SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3o8l'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D4Y_A_TPVA501_2 (PROTEIN (HIV-1 PROTEASE))	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 8	LEU A 711 ILE A 425 VAL A 523 ILE A 525	None	0.71A	1d4yB-3o8lA: undetectable	1d4yB-3o8lA: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7B_B_HLTB4003_1 (SERUM ALBUMIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 6	VAL A 159 GLY A 160 ALA A 320 LEU A 324	None	0.77A	1e7bB-3o8lA: undetectable	1e7bB-3o8lA: 20.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FDU_C_ESTC353_1 (17-BETA-HYDROXYSTERO ID DEHYDROGENASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 468 LEU A 467 GLY A 442 TYR A 455 VAL A 423	None	1.17A	1fduC-3o8lA: 4.2	1fduC-3o8lA: 19.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MUI_B_AB1B100_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.08A	1muiB-3o8lA: undetectable	1muiB-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NW5_A_SAMA401_0 (MODIFICATION METHYLASE RSRI)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	PHE A 675 SER A 222 VAL A 218 ALA A 418 ALA A 417	None	1.08A	1nw5A-3o8lA: undetectable	1nw5A-3o8lA: 17.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NW5_A_SAMA401_0 (MODIFICATION METHYLASE RSRI)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	THR A 669 PHE A 675 SER A 222 VAL A 218 ALA A 418	None	1.05A	1nw5A-3o8lA: undetectable	1nw5A-3o8lA: 17.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OHR_A_1UNA201_1 (ASPARTYLPROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.86A	1ohrA-3o8lA: undetectable	1ohrA-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_B_FUAB703_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.13A	1q23B-3o8lA: undetectable	1q23B-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_C_FUAC701_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.15A	1q23C-3o8lA: undetectable	1q23C-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_E_FUAE706_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.12A	1q23E-3o8lA: undetectable	1q23E-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_F_FUAF704_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.12A	1q23F-3o8lA: undetectable	1q23F-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_H_FUAH709_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.13A	1q23H-3o8lA: undetectable 1q23I-3o8lA: undetectable	1q23H-3o8lA: 15.81 1q23I-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_I_FUAI707_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.16A	1q23I-3o8lA: undetectable	1q23I-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_J_FUAJ711_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.11A	1q23J-3o8lA: undetectable	1q23J-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_K_FUAK712_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.16A	1q23K-3o8lA: undetectable	1q23K-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_L_FUAL710_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.13A	1q23L-3o8lA: undetectable	1q23L-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1R9O_A_FLPA501_1 (CYTOCHROME P450 2C9)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ARG A 310 ASN A 547 LEU A 546 ASP A 554 LEU A 626	None	0.93A	1r9oA-3o8lA: undetectable	1r9oA-3o8lA: 19.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RUK_H_BEZH601_0 (IMMUNOGLOBULIN IGG2A, HEAVY CHAIN IMMUNOGLOBULIN IGG2A, LIGHT CHAIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 8	ALA A 125 LEU A 122 GLY A 120 GLY A  24	None None ATP  A 763 (-2.9A) ATP  A 763 (-3.3A)	0.85A	1rukH-3o8lA: undetectable 1rukL-3o8lA: undetectable	1rukH-3o8lA: 16.22 1rukL-3o8lA: 14.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SDT_B_MK1B902_2 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	0.95A	1sdtB-3o8lA: undetectable	1sdtB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SDT_B_MK1B902_2 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.76A	1sdtB-3o8lA: undetectable	1sdtB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SDU_B_MK1B902_2 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	1.06A	1sduB-3o8lA: undetectable	1sduB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Y7I_A_SALA501_1 (SALICYLIC ACID-BINDING PROTEIN 2)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	GLY A  54 SER A  23 LEU A  21 PHE A  92 LEU A 113	None ATP  A 763 (-3.2A) None None None	1.44A	1y7iA-3o8lA: 2.8	1y7iA-3o8lA: 16.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AQU_B_DR7B300_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	0.99A	2aquA-3o8lA: undetectable	2aquA-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AQU_B_DR7B300_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.81A	2aquA-3o8lA: undetectable	2aquA-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AQU_B_DR7B300_2 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 11	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.03A	2aquB-3o8lA: undetectable	2aquB-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AVO_B_MK1B902_2 (POL POLYPROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.82A	2avoB-3o8lA: undetectable	2avoB-3o8lA: 8.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AVV_A_MK1A901_3 (POL POLYPROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.03A	2avvB-3o8lA: undetectable	2avvB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F81_A_017A302_2 (POL POLYPROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.96A	2f81B-3o8lA: undetectable	2f81B-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FXE_A_DR7A102_1 (POL PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.05A	2fxeA-3o8lA: undetectable	2fxeA-3o8lA: 8.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2GLU_B_SAMB302_0 (YCGJ)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 414 THR A 544 THR A 528 ALA A 527 ARG A 420 ALA A 676	None None PO4  A 768 (-4.5A) None PO4  A 767 (-4.4A) None	1.31A	2gluB-3o8lA: undetectable	2gluB-3o8lA: 14.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2H79_A_T3A1_1 (THRA PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ILE A 260 ILE A 259 ALA A 225 ALA A 216 LEU A 296	None	1.01A	2h79A-3o8lA: undetectable	2h79A-3o8lA: 15.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IEN_B_017B402_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.98A	2ienB-3o8lA: undetectable	2ienB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2O4K_A_DR7A301_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	LEU A  58 ALA A 125 GLY A 118 GLY A 117 ILE A 116	None None ATP  A 763 (-2.9A) ATP  A 763 ( 4.5A) None	0.96A	2o4kA-3o8lA: undetectable	2o4kA-3o8lA: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2O4L_A_TPVA403_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.87A	2o4lB-3o8lA: undetectable	2o4lB-3o8lA: 8.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OXT_C_SAMC300_1 (NUCLEOSIDE-2'-O-METH YLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 4	SER A 164 GLY A 163 HIS A 183 ASP A 672	None	1.33A	2oxtC-3o8lA: undetectable	2oxtC-3o8lA: 17.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PKK_A_2FAA501_1 (ADENOSINE KINASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 163 ALA A 181 GLN A  28 GLN A 300 GLY A  29 ASP A 309	None	1.47A	2pkkA-3o8lA: 3.9	2pkkA-3o8lA: 18.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PYM_A_1UNA1001_1 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.96A	2pymA-3o8lA: undetectable	2pymA-3o8lA: 9.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q5K_A_AB1A201_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	None	0.99A	2q5kA-3o8lA: undetectable	2q5kA-3o8lA: 9.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHC_B_AB1B9001_2 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	0.99A	2qhcB-3o8lA: undetectable	2qhcB-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHC_B_AB1B9001_2 (PROTEASE RETROPEPSIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.94A	2qhcB-3o8lA: undetectable	2qhcB-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHF_A_ACTA507_0 (CHORISMATE SYNTHASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	LEU A 434 ASN A 489 ARG A 432	None	0.95A	2qhfA-3o8lA: undetectable	2qhfA-3o8lA: 21.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R2V_D_ACTD37_0 (GCN4 LEUCINE ZIPPER)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	LYS A 466 ARG A 420 VAL A 419	None PO4  A 767 (-4.4A) None	0.67A	2r2vC-3o8lA: undetectable 2r2vD-3o8lA: undetectable	2r2vC-3o8lA: 3.78 2r2vD-3o8lA: 3.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5P_B_MK1B902_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.87A	2r5pB-3o8lA: undetectable	2r5pB-3o8lA: 8.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5P_D_MK1D902_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.87A	2r5pD-3o8lA: undetectable	2r5pD-3o8lA: 8.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5Q_B_1UNB900_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 11	GLY A 224 ALA A 225 ASP A 226 ILE A 260 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None None	1.38A	2r5qB-3o8lA: undetectable	2r5qB-3o8lA: 8.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VCV_D_ASDD1224_1 (GLUTATHIONE S-TRANSFERASE A3)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	LEU A 136 LEU A 156 LEU A 105 ALA A 101 PHE A 128	None	1.24A	2vcvD-3o8lA: undetectable	2vcvD-3o8lA: 15.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VCV_E_ASDE1224_1 (GLUTATHIONE S-TRANSFERASE A3)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	LEU A 136 LEU A 156 LEU A 105 ALA A 101 PHE A 128	None	1.22A	2vcvE-3o8lA: undetectable	2vcvE-3o8lA: 15.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VCV_H_ASDH1224_1 (GLUTATHIONE S-TRANSFERASE A3)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	LEU A 136 LEU A 156 LEU A 105 ALA A 101 PHE A 128	None	1.21A	2vcvH-3o8lA: undetectable	2vcvH-3o8lA: 15.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WA2_B_SAMB1267_0 (NON-STRUCTURAL PROTEIN 5)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A  61 LEU A  58 GLU A  53 ASP A  63 ILE A  65	None	0.94A	2wa2B-3o8lA: undetectable	2wa2B-3o8lA: 17.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Z54_A_AB1A200_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	1.04A	2z54A-3o8lA: undetectable	2z54A-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Z54_A_AB1A200_2 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.09A	2z54B-3o8lA: undetectable	2z54B-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3B9M_A_SALA1100_1 (SERUM ALBUMIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 4	LEU A 546 ARG A 746 LEU A 586 ALA A 581	None	1.15A	3b9mA-3o8lA: undetectable	3b9mA-3o8lA: 20.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BVB_B_017B401_2 (PROTEASE (RETROPEPSIN))	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.11A	3bvbB-3o8lA: undetectable	3bvbB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CL9_A_MTXA602_2 (BIFUNCTIONAL DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE (DHFR-TS))	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 4	VAL A  48 ARG A  35 ILE A 116 THR A  44	None PO4  A 766 (-4.4A) None None	1.22A	3cl9A-3o8lA: undetectable	3cl9A-3o8lA: 21.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CYX_A_ROCA201_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.98A	3cyxA-3o8lA: undetectable	3cyxA-3o8lA: 8.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3D20_A_017A201_2 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.95A	3d20B-3o8lA: undetectable	3d20B-3o8lA: 9.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3E22_B_LOCB700_2 (TUBULIN BETA-2B CHAIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	LEU A 324 ALA A 320 ALA A  46 VAL A  48 LYS A  16	None	1.31A	3e22B-3o8lA: undetectable	3e22B-3o8lA: 20.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKY_A_DR7A100_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.81A	3ekyA-3o8lA: undetectable	3ekyA-3o8lA: 9.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EL1_A_DR7A100_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.81A	3el1B-3o8lA: undetectable	3el1B-3o8lA: 9.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_A_DR7A100_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.80A	3em4A-3o8lA: undetectable	3em4A-3o8lA: 9.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_V_DR7V100_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.78A	3em4U-3o8lA: undetectable	3em4U-3o8lA: 9.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FPJ_B_SAMB301_1 (PUTATIVE UNCHARACTERIZED PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 7	GLY A 163 GLY A 118 THR A  22 ALA A  27	None ATP  A 763 (-2.9A) None None	0.78A	3fpjB-3o8lA: 2.0	3fpjB-3o8lA: 17.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3GCZ_A_SAMA4633_0 (POLYPROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	SER A 121 GLY A 117 GLY A  85 GLY A  54 GLY A  24	ATP  A 763 (-2.4A) ATP  A 763 ( 4.5A) None None ATP  A 763 (-3.3A)	0.89A	3gczA-3o8lA: undetectable	3gczA-3o8lA: 17.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3GWS_X_T3X500_1 (THYROID HORMONE RECEPTOR BETA)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ILE A 260 ILE A 259 ALA A 225 ALA A 216 LEU A 296	None	0.98A	3gwsX-3o8lA: undetectable	3gwsX-3o8lA: 17.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KKZ_B_SAMB302_0 (UNCHARACTERIZED PROTEIN Q5LES9)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 117 GLY A  29 LEU A 312 SER A 306 ALA A  27	ATP  A 763 ( 4.5A) None None None None	1.03A	3kkzB-3o8lA: undetectable	3kkzB-3o8lA: 15.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_G_PZIG800_0 (GLUTAMATE RECEPTOR 2)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 6	TYR A 635 ASN A 608 LEU A 605 ASP A 604	None	1.49A	3lslG-3o8lA: undetectable	3lslG-3o8lA: 16.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LZS_A_017A200_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.95A	3lzsA-3o8lA: undetectable	3lzsA-3o8lA: 9.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LZU_A_017A200_2 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.19A	3lzuB-3o8lA: undetectable	3lzuB-3o8lA: 9.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NDX_A_RITA100_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.82A	3ndxB-3o8lA: undetectable	3ndxB-3o8lA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NU6_B_478B401_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	GLY A 224 ALA A 225 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.90A	3nu6B-3o8lA: undetectable	3nu6B-3o8lA: 9.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PWM_B_017B402_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.90A	3pwmB-3o8lA: undetectable	3pwmB-3o8lA: 9.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TKG_B_ROCB801_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	0.98A	3tkgA-3o8lA: undetectable	3tkgA-3o8lA: 9.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TKG_C_ROCC901_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None	0.93A	3tkgC-3o8lA: undetectable	3tkgC-3o8lA: 9.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_B_CLMB221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.12A	3u9fB-3o8lA: undetectable 3u9fC-3o8lA: undetectable	3u9fB-3o8lA: 15.81 3u9fC-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_E_CLME221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.05A	3u9fE-3o8lA: undetectable	3u9fE-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_I_CLMI221_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.04A	3u9fI-3o8lA: undetectable	3u9fI-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_J_CLMJ221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.15A	3u9fJ-3o8lA: undetectable 3u9fK-3o8lA: undetectable	3u9fJ-3o8lA: 15.81 3u9fK-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_N_CLMN221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.02A	3u9fN-3o8lA: undetectable 3u9fO-3o8lA: undetectable	3u9fN-3o8lA: 15.81 3u9fO-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_P_CLMP221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.04A	3u9fP-3o8lA: undetectable	3u9fP-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_R_CLMR221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.06A	3u9fR-3o8lA: undetectable	3u9fR-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_S_CLMS221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	TYR A  55 LEU A 348 VAL A 335 PHE A 169 VAL A 352	ATP  A 763 (-4.5A) None None None None	1.10A	3u9fP-3o8lA: undetectable 3u9fS-3o8lA: undetectable	3u9fP-3o8lA: 15.81 3u9fS-3o8lA: 15.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UA5_B_06XB501_1 (CYTOCHROME P450 2B6)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 7	ILE A 259 GLU A 206 THR A 294 VAL A 279	None	0.81A	3ua5B-3o8lA: undetectable	3ua5B-3o8lA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UR0_C_SVRC516_1 (RNA-DEPENDENT RNA POLYMERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	PRO A 526 GLY A 497 ALA A 527 ALA A 413 ASP A 672	None	1.46A	3ur0C-3o8lA: undetectable	3ur0C-3o8lA: 19.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DQF_B_017B101_2 (ASPARTYL PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 10	GLY A 224 ALA A 225 ASP A 226 ILE A 192 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None None	1.04A	4dqfB-3o8lA: undetectable	4dqfB-3o8lA: 8.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EOH_A_TEPA402_1 (PYRIDOXAL KINASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 5	SER A 276 GLY A 278 VAL A 283 ASP A 281	None	1.04A	4eohA-3o8lA: 3.3	4eohA-3o8lA: 18.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HLA_A_017A200_1 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.95A	4hlaA-3o8lA: undetectable	4hlaA-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HLA_A_017A200_2 (PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 11	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.95A	4hlaB-3o8lA: undetectable	4hlaB-3o8lA: 9.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MM8_A_RFXA603_1 (TRANSPORTER)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	VAL A  34 GLY A 163 SER A 314 GLY A 317 THR A  22	None	1.09A	4mm8A-3o8lA: undetectable	4mm8A-3o8lA: 21.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N48_B_SAMB601_1 (CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-M ETHYLTRANSFERASE 1)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 5	ASN A  31 GLY A  80 ASP A 168 ASP A  26	None None ATP  A 763 ( 4.7A) None	1.15A	4n48B-3o8lA: undetectable	4n48B-3o8lA: 21.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N49_A_SAMA601_1 (CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-M ETHYLTRANSFERASE 1)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 4	ASN A  31 GLY A  80 ASP A 168 ASP A  26	None None ATP  A 763 ( 4.7A) None	1.18A	4n49A-3o8lA: undetectable	4n49A-3o8lA: 21.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q1X_A_017A101_2 (ASPARTYL PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	LEU A 711 ILE A 496 ILE A 425 VAL A 523 ILE A 525	None	0.80A	4q1xB-3o8lA: undetectable	4q1xB-3o8lA: 9.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R1Z_A_AERA601_1 (CYP17A1 PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	ALA A 542 ILE A 496 ASP A 672 GLY A 414 ALA A 413	None	1.25A	4r1zA-3o8lA: undetectable	4r1zA-3o8lA: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R1Z_A_AERA601_1 (CYP17A1 PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 9	ALA A 542 ILE A 525 ASP A 672 GLY A 414 ALA A 413	None	1.22A	4r1zA-3o8lA: undetectable	4r1zA-3o8lA: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XDT_A_ACTA409_0 (FAD:PROTEIN FMN TRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 5	ILE A 116 VAL A  20 ILE A  84 VAL A  34 THR A  82	None	1.48A	4xdtA-3o8lA: undetectable	4xdtA-3o8lA: 18.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XJ7_D_ADND303_1 (5'/3'-NUCLEOTIDASE SURE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	LEU A 586 LEU A 749 GLY A 585 ALA A  36 ILE A 748	None	1.12A	4xj7C-3o8lA: 4.9 4xj7D-3o8lA: 5.6	4xj7C-3o8lA: 17.52 4xj7D-3o8lA: 17.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 7	SER A 276 ASP A 290 ARG A 201 THR A 195	None	0.91A	5btaA-3o8lA: undetectable 5btaC-3o8lA: undetectable 5btaD-3o8lA: 2.3	5btaA-3o8lA: 23.09 5btaC-3o8lA: 23.09 5btaD-3o8lA: 16.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 7	SER A 276 ASP A 290 ARG A 201 THR A 195	None	0.83A	5btfA-3o8lA: undetectable 5btfB-3o8lA: 3.2 5btfC-3o8lA: undetectable	5btfA-3o8lA: 23.09 5btfB-3o8lA: 16.08 5btfC-3o8lA: 23.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EKX_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	SER A 121 GLY A 117 GLY A  85 GLY A  54 GLY A  24	ATP  A 763 (-2.4A) ATP  A 763 ( 4.5A) None None ATP  A 763 (-3.3A)	0.92A	5ekxA-3o8lA: undetectable	5ekxA-3o8lA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HFJ_G_SAMG301_0 (ADENINE SPECIFIC DNA METHYLTRANSFERASE (DPNA))	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ALA A 683 THR A 704 PHE A 720 GLY A 708 THR A 724	None	1.38A	5hfjG-3o8lA: undetectable	5hfjG-3o8lA: 15.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HFJ_H_SAMH301_0 (ADENINE SPECIFIC DNA METHYLTRANSFERASE (DPNA))	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ALA A 683 THR A 704 PHE A 720 GLY A 708 THR A 724	None	1.36A	5hfjH-3o8lA: 2.2	5hfjH-3o8lA: 15.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I1O_H_DVAH9_0 (D-VILLIN HEADPIECE SUBDOMAIN VILLIN-1)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	ALA A 101 ASN A 104 LEU A 105	None	0.48A	5i1oA-3o8lA: undetectable	5i1oA-3o8lA: 5.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KOC_A_SAMA401_0 (PAVINE N-METHYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 660 VAL A 529 THR A 528 ALA A 581 LEU A 580	None None PO4  A 768 (-4.5A) None None	1.06A	5kocA-3o8lA: undetectable	5kocA-3o8lA: 18.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KQX_A_ROCA101_1 (PROTEASE E35D-SQV)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	GLY A 224 ALA A 225 ASP A 226 VAL A 207 ILE A 261	PO4  A 767 ( 4.6A) None None None None	0.88A	5kqxA-3o8lA: undetectable	5kqxA-3o8lA: 8.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KR1_B_017B101_1 (PROTEASE PR5-DRV)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	LEU A 711 ALA A 676 ILE A 425 VAL A 523 ILE A 525	None	0.82A	5kr1A-3o8lA: undetectable	5kr1A-3o8lA: 9.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ILE A  18 VAL A 159 ILE A  42 ALA A  46 VAL A  38	None	1.13A	5n0sB-3o8lA: 4.2	5n0sB-3o8lA: 21.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	VAL A 159 VAL A 115 ILE A  42 ALA A  46 VAL A  38	None	1.17A	5n0sB-3o8lA: 4.2	5n0sB-3o8lA: 21.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5V5Z_A_1YNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	ILE A 496 PHE A 671 GLY A 680 LEU A 718 PHE A 538	None ADP  A 764 (-3.8A) None None ADP  A 764 (-4.0A)	1.35A	5v5zA-3o8lA: undetectable	5v5zA-3o8lA: 21.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VCV_A_1N1A404_2 (MEMBRANE-ASSOCIATED TYROSINE- AND THREONINE-SPECIFIC CDC2-INHIBITORY KINASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 5	VAL A 204 LEU A 247 CYH A 244 ASP A 281	None	1.23A	5vcvA-3o8lA: undetectable	5vcvA-3o8lA: 18.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WBV_A_SAMA402_1 (HISTONE-LYSINE N-METHYLTRANSFERASE KMT5B)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	HIS A 734 GLU A 597 ASN A 628	None	1.00A	5wbvA-3o8lA: undetectable	5wbvA-3o8lA: 16.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WBV_B_SAMB402_1 (HISTONE-LYSINE N-METHYLTRANSFERASE KMT5B)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	HIS A 734 GLU A 597 ASN A 628	None	0.99A	5wbvB-3o8lA: undetectable	5wbvB-3o8lA: 16.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X6Y_B_SAMB901_0 (MRNA CAPPING ENZYME P5)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 10	VAL A 115 GLY A 160 ALA A 125 LEU A 113 ASN A 157	None	1.17A	5x6yB-3o8lA: undetectable	5x6yB-3o8lA: 22.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BPL_B_PA1B605_1 (LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	3 / 3	ARG A 424 ARG A 246 ARG A 253	PO4  A 767 (-2.9A) ATP  A 765 (-3.6A) None	0.81A	6bplA-3o8lA: undetectable 6bplB-3o8lA: undetectable	6bplA-3o8lA: 7.16 6bplB-3o8lA: 7.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DJ1_B_AB1B201_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 260 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None None	1.22A	6dj1B-3o8lA: undetectable	6dj1B-3o8lA: 8.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DJ2_B_AB1B201_1 (HIV-1 PROTEASE)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	6 / 12	GLY A 224 ALA A 225 ASP A 226 ILE A 260 ILE A 192 VAL A 207	PO4  A 767 ( 4.6A) None None None None None	1.21A	6dj2B-3o8lA: undetectable	6dj2B-3o8lA: 8.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HD6_A_STIA603_1 (TYROSINE-PROTEIN KINASE ABL1)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	4 / 5	LEU A 711 ILE A 485 MET A 684 GLY A 680	None	0.89A	6hd6A-3o8lA: undetectable	6hd6A-3o8lA: 7.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6IE8_A_CHDA201_0 (REGULATORY PROTEIN)	3o8l	6-PHOSPHOFRUCTOKINAS E, MUSCLE TYPE (Oryctolagus cuniculus)	5 / 12	THR A 582 ILE A 595 TYR A 594 ALA A 607 LEU A 749	None	1.28A	6ie8A-3o8lA: undetectable	6ie8A-3o8lA: 12.40