A 227 HIS A 228 GLY A 484 ASP A 486 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.6A)	0.83A	1qu2A-3kflA: 21.7	1qu2A-3kflA: 21.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QU2_A_MRCA1993_1 (ISOLEUCYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 228 GLY A 227 GLY A 484 ASP A 486 HIS A 513	POP A 802 ( 3.8A) ME8 A 801 (-3.4A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.6A)	1.05A	1qu2A-3kflA: 21.7	1qu2A-3kflA: 21.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QU3_A_MRCA993_1 (ISOLEUCYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 225 GLY A 227 HIS A 228 ASP A 486 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.6A)	1.04A	1qu3A-3kflA: 16.0	1qu3A-3kflA: 21.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QZR_B_CDXB901_1 (DNA TOPOISOMERASE II)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 7	HIS A 470 TYR A 451 ASN A 449 LEU A 309	None None ME8 A 801 (-4.6A) None	1.13A	1qzrA-3kflA: undetectable	1qzrA-3kflA: 21.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1W5U_C_DVAC6_0 (GRAMICIDIN D)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ALA A 695 VAL A 698 TRP A 596	None	0.82A	1w5uC-3kflA: undetectable 1w5uD-3kflA: undetectable	1w5uC-3kflA: 4.38 1w5uD-3kflA: 4.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2G72_B_SAMB2002_0 (PHENYLETHANOLAMINE N-METHYLTRANSFERASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	GLN A 682 PHE A 711 LEU A 613 ILE A 713 VAL A 714	None	1.30A	2g72B-3kflA: 2.2	2g72B-3kflA: 18.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRC_B_CHDB1603_0 (FERROCHELATASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 5	MET A 500 ARG A 382 LEU A 413 PRO A 507	None None FMT A 822 (-4.5A) None	1.37A	2hrcB-3kflA: 0.0	2hrcB-3kflA: 19.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IZQ_B_DVAB6_0 (GRAMICIDIN D)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	TRP A 596 ALA A 695 VAL A 698	None	0.83A	2izqA-3kflA: undetectable 2izqB-3kflA: undetectable	2izqA-3kflA: 4.38 2izqB-3kflA: 4.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QEO_A_LNRA200_1 (D7R4 PROTEIN)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	TYR A 218 HIS A 491 ILE A 487 VAL A 483 MET A 295	ME8 A 801 (-4.7A) ME8 A 801 (-4.6A) ME8 A 801 (-4.0A) None None	1.00A	2qeoA-3kflA: undetectable	2qeoA-3kflA: 13.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VL2_B_BEZB1162_0 (PEROXIREDOXIN-5)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 7	THR A 215 PRO A 216 PHE A 288 THR A 255	None ME8 A 801 (-4.4A) None None	0.98A	2vl2B-3kflA: 3.4	2vl2B-3kflA: 17.22
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	2X1L_A_ADNA601_1 (METHIONYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	7 / 11	HIS A 225 GLY A 227 HIS A 228 GLY A 484 ASP A 486 ILE A 487 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.0A) ME8 A 801 (-4.6A)	0.52A	2x1lA-3kflA: 45.3	2x1lA-3kflA: 41.61
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	2X1L_B_ADNB601_1 (METHIONYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	7 / 12	HIS A 225 GLY A 227 HIS A 228 GLY A 484 ASP A 486 ILE A 487 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.0A) ME8 A 801 (-4.6A)	0.50A	2x1lB-3kflA: 43.3	2x1lB-3kflA: 41.61
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	2X1L_C_ADNC601_1 (METHIONYL-TRNA SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	7 / 11	HIS A 225 GLY A 227 HIS A 228 GLY A 484 ASP A 486 ILE A 487 HIS A 513	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) ME8 A 801 (-3.2A) ME8 A 801 ( 2.6A) ME8 A 801 (-4.0A) ME8 A 801 (-4.6A)	0.50A	2x1lC-3kflA: 43.0	2x1lC-3kflA: 41.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ADX_A_IMNA2_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 7	ILE A 713 ILE A 692 LEU A 710 PHE A 711 LEU A 643	None	1.30A	3adxA-3kflA: undetectable	3adxA-3kflA: 20.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HEC_A_STIA1_2 (MITOGEN-ACTIVATED PROTEIN KINASE 14)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 4	LEU A 574 MET A 693 ILE A 629 ASP A 236	None	1.49A	3hecA-3kflA: undetectable	3hecA-3kflA: 21.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L8L_C_DVAC6_0 (GRAMICIDIN D)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ALA A 695 VAL A 698 TRP A 596	None	0.74A	3l8lC-3kflA: undetectable 3l8lD-3kflA: undetectable	3l8lC-3kflA: 4.38 3l8lD-3kflA: 3.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3REQ_A_ADNA801_1 (METHYLMALONYL-COA MUTASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 4	TYR A 602 TYR A 668 GLU A 672 GLY A 712	None	1.15A	3reqA-3kflA: 2.5	3reqA-3kflA: 22.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UZZ_B_ASDB501_1 (3-OXO-5-BETA-STEROID 4-DEHYDROGENASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 8	TYR A 450 HIS A 306 TRP A 495 LEU A 444	ME8 A 801 (-4.7A) None None None	1.38A	3uzzB-3kflA: undetectable	3uzzB-3kflA: 21.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FN9_B_STRB301_1 (STEROID RECEPTOR 2)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	LEU A 570 ASN A 571 LEU A 574 ALA A 575 THR A 734	None	1.21A	4fn9B-3kflA: undetectable	4fn9B-3kflA: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FOX_C_D16C301_1 (THYMIDYLATE SYNTHASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 11	HIS A 364 SER A 335 GLU A 337 LEU A 416 LEU A 340	EDO A 811 (-4.4A) POP A 802 ( 4.2A) None EDO A 814 ( 4.4A) None	1.47A	4foxC-3kflA: undetectable	4foxC-3kflA: 20.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IG1_A_ACTA504_0 (FAD:PROTEIN FMN TRANSFERASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 5	SER A 512 ARG A 401 LEU A 488 ASP A 486	None None EDO A 815 (-4.5A) ME8 A 801 ( 2.6A)	1.32A	4ig1A-3kflA: undetectable	4ig1A-3kflA: 21.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4V2Z_B_Y70B151_1 (CEREBLON ISOFORM 4)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 8	PRO A 699 MET A 693 TRP A 596 TYR A 668	None	1.23A	4v2zB-3kflA: undetectable	4v2zB-3kflA: 13.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4V30_B_LVYB151_1 (CEREBLON ISOFORM 4)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 8	PRO A 699 MET A 693 TRP A 596 TYR A 668	None	1.26A	4v30B-3kflA: undetectable	4v30B-3kflA: 13.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 6	ALA A 635 ARG A 675 GLY A 673 GLU A 672	FMT A 823 ( 3.7A) None None None	0.95A	5btgA-3kflA: undetectable 5btgB-3kflA: undetectable 5btgC-3kflA: undetectable	5btgA-3kflA: 21.73 5btgB-3kflA: 19.85 5btgC-3kflA: 21.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HG0_B_SAMB301_0 (PANTOTHENATE SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 225 GLY A 227 HIS A 228 VAL A 442 ASP A 486	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) None ME8 A 801 ( 2.6A)	0.96A	5hg0B-3kflA: 7.5	5hg0B-3kflA: 19.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HG0_B_SAMB301_0 (PANTOTHENATE SYNTHETASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	HIS A 225 GLY A 227 HIS A 228 VAL A 442 GLY A 484	POP A 802 ( 4.0A) ME8 A 801 (-3.4A) POP A 802 ( 3.8A) None ME8 A 801 (-3.2A)	0.67A	5hg0B-3kflA: 7.5	5hg0B-3kflA: 19.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HWA_A_GCSA302_1 (CHITOSANASE)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	4 / 7	THR A 301 ASP A 256 ASP A 445 GLY A 259	None ME8 A 801 (-3.7A) None None	0.78A	5hwaA-3kflA: undetectable	5hwaA-3kflA: 18.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C06_D_FI8D1404_1 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA')	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	3 / 3	ARG A 300 LYS A 285 ARG A 243	EDO A 817 ( 4.0A) EDO A 817 (-4.1A) EDO A 813 (-4.0A)	1.35A	6c06D-3kflA: 2.1	6c06D-3kflA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6J20_A_GBQA1201_0 (SUBSTANCE-P RECEPTOR,ENDOLYSIN)	3kfl	METHIONYL-TRNA SYNTHETASE (Leishmania major)	5 / 12	ASN A 221 ILE A 487 TYR A 450 THR A 253 PHE A 284	POP A 802 (-3.3A) ME8 A 801 (-4.0A) ME8 A 801 (-4.7A) None None	1.46A	6j20A-3kflA: undetectable	6j20A-3kflA: 20.58

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1AV2_C_DVAC6_0","GRAMICIDIN A","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ALA A 695;VAL A 698;TRP A 596","None","0.86A","1av2C-3kflA:undetectable;1av2D-3kflA:undetectable","1av2C-3kflA:4.38;1av2D-3kflA:4.38"],["1FFY_A_MRCA1993_1","ISOLEUCYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 225;GLY A 227;GLY A 484;ASP A 486;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.6A)","0.80A","1ffyA-3kflA:21.6","1ffyA-3kflA:21.82"],["1FFY_A_MRCA1993_1","ISOLEUCYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 228;GLY A 227;GLY A 484;ASP A 486;HIS A 513","POP A 802 ( 3.8A);ME8 A 801 (-3.4A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.6A)","1.05A","1ffyA-3kflA:21.6","1ffyA-3kflA:21.82"],["1IWH_A_PEMA501_1","HEMOGLOBIN ALPHA CHAIN","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"LYS A 690;ASP A 694;ALA A 695;LEU A 723","None;EDO A 816 (-4.4A);None;None","0.39A","1iwhA-3kflA:undetectable","1iwhA-3kflA:13.83"],["1NT2_A_SAMA301_1","FIBRILLARIN-LIKE PRE-RRNA PROCESSING PROTEIN","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"THR A 367;GLU A 337;ASP A 445","None","0.86A","1nt2A-3kflA:2.7","1nt2A-3kflA:18.37"],["1NT5_A_DVAA6_0","GRAMICIDIN A","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ALA A 695;VAL A 698;TRP A 596","None","0.78A","1nt5A-3kflA:undetectable","1nt5A-3kflA:4.25"],["1NT5_B_DVAB6_0","GRAMICIDIN A","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ALA A 695;VAL A 698;TRP A 596","None","0.78A","1nt5B-3kflA:undetectable","1nt5B-3kflA:4.25"],["1PG2_A_ADNA552_1","METHIONYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",7,"HIS A 225;GLY A 227;HIS A 228;GLY A 484;ASP A 486;ILE A 487;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.0A);ME8 A 801 (-4.6A)","0.66A","1pg2A-3kflA:35.5","1pg2A-3kflA:26.93"],["1QU2_A_MRCA1993_1","ISOLEUCYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",6,"HIS A 225;GLY A 227;HIS A 228;GLY A 484;ASP A 486;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.6A)","0.83A","1qu2A-3kflA:21.7","1qu2A-3kflA:21.82"],["1QU2_A_MRCA1993_1","ISOLEUCYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 228;GLY A 227;GLY A 484;ASP A 486;HIS A 513","POP A 802 ( 3.8A);ME8 A 801 (-3.4A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.6A)","1.05A","1qu2A-3kflA:21.7","1qu2A-3kflA:21.82"],["1QU3_A_MRCA993_1","ISOLEUCYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 225;GLY A 227;HIS A 228;ASP A 486;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.6A)","1.04A","1qu3A-3kflA:16.0","1qu3A-3kflA:21.82"],["1QZR_B_CDXB901_1","DNA TOPOISOMERASE II;DNA TOPOISOMERASE II","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"HIS A 470;TYR A 451;ASN A 449;LEU A 309","None;None;ME8 A 801 (-4.6A);None","1.13A","1qzrA-3kflA:undetectable","1qzrA-3kflA:21.84"],["1W5U_C_DVAC6_0","GRAMICIDIN D","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ALA A 695;VAL A 698;TRP A 596","None","0.82A","1w5uC-3kflA:undetectable;1w5uD-3kflA:undetectable","1w5uC-3kflA:4.38;1w5uD-3kflA:4.38"],["2G72_B_SAMB2002_0","PHENYLETHANOLAMINE N-METHYLTRANSFERASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"GLN A 682;PHE A 711;LEU A 613;ILE A 713;VAL A 714","None","1.30A","2g72B-3kflA:2.2","2g72B-3kflA:18.86"],["2HRC_B_CHDB1603_0","FERROCHELATASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"MET A 500;ARG A 382;LEU A 413;PRO A 507","None;None;FMT A 822 (-4.5A);None","1.37A","2hrcB-3kflA:0.0","2hrcB-3kflA:19.97"],["2IZQ_B_DVAB6_0","GRAMICIDIN D","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"TRP A 596;ALA A 695;VAL A 698","None","0.83A","2izqA-3kflA:undetectable;2izqB-3kflA:undetectable","2izqA-3kflA:4.38;2izqB-3kflA:4.38"],["2QEO_A_LNRA200_1","D7R4 PROTEIN","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"TYR A 218;HIS A 491;ILE A 487;VAL A 483;MET A 295","ME8 A 801 (-4.7A);ME8 A 801 (-4.6A);ME8 A 801 (-4.0A);None;None","1.00A","2qeoA-3kflA:undetectable","2qeoA-3kflA:13.72"],["2VL2_B_BEZB1162_0","PEROXIREDOXIN-5","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"THR A 215;PRO A 216;PHE A 288;THR A 255","None;ME8 A 801 (-4.4A);None;None","0.98A","2vl2B-3kflA:3.4","2vl2B-3kflA:17.22"],["2X1L_A_ADNA601_1","METHIONYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",7,"HIS A 225;GLY A 227;HIS A 228;GLY A 484;ASP A 486;ILE A 487;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.0A);ME8 A 801 (-4.6A)","0.52A","2x1lA-3kflA:45.3","2x1lA-3kflA:41.61"],["2X1L_B_ADNB601_1","METHIONYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",7,"HIS A 225;GLY A 227;HIS A 228;GLY A 484;ASP A 486;ILE A 487;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.0A);ME8 A 801 (-4.6A)","0.50A","2x1lB-3kflA:43.3","2x1lB-3kflA:41.61"],["2X1L_C_ADNC601_1","METHIONYL-TRNA SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",7,"HIS A 225;GLY A 227;HIS A 228;GLY A 484;ASP A 486;ILE A 487;HIS A 513","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);ME8 A 801 (-3.2A);ME8 A 801 ( 2.6A);ME8 A 801 (-4.0A);ME8 A 801 (-4.6A)","0.50A","2x1lC-3kflA:43.0","2x1lC-3kflA:41.61"],["3ADX_A_IMNA2_2","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"ILE A 713;ILE A 692;LEU A 710;PHE A 711;LEU A 643","None","1.30A","3adxA-3kflA:undetectable","3adxA-3kflA:20.18"],["3HEC_A_STIA1_2","MITOGEN-ACTIVATED PROTEIN KINASE 14","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"LEU A 574;MET A 693;ILE A 629;ASP A 236","None","1.49A","3hecA-3kflA:undetectable","3hecA-3kflA:21.34"],["3L8L_C_DVAC6_0","GRAMICIDIN D","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ALA A 695;VAL A 698;TRP A 596","None","0.74A","3l8lC-3kflA:undetectable;3l8lD-3kflA:undetectable","3l8lC-3kflA:4.38;3l8lD-3kflA:3.70"],["3REQ_A_ADNA801_1","METHYLMALONYL-COA MUTASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"TYR A 602;TYR A 668;GLU A 672;GLY A 712","None","1.15A","3reqA-3kflA:2.5","3reqA-3kflA:22.31"],["3UZZ_B_ASDB501_1","3-OXO-5-BETA-STEROID 4-DEHYDROGENASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"TYR A 450;HIS A 306;TRP A 495;LEU A 444","ME8 A 801 (-4.7A);None;None;None","1.38A","3uzzB-3kflA:undetectable","3uzzB-3kflA:21.55"],["4FN9_B_STRB301_1","STEROID RECEPTOR 2","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"LEU A 570;ASN A 571;LEU A 574;ALA A 575;THR A 734","None","1.21A","4fn9B-3kflA:undetectable","4fn9B-3kflA:16.67"],["4FOX_C_D16C301_1","THYMIDYLATE SYNTHASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 364;SER A 335;GLU A 337;LEU A 416;LEU A 340","EDO A 811 (-4.4A);POP A 802 ( 4.2A);None;EDO A 814 ( 4.4A);None","1.47A","4foxC-3kflA:undetectable","4foxC-3kflA:20.42"],["4IG1_A_ACTA504_0","FAD:PROTEIN FMN TRANSFERASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"SER A 512;ARG A 401;LEU A 488;ASP A 486","None;None;EDO A 815 (-4.5A);ME8 A 801 ( 2.6A)","1.32A","4ig1A-3kflA:undetectable","4ig1A-3kflA:21.95"],["4V2Z_B_Y70B151_1","CEREBLON ISOFORM 4","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"PRO A 699;MET A 693;TRP A 596;TYR A 668","None","1.23A","4v2zB-3kflA:undetectable","4v2zB-3kflA:13.54"],["4V30_B_LVYB151_1","CEREBLON ISOFORM 4","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"PRO A 699;MET A 693;TRP A 596;TYR A 668","None","1.26A","4v30B-3kflA:undetectable","4v30B-3kflA:13.54"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"ALA A 635;ARG A 675;GLY A 673;GLU A 672","FMT A 823 ( 3.7A);None;None;None","0.95A","5btgA-3kflA:undetectable;5btgB-3kflA:undetectable;5btgC-3kflA:undetectable","5btgA-3kflA:21.73;5btgB-3kflA:19.85;5btgC-3kflA:21.73"],["5HG0_B_SAMB301_0","PANTOTHENATE SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 225;GLY A 227;HIS A 228;VAL A 442;ASP A 486","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);None;ME8 A 801 ( 2.6A)","0.96A","5hg0B-3kflA:7.5","5hg0B-3kflA:19.65"],["5HG0_B_SAMB301_0","PANTOTHENATE SYNTHETASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"HIS A 225;GLY A 227;HIS A 228;VAL A 442;GLY A 484","POP A 802 ( 4.0A);ME8 A 801 (-3.4A);POP A 802 ( 3.8A);None;ME8 A 801 (-3.2A)","0.67A","5hg0B-3kflA:7.5","5hg0B-3kflA:19.65"],["5HWA_A_GCSA302_1","CHITOSANASE","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",4,"THR A 301;ASP A 256;ASP A 445;GLY A 259","None;ME8 A 801 (-3.7A);None;None","0.78A","5hwaA-3kflA:undetectable","5hwaA-3kflA:18.48"],["6C06_D_FI8D1404_1","DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA'","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",3,"ARG A 300;LYS A 285;ARG A 243","EDO A 817 ( 4.0A);EDO A 817 (-4.1A);EDO A 813 (-4.0A)","1.35A","6c06D-3kflA:2.1","6c06D-3kflA:undetectable"],["6J20_A_GBQA1201_0","SUBSTANCE-P RECEPTOR,ENDOLYSIN","3kfl","METHIONYL-TRNA SYNTHETASE","Leishmania major",5,"ASN A 221;ILE A 487;TYR A 450;THR A 253;PHE A 284","POP A 802 (-3.3A);ME8 A 801 (-4.0A);ME8 A 801 (-4.7A);None;None","1.46A","6j20A-3kflA:undetectable","6j20A-3kflA:20.58"]]