SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3oep'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ETA_1_T441128_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	1.03A	1eta1-3oepA: undetectable	1eta1-3oepA: 14.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ETA_2_T442129_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	1.07A	1eta2-3oepA: undetectable	1eta2-3oepA: 14.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ETB_1_T441128_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	1.02A	1etb1-3oepA: undetectable	1etb1-3oepA: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FDU_B_ESTB354_1 (17-BETA-HYDROXYSTERO ID DEHYDROGENASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 8	VAL A 225 LEU A 223 PRO A 281 VAL A 336	None	0.98A	1fduB-3oepA: undetectable	1fduB-3oepA: 25.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_A_BEZA1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 10	PRO A 121 GLY A 122 LEU A 346 PHE A 345 GLY A 242	None	1.27A	1h4oA-3oepA: undetectable 1h4oB-3oepA: undetectable	1h4oA-3oepA: 17.38 1h4oB-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_A_BEZA1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 10	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.31A	1h4oA-3oepA: undetectable 1h4oB-3oepA: undetectable	1h4oA-3oepA: 17.38 1h4oB-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_D_BEZD1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.36A	1h4oD-3oepA: undetectable	1h4oD-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_F_BEZF1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.35A	1h4oF-3oepA: undetectable	1h4oF-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_G_BEZG1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 8	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.30A	1h4oG-3oepA: undetectable	1h4oG-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1H4O_H_BEZH1162_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.35A	1h4oH-3oepA: undetectable	1h4oH-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HD2_A_BEZA201_0 (PEROXIREDOXIN 5 RESIDUES 54-214)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.31A	1hd2A-3oepA: undetectable	1hd2A-3oepA: 17.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICT_C_T44C128_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 11	ALA A 291 LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	1.23A	1ictA-3oepA: undetectable 1ictC-3oepA: undetectable	1ictA-3oepA: 13.32 1ictC-3oepA: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IE4_A_T44A128_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 10	ALA A 291 LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	1.10A	1ie4A-3oepA: undetectable 1ie4C-3oepA: undetectable	1ie4A-3oepA: 13.96 1ie4C-3oepA: 13.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IE4_A_T44A128_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 10	LEU A 321 GLU A 303 ALA A 285 LEU A 283 ALA A 291	None	0.99A	1ie4A-3oepA: undetectable 1ie4C-3oepA: undetectable	1ie4A-3oepA: 13.96 1ie4C-3oepA: 13.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JGS_A_SALA256_1 (MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN MARR)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	VAL A 366 LEU A 286 THR A 284 LEU A 283	None	0.77A	1jgsA-3oepA: undetectable	1jgsA-3oepA: 13.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MXG_A_ACRA442_1 (ALPHA AMYLASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 11	GLY A 243 PHE A 187 GLY A 118 GLY A 355 ASP A 352	None	1.11A	1mxgA-3oepA: undetectable	1mxgA-3oepA: 21.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_D_AG2D7015_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	LEU A 425 LEU A 392 LEU A 457 GLY A 422	None	0.80A	1n13D-3oepA: undetectable 1n13E-3oepA: undetectable	1n13D-3oepA: 10.85 1n13E-3oepA: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OC3_B_BEZB201_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.36A	1oc3B-3oepA: undetectable	1oc3B-3oepA: 17.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SN0_B_T44B602_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	LEU A 321 GLU A 303 ALA A 285 ALA A 291	None	0.85A	1sn0B-3oepA: undetectable 1sn0D-3oepA: undetectable	1sn0B-3oepA: 13.44 1sn0D-3oepA: 13.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SN5_C_T3C601_1 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	0.98A	1sn5A-3oepA: undetectable	1sn5A-3oepA: 13.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SN5_C_T3C601_2 (TRANSTHYRETIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 8	LEU A 321 GLU A 303 ALA A 285 LEU A 283	None	0.98A	1sn5C-3oepA: undetectable	1sn5C-3oepA: 13.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1URM_A_BEZA201_0 (PEROXIREDOXIN 5)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 9	PRO A 186 PRO A 121 GLY A 122 LEU A 346 PHE A 345	None	1.32A	1urmA-3oepA: undetectable	1urmA-3oepA: 17.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XP0_A_VDNA201_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 10	LEU A 321 ALA A 285 ALA A 337 LEU A 264 PHE A 313	None None GOL A 500 ( 3.8A) None None	1.15A	1xp0A-3oepA: undetectable	1xp0A-3oepA: 21.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DDW_B_PXLB1005_1 (PYRIDOXINE KINASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	THR A 204 PRO A 205 HIS A 148 GLY A 172	None	1.02A	2ddwB-3oepA: undetectable	2ddwB-3oepA: 21.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJF_B_ADNB2002_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	ARG A 30 ASN A 18 PRO A 41 ALA A 21	None	1.36A	2ejfB-3oepA: undetectable	2ejfB-3oepA: 20.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRE_D_CHDD702_0 (FERROCHELATASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	ARG A 19 GLY A 192 PRO A 191	None	0.77A	2hreD-3oepA: undetectable	2hreD-3oepA: 21.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRE_D_CHDD702_0 (FERROCHELATASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	ARG A 414 GLY A 427 PRO A 428	GOL A 502 (-3.5A) None None	0.59A	2hreD-3oepA: undetectable	2hreD-3oepA: 21.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HS1_B_017B203_1 (HIV-1 PROTEASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	GLU A 370 PRO A 374 ARG A 373 GLY A 339	None GOL A 500 ( 4.7A) None None	0.98A	2hs1B-3oepA: undetectable	2hs1B-3oepA: 10.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QMZ_B_LDPB502_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	GLN A 156 PHE A 125 PHE A 123 GLY A 167	None GOL A 501 (-4.8A) None GOL A 501 ( 4.9A)	1.33A	2qmzA-3oepA: undetectable 2qmzB-3oepA: undetectable	2qmzA-3oepA: 18.48 2qmzB-3oepA: 18.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QWX_B_ML1B233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	GLY A 166 GLY A 465 PHE A 125 PHE A 123	GOL A 501 (-3.2A) None GOL A 501 (-4.8A) None	0.78A	2qwxA-3oepA: undetectable 2qwxB-3oepA: undetectable	2qwxA-3oepA: 18.69 2qwxB-3oepA: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2UZ2_A_ACTA1123_0 (XENAVIDIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	LEU A 133 TYR A 112 THR A 157 VAL A 152	None	0.99A	2uz2A-3oepA: undetectable	2uz2A-3oepA: 11.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X8O_A_OINA1314_1 (CHOLINE-BINDING PROTEIN F)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	ASP A 254 ARG A 331 TYR A 333 GLU A 275	None	1.19A	2x8oA-3oepA: undetectable	2x8oA-3oepA: 20.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZD1_A_T27A557_1 (REVERSE TRANSCRIPTASE/RIBONU CLEASE H)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	LEU A 22 VAL A 45 TYR A 115 TYR A 43 PRO A 439	None	1.49A	2zd1A-3oepA: 4.0	2zd1A-3oepA: 21.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZXW_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1 CYTOCHROME C OXIDASE SUBUNIT 1)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	ILE A 489 LEU A 392 PHE A 491 ARG A 452	None	0.97A	2zxwN-3oepA: undetectable 2zxwW-3oepA: undetectable	2zxwN-3oepA: 21.17 2zxwW-3oepA: 7.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AV6_A_SAMA1_0 (DNA (CYTOSINE-5)-METHYLT RANSFERASE 1)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	GLY A 158 LEU A 98 ASN A 169 ALA A 151 VAL A 150	None	1.07A	3av6A-3oepA: undetectable	3av6A-3oepA: 17.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3B9M_A_SALA1100_1 (SERUM ALBUMIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 4	LEU A 46 ARG A 30 LEU A 29 ALA A 23	None	1.10A	3b9mA-3oepA: undetectable	3b9mA-3oepA: 21.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_D_DVAD10_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	GLY A 118 GLY A 243 GLY A 246	None	0.40A	3bogD-3oepA: undetectable	3bogD-3oepA: 11.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G2O_A_SAMA500_1 (PCZA361.24)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	ARG A 259 GLU A 275 ASP A 419	None	0.68A	3g2oA-3oepA: undetectable	3g2oA-3oepA: 21.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KK6_B_CELB1701_1 (PROSTAGLANDIN G/H SYNTHASE 1)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	VAL A 114 LEU A 126 LEU A 117 PHE A 197 ILE A 80	None	1.27A	3kk6B-3oepA: undetectable	3kk6B-3oepA: 22.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LOQ_A_ACTA277_0 (UNIVERSAL STRESS PROTEIN)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	ASP A 254 SER A 257 ARG A 384	None	0.52A	3loqA-3oepA: undetectable	3loqA-3oepA: 20.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3M6W_A_SAMA465_0 (RRNA METHYLASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	GLY A 318 VAL A 225 PRO A 281 VAL A 234 LEU A 274	None	1.02A	3m6wA-3oepA: undetectable	3m6wA-3oepA: 27.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SXJ_A_SAMA258_0 (PUTATIVE METHYLTRANSFERASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	ARG A 384 GLN A 383 GLY A 295 LEU A 334 ALA A 258	None	1.19A	3sxjA-3oepA: undetectable	3sxjA-3oepA: 17.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SXJ_B_SAMB258_0 (PUTATIVE METHYLTRANSFERASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	ARG A 384 GLN A 383 GLY A 295 LEU A 334 ALA A 258	None	1.19A	3sxjB-3oepA: undetectable	3sxjB-3oepA: 17.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5K_C_08JC3_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 8	VAL A 445 LEU A 408 LEU A 394 ILE A 489	None	0.91A	3u5kC-3oepA: undetectable	3u5kC-3oepA: 12.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5K_D_08JD4_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 8	VAL A 445 LEU A 408 LEU A 394 ILE A 489	None	0.86A	3u5kD-3oepA: undetectable	3u5kD-3oepA: 12.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UCB_B_017B202_1 (PROTEASE)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 7	PRO A 308 ARG A 326 GLY A 327 PRO A 328	None	1.30A	3ucbB-3oepA: undetectable	3ucbB-3oepA: 12.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VW7_A_VPXA2001_2 (PROTEINASE-ACTIVATED RECEPTOR 1, LYSOZYME)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 4	PRO A 33 LEU A 241 HIS A 244 LEU A 117	None	1.42A	3vw7A-3oepA: undetectable	3vw7A-3oepA: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A9J_A_TYLA1188_1 (BROMODOMAIN CONTAINING 2)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	VAL A 445 LEU A 408 LEU A 394 ILE A 489	None	0.95A	4a9jA-3oepA: undetectable	4a9jA-3oepA: 12.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A9J_B_TYLB1187_1 (BROMODOMAIN CONTAINING 2)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	VAL A 445 LEU A 408 LEU A 394 ILE A 489	None	0.92A	4a9jB-3oepA: undetectable	4a9jB-3oepA: 12.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KFB_A_T27A607_1 (REVERSE TRANSCRIPTASE/RIBONU CLEASE H, EXORIBONUCLEA P66 RT)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	LEU A 22 VAL A 45 TYR A 115 TYR A 43 PRO A 439	None	1.50A	4kfbA-3oepA: 4.5	4kfbA-3oepA: 21.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MM4_A_8PRA603_1 (TRANSPORTER)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	ALA A 335 TYR A 333 PHE A 298 PHE A 293 SER A 257	None	1.22A	4mm4A-3oepA: undetectable	4mm4A-3oepA: 23.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MM4_B_8PRB603_1 (TRANSPORTER)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	ALA A 335 TYR A 333 PHE A 298 PHE A 293 SER A 257	None	1.21A	4mm4B-3oepA: undetectable	4mm4B-3oepA: 23.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z3O_F_MFXF101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE E-SITE DNA)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	ARG A 420 ARG A 359 GLY A 358 GLU A 212	None	1.10A	4z3oA-3oepA: 5.5 4z3oB-3oepA: 5.5	4z3oA-3oepA: 20.37 4z3oB-3oepA: 20.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZB_E_ACTE403_0 (PROTON-GATED ION CHANNEL)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	3 / 3	ARG A 420 TYR A 333 GLU A 275	None	0.68A	4zzbE-3oepA: undetectable	4zzbE-3oepA: 19.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	ARG A 359 GLY A 358 GLU A 212 ARG A 420	None	1.05A	5btaA-3oepA: 5.3 5btaB-3oepA: undetectable 5btaC-3oepA: 5.6	5btaA-3oepA: 23.37 5btaB-3oepA: 20.53 5btaC-3oepA: 23.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	ARG A 420 ARG A 359 GLY A 358 GLU A 212	None	1.03A	5btcA-3oepA: 5.4 5btcC-3oepA: 5.2 5btcD-3oepA: undetectable	5btcA-3oepA: 23.37 5btcC-3oepA: 23.37 5btcD-3oepA: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 6	ARG A 359 GLY A 358 GLU A 212 ARG A 420	None	1.03A	5btcA-3oepA: 5.3 5btcB-3oepA: undetectable 5btcC-3oepA: 5.2	5btcA-3oepA: 23.37 5btcB-3oepA: 20.53 5btcC-3oepA: 23.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JQ7_B_T0RB705_1 (ENVELOPE GLYCOPROTEIN 1,ENVELOPE GLYCOPROTEIN 1,ENVELOPE GLYCOPROTEIN 1 ENVELOPE GLYCOPROTEIN 2)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 7	VAL A 103 LEU A 133 GLU A 101 ALA A 102 LEU A 89	None	1.37A	5jq7A-3oepA: undetectable	5jq7A-3oepA: 19.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OG9_B_TESB502_1 (-)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	5 / 12	LEU A 361 LEU A 214 LEU A 283 PRO A 218 LEU A 286	None	1.16A	5og9B-3oepA: undetectable	5og9B-3oepA: 24.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5XV7_A_EMHA705_2 (SERINE-ARGININE (SR) PROTEIN KINASE 1)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 4	VAL A 366 LEU A 223 LEU A 283 ASP A 232	None	1.50A	5xv7A-3oepA: undetectable	5xv7A-3oepA: 9.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AK3_B_P2EB1201_1 (PROSTAGLANDIN E2 RECEPTOR EP3 SUBTYPE,SOLUBLE CYTOCHROME B562)	3oep	PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988 (Thermus thermophilus)	4 / 5	PRO A 281 VAL A 225 GLY A 358 VAL A 234	None	1.08A	6ak3B-3oepA: undetectable	6ak3B-3oepA: 9.73

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1ETA_1_T441128_1","TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","1.03A","1eta1-3oepA:undetectable","1eta1-3oepA:14.14"],["1ETA_2_T442129_1","TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","1.07A","1eta2-3oepA:undetectable","1eta2-3oepA:14.14"],["1ETB_1_T441128_1","TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","1.02A","1etb1-3oepA:undetectable","1etb1-3oepA:13.32"],["1FDU_B_ESTB354_1","17-BETA-HYDROXYSTEROID DEHYDROGENASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 225;LEU A 223;PRO A 281;VAL A 336","None","0.98A","1fduB-3oepA:undetectable","1fduB-3oepA:25.05"],["1H4O_A_BEZA1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 121;GLY A 122;LEU A 346;PHE A 345;GLY A 242","None","1.27A","1h4oA-3oepA:undetectable;1h4oB-3oepA:undetectable","1h4oA-3oepA:17.38;1h4oB-3oepA:17.38"],["1H4O_A_BEZA1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.31A","1h4oA-3oepA:undetectable;1h4oB-3oepA:undetectable","1h4oA-3oepA:17.38;1h4oB-3oepA:17.38"],["1H4O_D_BEZD1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.36A","1h4oD-3oepA:undetectable","1h4oD-3oepA:17.38"],["1H4O_F_BEZF1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.35A","1h4oF-3oepA:undetectable","1h4oF-3oepA:17.38"],["1H4O_G_BEZG1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.30A","1h4oG-3oepA:undetectable","1h4oG-3oepA:17.38"],["1H4O_H_BEZH1162_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.35A","1h4oH-3oepA:undetectable","1h4oH-3oepA:17.38"],["1HD2_A_BEZA201_0","PEROXIREDOXIN 5 RESIDUES 54-214","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.31A","1hd2A-3oepA:undetectable","1hd2A-3oepA:17.38"],["1ICT_C_T44C128_1","TRANSTHYRETIN;TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ALA A 291;LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","1.23A","1ictA-3oepA:undetectable;1ictC-3oepA:undetectable","1ictA-3oepA:13.32;1ictC-3oepA:13.32"],["1IE4_A_T44A128_1","TRANSTHYRETIN;TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ALA A 291;LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","1.10A","1ie4A-3oepA:undetectable;1ie4C-3oepA:undetectable","1ie4A-3oepA:13.96;1ie4C-3oepA:13.96"],["1IE4_A_T44A128_1","TRANSTHYRETIN;TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"LEU A 321;GLU A 303;ALA A 285;LEU A 283;ALA A 291","None","0.99A","1ie4A-3oepA:undetectable;1ie4C-3oepA:undetectable","1ie4A-3oepA:13.96;1ie4C-3oepA:13.96"],["1JGS_A_SALA256_1","MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN MARR","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 366;LEU A 286;THR A 284;LEU A 283","None","0.77A","1jgsA-3oepA:undetectable","1jgsA-3oepA:13.75"],["1MXG_A_ACRA442_1","ALPHA AMYLASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"GLY A 243;PHE A 187;GLY A 118;GLY A 355;ASP A 352","None","1.11A","1mxgA-3oepA:undetectable","1mxgA-3oepA:21.63"],["1N13_D_AG2D7015_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 425;LEU A 392;LEU A 457;GLY A 422","None","0.80A","1n13D-3oepA:undetectable;1n13E-3oepA:undetectable","1n13D-3oepA:10.85;1n13E-3oepA:9.27"],["1OC3_B_BEZB201_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.36A","1oc3B-3oepA:undetectable","1oc3B-3oepA:17.71"],["1SN0_B_T44B602_1","TRANSTHYRETIN;TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;ALA A 291","None","0.85A","1sn0B-3oepA:undetectable;1sn0D-3oepA:undetectable","1sn0B-3oepA:13.44;1sn0D-3oepA:13.44"],["1SN5_C_T3C601_1","TRANSTHYRETIN;TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","0.98A","1sn5A-3oepA:undetectable","1sn5A-3oepA:13.44"],["1SN5_C_T3C601_2","TRANSTHYRETIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 321;GLU A 303;ALA A 285;LEU A 283","None","0.98A","1sn5C-3oepA:undetectable","1sn5C-3oepA:13.44"],["1URM_A_BEZA201_0","PEROXIREDOXIN 5","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"PRO A 186;PRO A 121;GLY A 122;LEU A 346;PHE A 345","None","1.32A","1urmA-3oepA:undetectable","1urmA-3oepA:17.71"],["1XP0_A_VDNA201_1","CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"LEU A 321;ALA A 285;ALA A 337;LEU A 264;PHE A 313","None;None;GOL A 500 ( 3.8A);None;None","1.15A","1xp0A-3oepA:undetectable","1xp0A-3oepA:21.36"],["2DDW_B_PXLB1005_1","PYRIDOXINE KINASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"THR A 204;PRO A 205;HIS A 148;GLY A 172","None","1.02A","2ddwB-3oepA:undetectable","2ddwB-3oepA:21.77"],["2EJF_B_ADNB2002_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ARG A  30;ASN A  18;PRO A  41;ALA A  21","None","1.36A","2ejfB-3oepA:undetectable","2ejfB-3oepA:20.20"],["2HRE_D_CHDD702_0","FERROCHELATASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"ARG A  19;GLY A 192;PRO A 191","None","0.77A","2hreD-3oepA:undetectable","2hreD-3oepA:21.87"],["2HRE_D_CHDD702_0","FERROCHELATASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"ARG A 414;GLY A 427;PRO A 428","GOL A 502 (-3.5A);None;None","0.59A","2hreD-3oepA:undetectable","2hreD-3oepA:21.87"],["2HS1_B_017B203_1","HIV-1 PROTEASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"GLU A 370;PRO A 374;ARG A 373;GLY A 339","None;GOL A 500 ( 4.7A);None;None","0.98A","2hs1B-3oepA:undetectable","2hs1B-3oepA:10.85"],["2QMZ_B_LDPB502_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE;RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"GLN A 156;PHE A 125;PHE A 123;GLY A 167","None;GOL A 501 (-4.8A);None;GOL A 501 ( 4.9A)","1.33A","2qmzA-3oepA:undetectable;2qmzB-3oepA:undetectable","2qmzA-3oepA:18.48;2qmzB-3oepA:18.48"],["2QWX_B_ML1B233_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"GLY A 166;GLY A 465;PHE A 125;PHE A 123","GOL A 501 (-3.2A);None;GOL A 501 (-4.8A);None","0.78A","2qwxA-3oepA:undetectable;2qwxB-3oepA:undetectable","2qwxA-3oepA:18.69;2qwxB-3oepA:18.69"],["2UZ2_A_ACTA1123_0","XENAVIDIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A 133;TYR A 112;THR A 157;VAL A 152","None","0.99A","2uz2A-3oepA:undetectable","2uz2A-3oepA:11.68"],["2X8O_A_OINA1314_1","CHOLINE-BINDING PROTEIN F","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ASP A 254;ARG A 331;TYR A 333;GLU A 275","None","1.19A","2x8oA-3oepA:undetectable","2x8oA-3oepA:20.82"],["2ZD1_A_T27A557_1","REVERSE TRANSCRIPTASE\/RIBONUCLEASE H","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"LEU A  22;VAL A  45;TYR A 115;TYR A  43;PRO A 439","None","1.49A","2zd1A-3oepA:4.0","2zd1A-3oepA:21.83"],["2ZXW_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1;CYTOCHROME C OXIDASE SUBUNIT 1","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ILE A 489;LEU A 392;PHE A 491;ARG A 452","None","0.97A","2zxwN-3oepA:undetectable;2zxwW-3oepA:undetectable","2zxwN-3oepA:21.17;2zxwW-3oepA:7.33"],["3AV6_A_SAMA1_0","DNA (CYTOSINE-5)-METHYLTRANSFERASE 1","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"GLY A 158;LEU A  98;ASN A 169;ALA A 151;VAL A 150","None","1.07A","3av6A-3oepA:undetectable","3av6A-3oepA:17.05"],["3B9M_A_SALA1100_1","SERUM ALBUMIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"LEU A  46;ARG A  30;LEU A  29;ALA A  23","None","1.10A","3b9mA-3oepA:undetectable","3b9mA-3oepA:21.97"],["3BOG_D_DVAD10_0","6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"GLY A 118;GLY A 243;GLY A 246","None","0.40A","3bogD-3oepA:undetectable","3bogD-3oepA:11.48"],["3G2O_A_SAMA500_1","PCZA361.24","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"ARG A 259;GLU A 275;ASP A 419","None","0.68A","3g2oA-3oepA:undetectable","3g2oA-3oepA:21.86"],["3KK6_B_CELB1701_1","PROSTAGLANDIN G\/H SYNTHASE 1","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"VAL A 114;LEU A 126;LEU A 117;PHE A 197;ILE A  80","None","1.27A","3kk6B-3oepA:undetectable","3kk6B-3oepA:22.60"],["3LOQ_A_ACTA277_0","UNIVERSAL STRESS PROTEIN","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"ASP A 254;SER A 257;ARG A 384","None","0.52A","3loqA-3oepA:undetectable","3loqA-3oepA:20.16"],["3M6W_A_SAMA465_0","RRNA METHYLASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"GLY A 318;VAL A 225;PRO A 281;VAL A 234;LEU A 274","None","1.02A","3m6wA-3oepA:undetectable","3m6wA-3oepA:27.86"],["3SXJ_A_SAMA258_0","PUTATIVE METHYLTRANSFERASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ARG A 384;GLN A 383;GLY A 295;LEU A 334;ALA A 258","None","1.19A","3sxjA-3oepA:undetectable","3sxjA-3oepA:17.13"],["3SXJ_B_SAMB258_0","PUTATIVE METHYLTRANSFERASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ARG A 384;GLN A 383;GLY A 295;LEU A 334;ALA A 258","None","1.19A","3sxjB-3oepA:undetectable","3sxjB-3oepA:17.13"],["3U5K_C_08JC3_1","BROMODOMAIN-CONTAINING PROTEIN 4","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 445;LEU A 408;LEU A 394;ILE A 489","None","0.91A","3u5kC-3oepA:undetectable","3u5kC-3oepA:12.21"],["3U5K_D_08JD4_1","BROMODOMAIN-CONTAINING PROTEIN 4","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 445;LEU A 408;LEU A 394;ILE A 489","None","0.86A","3u5kD-3oepA:undetectable","3u5kD-3oepA:12.21"],["3UCB_B_017B202_1","PROTEASE","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"PRO A 308;ARG A 326;GLY A 327;PRO A 328","None","1.30A","3ucbB-3oepA:undetectable","3ucbB-3oepA:12.74"],["3VW7_A_VPXA2001_2","PROTEINASE-ACTIVATED RECEPTOR 1, LYSOZYME","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"PRO A  33;LEU A 241;HIS A 244;LEU A 117","None","1.42A","3vw7A-3oepA:undetectable","3vw7A-3oepA:21.39"],["4A9J_A_TYLA1188_1","BROMODOMAIN CONTAINING 2","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 445;LEU A 408;LEU A 394;ILE A 489","None","0.95A","4a9jA-3oepA:undetectable","4a9jA-3oepA:12.79"],["4A9J_B_TYLB1187_1","BROMODOMAIN CONTAINING 2","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 445;LEU A 408;LEU A 394;ILE A 489","None","0.92A","4a9jB-3oepA:undetectable","4a9jB-3oepA:12.79"],["4KFB_A_T27A607_1","REVERSE TRANSCRIPTASE\/RIBONUCLEASE H, EXORIBONUCLEA P66 RT","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"LEU A  22;VAL A  45;TYR A 115;TYR A  43;PRO A 439","None","1.50A","4kfbA-3oepA:4.5","4kfbA-3oepA:21.83"],["4MM4_A_8PRA603_1","TRANSPORTER","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ALA A 335;TYR A 333;PHE A 298;PHE A 293;SER A 257","None","1.22A","4mm4A-3oepA:undetectable","4mm4A-3oepA:23.19"],["4MM4_B_8PRB603_1","TRANSPORTER","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"ALA A 335;TYR A 333;PHE A 298;PHE A 293;SER A 257","None","1.21A","4mm4B-3oepA:undetectable","4mm4B-3oepA:23.19"],["4Z3O_F_MFXF101_1","DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;E-SITE DNA","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ARG A 420;ARG A 359;GLY A 358;GLU A 212","None","1.10A","4z3oA-3oepA:5.5;4z3oB-3oepA:5.5","4z3oA-3oepA:20.37;4z3oB-3oepA:20.37"],["4ZZB_E_ACTE403_0","PROTON-GATED ION CHANNEL","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",3,"ARG A 420;TYR A 333;GLU A 275","None","0.68A","4zzbE-3oepA:undetectable","4zzbE-3oepA:19.57"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ARG A 359;GLY A 358;GLU A 212;ARG A 420","None","1.05A","5btaA-3oepA:5.3;5btaB-3oepA:undetectable;5btaC-3oepA:5.6","5btaA-3oepA:23.37;5btaB-3oepA:20.53;5btaC-3oepA:23.37"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ARG A 420;ARG A 359;GLY A 358;GLU A 212","None","1.03A","5btcA-3oepA:5.4;5btcC-3oepA:5.2;5btcD-3oepA:undetectable","5btcA-3oepA:23.37;5btcC-3oepA:23.37;5btcD-3oepA:20.53"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"ARG A 359;GLY A 358;GLU A 212;ARG A 420","None","1.03A","5btcA-3oepA:5.3;5btcB-3oepA:undetectable;5btcC-3oepA:5.2","5btcA-3oepA:23.37;5btcB-3oepA:20.53;5btcC-3oepA:23.37"],["5JQ7_B_T0RB705_1","ENVELOPE GLYCOPROTEIN 1,ENVELOPE GLYCOPROTEIN 1,ENVELOPE GLYCOPROTEIN 1;ENVELOPE GLYCOPROTEIN 2","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"VAL A 103;LEU A 133;GLU A 101;ALA A 102;LEU A  89","None","1.37A","5jq7A-3oepA:undetectable","5jq7A-3oepA:19.88"],["5OG9_B_TESB502_1","-","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",5,"LEU A 361;LEU A 214;LEU A 283;PRO A 218;LEU A 286","None","1.16A","5og9B-3oepA:undetectable","5og9B-3oepA:24.60"],["5XV7_A_EMHA705_2","SERINE-ARGININE (SR) PROTEIN KINASE 1","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"VAL A 366;LEU A 223;LEU A 283;ASP A 232","None","1.50A","5xv7A-3oepA:undetectable","5xv7A-3oepA:9.07"],["6AK3_B_P2EB1201_1","PROSTAGLANDIN E2 RECEPTOR EP3 SUBTYPE,SOLUBLE CYTOCHROME B562","3oep","PUTATIVE UNCHARACTERIZED PROTEIN TTHA0988","Thermus thermophilus",4,"PRO A 281;VAL A 225;GLY A 358;VAL A 234","None","1.08A","6ak3B-3oepA:undetectable","6ak3B-3oepA:9.73"]]