SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3red'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DB1_A_VDXA428_2 (VITAMIN D NUCLEAR RECEPTOR)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	LEU A 201 ILE A 255 ARG A 484 VAL A 51	None	0.91A	1db1A-3redA: undetectable	1db1A-3redA: 18.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EIZ_A_SAMA301_0 (FTSJ)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	GLY A 262 GLY A 464 GLY A 463 LEU A 266 LEU A 267	FAD A 773 ( 4.0A) None None FAD A 773 ( 4.6A) None	0.99A	1eizA-3redA: 2.4	1eizA-3redA: 15.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EJ0_A_SAMA301_0 (FTSJ)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	GLY A 262 GLY A 464 GLY A 463 LEU A 266 LEU A 267	FAD A 773 ( 4.0A) None None FAD A 773 ( 4.6A) None	0.98A	1ej0A-3redA: 2.4	1ej0A-3redA: 15.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQH_A_FLPA701_1 (PROSTAGLANDIN H2 SYNTHASE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	0.98A	1eqhA-3redA: undetectable	1eqhA-3redA: 21.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EQH_B_FLPB1701_1 (PROSTAGLANDIN H2 SYNTHASE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	1.02A	1eqhB-3redA: undetectable	1eqhB-3redA: 21.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MX1_F_THAF6_1 (LIVER CARBOXYLESTERASE I)	3red	HYDROXYNITRILE LYASE (Prunus mume)	6 / 12	GLY A 35 GLY A 104 SER A 107 LEU A 201 LEU A 103 LEU A 200	FAD A 773 (-3.4A) None None None None None	1.46A	1mx1F-3redA: undetectable	1mx1F-3redA: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_A_BEZA502_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	PHE A 303 ASN A 305 ILE A 435 GLY A 434	None	0.75A	1oniA-3redA: undetectable 1oniB-3redA: undetectable	1oniA-3redA: 14.68 1oniB-3redA: 14.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_D_BEZD508_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	PHE A 303 ASN A 305 ILE A 435 GLY A 434	None	0.75A	1oniD-3redA: undetectable 1oniF-3redA: undetectable	1oniD-3redA: 14.68 1oniF-3redA: 14.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_I_BEZI518_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 7	ILE A 435 GLY A 434 PHE A 303 ASN A 305	None	0.68A	1oniG-3redA: undetectable 1oniI-3redA: undetectable	1oniG-3redA: 14.68 1oniI-3redA: 14.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YA4_A_CTXA1_1 (CES1 PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	ALA A 42 GLY A 35 GLY A 104 SER A 107 LEU A 201	None FAD A 773 (-3.4A) None None None	0.86A	1ya4A-3redA: undetectable	1ya4A-3redA: 21.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YAJ_G_BEZG3385_0 (CES1 PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	3 / 3	SER A 489 VAL A 470 LEU A 471	None	0.71A	1yajG-3redA: undetectable	1yajG-3redA: 21.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FL5_F_RBFF204_1 (IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN IMMUNOGLOBULIN IGG1 HEAVY CHAIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 8	TYR A 63 ASN A 75 ARG A 88 TYR A 74	None	1.03A	2fl5E-3redA: undetectable 2fl5F-3redA: undetectable	2fl5E-3redA: 18.91 2fl5F-3redA: 22.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IEO_A_017A402_2 (PROTEASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 54 VAL A 256 ILE A 221 VAL A 30 VAL A 32	None None None None FAD A 773 ( 4.9A)	0.74A	2ieoB-3redA: undetectable	2ieoB-3redA: 10.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OA1_B_ADNB2005_1 (TRYPTOPHAN HALOGENASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 7	GLY A 104 GLY A 105 VAL A 211 LEU A 201	None FAD A 773 (-3.3A) None None	0.72A	2oa1B-3redA: 8.9	2oa1B-3redA: 22.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX4_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 8	ILE A 261 PHE A 388 GLY A 464 GLY A 463	None	0.77A	2qx4A-3redA: 2.0 2qx4B-3redA: undetectable	2qx4A-3redA: 16.67 2qx4B-3redA: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX6_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	ILE A 261 PHE A 388 GLY A 464 GLY A 463	None	0.79A	2qx6A-3redA: 2.4 2qx6B-3redA: 2.4	2qx6A-3redA: 16.67 2qx6B-3redA: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_D_KLND1499_1 (CYTOCHROME P450 3A4)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	PHE A 343 PHE A 359 PHE A 356 ILE A 427	None	1.26A	2v0mD-3redA: undetectable	2v0mD-3redA: 22.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_D_KLND1499_1 (CYTOCHROME P450 3A4)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	PHE A 344 PHE A 359 PHE A 356 ILE A 427	None	1.04A	2v0mD-3redA: undetectable	2v0mD-3redA: 22.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VAX_I_CSCI1384_1 (ACETYL-COA--DEACETYL CEPHALOSPORIN C ACETYLTRANSFERASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	THR A 184 LEU A 183 THR A 318 ASN A 190 VAL A 146	None	1.47A	2vaxI-3redA: undetectable	2vaxI-3redA: 21.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7K_A_SALA1303_1 (LYSR-TYPE REGULATORY PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 7	PRO A 492 ILE A 121 PRO A 366 GLY A 365	None	0.92A	2y7kA-3redA: undetectable	2y7kA-3redA: 18.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HUO_B_PNNB301_0 (CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	CYH A 39 GLY A 38 GLY A 34 GLY A 104 ARG A 56	None None None None FAD A 773 (-4.2A)	0.89A	3huoB-3redA: undetectable	3huoB-3redA: 19.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IJD_B_C2FB314_1 (UNCHARACTERIZED PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	3 / 3	THR A 119 LYS A 1 GLU A 178	None	0.86A	3ijdB-3redA: undetectable	3ijdB-3redA: 20.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K8M_B_ACRB820_1 (ALPHA-AMYLASE, SUSG)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 7	TYR A 509 GLU A 517 LEU A 506 TRP A 129	None	1.38A	3k8mB-3redA: undetectable	3k8mB-3redA: 21.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K9F_F_LFXF0_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	SER A 197 ARG A 99 GLY A 100 GLU A 87	None	1.28A	3k9fA-3redA: undetectable 3k9fB-3redA: undetectable 3k9fC-3redA: undetectable	3k9fA-3redA: 19.65 3k9fB-3redA: 19.65 3k9fC-3redA: 17.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K9F_H_LFXH0_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	SER A 107 ARG A 508 GLY A 507 GLU A 47	None	1.13A	3k9fA-3redA: undetectable 3k9fB-3redA: undetectable 3k9fD-3redA: undetectable	3k9fA-3redA: 19.65 3k9fB-3redA: 19.65 3k9fD-3redA: 17.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_A_CELA682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.96A	3ln1A-3redA: undetectable	3ln1A-3redA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_B_CELB682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.97A	3ln1B-3redA: undetectable	3ln1B-3redA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_C_CELC682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.96A	3ln1C-3redA: undetectable	3ln1C-3redA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LN1_D_CELD682_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.96A	3ln1D-3redA: undetectable	3ln1D-3redA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N8W_A_FLPA701_1 (PROSTAGLANDIN G/H SYNTHASE 1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	1.05A	3n8wA-3redA: undetectable	3n8wA-3redA: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3O9M_B_BEZB999_0 (CHOLINESTERASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	GLY A 105 GLY A 104 SER A 107 LEU A 200	FAD A 773 (-3.3A) None None None	0.81A	3o9mB-3redA: undetectable	3o9mB-3redA: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PGH_C_FLPC701_1 (CYCLOOXYGENASE-2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	0.97A	3pghC-3redA: 0.7	3pghC-3redA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RR3_A_FLRA700_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	0.94A	3rr3A-3redA: undetectable	3rr3A-3redA: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RR3_B_FLRB700_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	0.93A	3rr3B-3redA: undetectable	3rr3B-3redA: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SOA_A_DB8A445_1 (CALCIUM/CALMODULIN-D EPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	LEU A 471 VAL A 467 PHE A 491 VAL A 486	None	1.03A	3soaA-3redA: undetectable	3soaA-3redA: 22.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UWL_B_FOZB316_0 (THYMIDYLATE SYNTHASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 296 GLY A 370 PHE A 388 ASN A 389 ILE A 372	None	0.96A	3uwlB-3redA: undetectable	3uwlB-3redA: 21.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UWL_D_FOZD316_0 (THYMIDYLATE SYNTHASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 296 GLY A 370 PHE A 388 ASN A 389 ILE A 372	None	0.95A	3uwlD-3redA: undetectable	3uwlD-3redA: 21.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_B_W9TB502_1 (HEMOLYTIC LECTIN CEL-III)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	GLU A 253 GLY A 252 LEU A 45 TYR A 49	None	1.05A	3w9tB-3redA: undetectable	3w9tB-3redA: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_E_W9TE502_1 (HEMOLYTIC LECTIN CEL-III)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	GLU A 253 GLY A 252 LEU A 45 TYR A 49	None	1.06A	3w9tE-3redA: undetectable	3w9tE-3redA: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_F_W9TF503_1 (HEMOLYTIC LECTIN CEL-III)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	GLU A 253 GLY A 252 LEU A 45 TYR A 49	None	1.05A	3w9tF-3redA: undetectable	3w9tF-3redA: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CCQ_A_ACTA1317_0 (THIOREDOXIN REDUCTASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	3 / 3	LEU A 515 GLU A 517 SER A 519	None	0.71A	4ccqA-3redA: undetectable	4ccqA-3redA: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EVR_A_BEZA401_0 (PUTATIVE ABC TRANSPORTER SUBUNIT, SUBSTRATE-BINDING COMPONENT)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 11	LEU A 266 VAL A 256 ALA A 231 PHE A 222 SER A 270	FAD A 773 ( 4.6A) None None None None	1.35A	4evrA-3redA: 3.0	4evrA-3redA: 22.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4I1R_A_LZUA801_1 (MUCOSA-ASSOCIATED LYMPHOID TISSUE LYMPHOMA TRANSLOCATION PROTEIN 1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 209 VAL A 51 ALA A 43 GLU A 47 LEU A 515	None	1.03A	4i1rA-3redA: undetectable	4i1rA-3redA: 23.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KIC_B_SAMB401_1 (METHYLTRANSFERASE MPPJ)	3red	HYDROXYNITRILE LYASE (Prunus mume)	3 / 3	ARG A 452 ASP A 93 ASP A 97	None	0.71A	4kicB-3redA: undetectable	4kicB-3redA: 20.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOE_F_TR6F101_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B E-SITE DNA2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	ARG A 99 GLY A 488 ASP A 487 GLY A 464	None FAD A 773 (-3.3A) FAD A 773 (-4.4A) None	1.04A	4koeA-3redA: undetectable 4koeB-3redA: undetectable 4koeC-3redA: undetectable	4koeA-3redA: 19.65 4koeB-3redA: 19.65 4koeC-3redA: 17.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOT_A_CE3A205_1 (UNCHARACTERIZED PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	PHE A 343 ARG A 194 GLY A 112 ASN A 110 PHE A 331	None None FAD A 773 (-3.9A) FAD A 773 (-4.3A) None	1.42A	4kotA-3redA: undetectable	4kotA-3redA: 15.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOU_A_C04A206_1 (UNCHARACTERIZED PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	PHE A 343 ARG A 194 GLY A 112 ASN A 110 PHE A 331	None None FAD A 773 (-3.9A) FAD A 773 (-4.3A) None	1.40A	4kouA-3redA: undetectable	4kouA-3redA: 15.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KOW_A_CFXA204_1 (UNCHARACTERIZED PROTEIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	PHE A 343 ARG A 194 GLY A 112 ASN A 110 PHE A 331	None None FAD A 773 (-3.9A) FAD A 773 (-4.3A) None	1.39A	4kowA-3redA: undetectable	4kowA-3redA: 15.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNX_A_T44A501_1 (THYROID HORMONE RECEPTOR ALPHA)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	SER A 107 GLN A 500 VAL A 141 THR A 144	None FAD A 773 (-4.4A) None None	1.32A	4lnxA-3redA: undetectable	4lnxA-3redA: 19.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PGH_B_SAMB401_0 (CAFFEIC ACID O-METHYLTRANSFERASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	SER A 197 GLY A 100 THR A 36 ASP A 80 ILE A 109	None None FAD A 773 (-3.1A) None None	1.21A	4pghB-3redA: undetectable	4pghB-3redA: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PH9_A_IBPA601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	1.00A	4ph9A-3redA: undetectable	4ph9A-3redA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PH9_B_IBPB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	VAL A 485 VAL A 272 LEU A 267 GLY A 479 LEU A 483	None	0.99A	4ph9B-3redA: undetectable	4ph9B-3redA: 20.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 11	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.34A	4qvyV-3redA: undetectable 4qvyb-3redA: undetectable	4qvyV-3redA: 17.33 4qvyb-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVY_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 11	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.34A	4qvyH-3redA: undetectable 4qvyN-3redA: undetectable	4qvyH-3redA: 17.33 4qvyN-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RTM_A_SAMA301_0 (DNA ADENINE METHYLASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	GLY A 35 GLY A 34 GLY A 259 ALA A 258 SER A 494	FAD A 773 (-3.4A) None FAD A 773 (-3.5A) FAD A 773 (-3.6A) None	1.04A	4rtmA-3redA: 2.3	4rtmA-3redA: 20.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TVT_A_ASCA303_0 (THAUMATIN-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 7	LEU A 267 SER A 270 ILE A 220 VAL A 234	None	1.04A	4tvtA-3redA: undetectable	4tvtA-3redA: 17.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XUM_A_IMNA501_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	ILE A 145 PHE A 9 HIS A 7 LEU A 67 LEU A 66	None	1.26A	4xumA-3redA: undetectable	4xumA-3redA: 20.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_A_STRA604_1 (CYTOCHROME P450 21-HYDROXYLASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 470 SER A 489 VAL A 272 LEU A 268 LEU A 296	None	1.08A	4y8wA-3redA: undetectable	4y8wA-3redA: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_B_STRB603_1 (CYTOCHROME P450 21-HYDROXYLASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	VAL A 470 SER A 489 VAL A 272 LEU A 268 LEU A 296	None	1.08A	4y8wB-3redA: undetectable	4y8wB-3redA: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z69_I_DIFI1006_1 (SERUM ALBUMIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	ARG A 56 ARG A 99 LEU A 374 ILE A 372 ALA A 383	FAD A 773 (-4.2A) None None None None	1.30A	4z69I-3redA: undetectable	4z69I-3redA: 21.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE1_A_X2NA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	VAL A 256 TYR A 138 PRO A 40 THR A 187	None	1.34A	4ze1A-3redA: undetectable	4ze1A-3redA: 23.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	SER A 270 ARG A 56 GLY A 33 GLU A 55	None FAD A 773 (-4.2A) FAD A 773 (-3.2A) FAD A 773 (-2.8A)	1.16A	5btiA-3redA: undetectable 5btiB-3redA: undetectable	5btiA-3redA: 23.29 5btiB-3redA: 21.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	SER A 270 ARG A 56 GLY A 33 GLU A 55	None FAD A 773 (-4.2A) FAD A 773 (-3.2A) FAD A 773 (-2.8A)	1.19A	5btiC-3redA: undetectable 5btiD-3redA: undetectable	5btiC-3redA: 23.29 5btiD-3redA: 21.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DBY_A_NPSA602_1 (SERUM ALBUMIN)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 466 PHE A 475 LEU A 506 TYR A 503 SER A 125	None None None FAD A 773 (-4.2A) None	1.50A	5dbyA-3redA: undetectable	5dbyA-3redA: 21.28
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5EB5_A_010A609_0 (HNL ISOENZYME 5)	3red	HYDROXYNITRILE LYASE (Prunus mume)	7 / 11	ALA A 111 ARG A 301 HIS A 358 VAL A 360 TYR A 458 TRP A 459 HIS A 498	FAD A 773 (-3.0A) None None None None FAD A 773 (-3.8A) FAD A 773 (-4.4A)	0.34A	5eb5A-3redA: 64.0	5eb5A-3redA: 76.72
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5EB5_B_010B607_0 (HNL ISOENZYME 5)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	ALA A 111 ARG A 301 HIS A 358 VAL A 360 HIS A 460	FAD A 773 (-3.0A) None None None FAD A 773 ( 4.4A)	1.45A	5eb5B-3redA: 64.1	5eb5B-3redA: 76.72
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5EB5_B_010B607_0 (HNL ISOENZYME 5)	3red	HYDROXYNITRILE LYASE (Prunus mume)	7 / 10	ALA A 111 ARG A 301 HIS A 358 VAL A 360 TYR A 458 TRP A 459 HIS A 498	FAD A 773 (-3.0A) None None None None FAD A 773 (-3.8A) FAD A 773 (-4.4A)	0.40A	5eb5B-3redA: 64.1	5eb5B-3redA: 76.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5G08_A_Z80A1187_1 (FREQUENIN 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 6	ILE A 427 PHE A 359 THR A 158 TRP A 154	None	1.33A	5g08A-3redA: undetectable	5g08A-3redA: 15.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGJ_A_CTYA402_2 (MACROLIDE 2'-PHOSPHOTRANSFERAS E)	3red	HYDROXYNITRILE LYASE (Prunus mume)	4 / 5	PRO A 300 HIS A 498 LEU A 410 PHE A 331	None FAD A 773 (-4.4A) None None	1.43A	5igjA-3redA: undetectable	5igjA-3redA: 22.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKT_B_TLFB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	3 / 3	TYR A 11 TYR A 147 SER A 5	None	0.87A	5iktB-3redA: undetectable	5iktB-3redA: 21.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JW1_A_CELA602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.96A	5jw1A-3redA: undetectable	5jw1A-3redA: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KIR_A_RCXA601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.98A	5kirA-3redA: undetectable	5kirA-3redA: 21.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KIR_B_RCXB601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	TYR A 458 ALA A 496 VAL A 113 GLY A 112 ALA A 111	None None FAD A 773 (-3.7A) FAD A 773 (-3.9A) FAD A 773 (-3.0A)	0.97A	5kirB-3redA: undetectable	5kirB-3redA: 21.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 11	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.33A	5l5fV-3redA: undetectable 5l5fb-3redA: undetectable	5l5fV-3redA: 17.33 5l5fb-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5F_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 11	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.33A	5l5fH-3redA: undetectable 5l5fN-3redA: undetectable	5l5fH-3redA: 17.33 5l5fN-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5Z_B_BO2B201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.34A	5l5zV-3redA: undetectable 5l5zb-3redA: undetectable	5l5zV-3redA: 17.33 5l5zb-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5Z_N_BO2N201_1 (PROTEASOME SUBUNIT BETA TYPE-2 PROTEASOME SUBUNIT BETA TYPE-1)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	HIS A 177 SER A 497 THR A 158 THR A 181 SER A 330	None	1.33A	5l5zH-3redA: undetectable 5l5zN-3redA: undetectable	5l5zH-3redA: 17.33 5l5zN-3redA: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_A_PCFA1803_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	TYR A 419 ILE A 306 ILE A 432 ILE A 312 ASN A 310	None	1.23A	5vkqA-3redA: undetectable 5vkqD-3redA: undetectable	5vkqA-3redA: 15.96 5vkqD-3redA: 15.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_B_PCFB1808_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	ILE A 312 ASN A 310 TYR A 419 ILE A 306 ILE A 432	None	1.23A	5vkqA-3redA: undetectable 5vkqB-3redA: undetectable	5vkqA-3redA: 15.96 5vkqB-3redA: 15.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_D_PCFD1801_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 10	ILE A 312 ASN A 310 TYR A 419 ILE A 306 ILE A 432	None	1.19A	5vkqC-3redA: undetectable 5vkqD-3redA: undetectable	5vkqC-3redA: 15.96 5vkqD-3redA: 15.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6QXS_B_FOZB403_0 (THYMIDYLATE SYNTHASE)	3red	HYDROXYNITRILE LYASE (Prunus mume)	5 / 12	LEU A 296 GLY A 370 PHE A 388 ASN A 389 ILE A 372	None	0.91A	6qxsB-3redA: undetectable	6qxsB-3redA: 21.52

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1DB1_A_VDXA428_2","VITAMIN D NUCLEAR RECEPTOR","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"LEU A 201;ILE A 255;ARG A 484;VAL A  51","None","0.91A","1db1A-3redA:undetectable","1db1A-3redA:18.45"],["1EIZ_A_SAMA301_0","FTSJ","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"GLY A 262;GLY A 464;GLY A 463;LEU A 266;LEU A 267","FAD A 773 ( 4.0A);None;None;FAD A 773 ( 4.6A);None","0.99A","1eizA-3redA:2.4","1eizA-3redA:15.18"],["1EJ0_A_SAMA301_0","FTSJ","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"GLY A 262;GLY A 464;GLY A 463;LEU A 266;LEU A 267","FAD A 773 ( 4.0A);None;None;FAD A 773 ( 4.6A);None","0.98A","1ej0A-3redA:2.4","1ej0A-3redA:15.18"],["1EQH_A_FLPA701_1","PROSTAGLANDIN H2 SYNTHASE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","0.98A","1eqhA-3redA:undetectable","1eqhA-3redA:21.16"],["1EQH_B_FLPB1701_1","PROSTAGLANDIN H2 SYNTHASE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","1.02A","1eqhB-3redA:undetectable","1eqhB-3redA:21.16"],["1MX1_F_THAF6_1","LIVER CARBOXYLESTERASE I","3red","HYDROXYNITRILE LYASE","Prunus mume",6,"GLY A  35;GLY A 104;SER A 107;LEU A 201;LEU A 103;LEU A 200","FAD A 773 (-3.4A);None;None;None;None;None","1.46A","1mx1F-3redA:undetectable","1mx1F-3redA:21.31"],["1ONI_A_BEZA502_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PHE A 303;ASN A 305;ILE A 435;GLY A 434","None","0.75A","1oniA-3redA:undetectable;1oniB-3redA:undetectable","1oniA-3redA:14.68;1oniB-3redA:14.68"],["1ONI_D_BEZD508_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PHE A 303;ASN A 305;ILE A 435;GLY A 434","None","0.75A","1oniD-3redA:undetectable;1oniF-3redA:undetectable","1oniD-3redA:14.68;1oniF-3redA:14.68"],["1ONI_I_BEZI518_0","14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"ILE A 435;GLY A 434;PHE A 303;ASN A 305","None","0.68A","1oniG-3redA:undetectable;1oniI-3redA:undetectable","1oniG-3redA:14.68;1oniI-3redA:14.68"],["1YA4_A_CTXA1_1","CES1 PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ALA A  42;GLY A  35;GLY A 104;SER A 107;LEU A 201","None;FAD A 773 (-3.4A);None;None;None","0.86A","1ya4A-3redA:undetectable","1ya4A-3redA:21.37"],["1YAJ_G_BEZG3385_0","CES1 PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",3,"SER A 489;VAL A 470;LEU A 471","None","0.71A","1yajG-3redA:undetectable","1yajG-3redA:21.37"],["2FL5_F_RBFF204_1","IMMUNOGLOBULIN IGG1 LAMBDA LIGHT CHAIN;IMMUNOGLOBULIN IGG1 HEAVY CHAIN","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"TYR A  63;ASN A  75;ARG A  88;TYR A  74","None","1.03A","2fl5E-3redA:undetectable;2fl5F-3redA:undetectable","2fl5E-3redA:18.91;2fl5F-3redA:22.53"],["2IEO_A_017A402_2","PROTEASE;PROTEASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A  54;VAL A 256;ILE A 221;VAL A  30;VAL A  32","None;None;None;None;FAD A 773 ( 4.9A)","0.74A","2ieoB-3redA:undetectable","2ieoB-3redA:10.64"],["2OA1_B_ADNB2005_1","TRYPTOPHAN HALOGENASE","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"GLY A 104;GLY A 105;VAL A 211;LEU A 201","None;FAD A 773 (-3.3A);None;None","0.72A","2oa1B-3redA:8.9","2oa1B-3redA:22.96"],["2QX4_A_ML1A233_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"ILE A 261;PHE A 388;GLY A 464;GLY A 463","None","0.77A","2qx4A-3redA:2.0;2qx4B-3redA:undetectable","2qx4A-3redA:16.67;2qx4B-3redA:16.67"],["2QX6_A_ML1A233_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"ILE A 261;PHE A 388;GLY A 464;GLY A 463","None","0.79A","2qx6A-3redA:2.4;2qx6B-3redA:2.4","2qx6A-3redA:16.67;2qx6B-3redA:16.67"],["2V0M_D_KLND1499_1","CYTOCHROME P450 3A4","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PHE A 343;PHE A 359;PHE A 356;ILE A 427","None","1.26A","2v0mD-3redA:undetectable","2v0mD-3redA:22.57"],["2V0M_D_KLND1499_1","CYTOCHROME P450 3A4","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PHE A 344;PHE A 359;PHE A 356;ILE A 427","None","1.04A","2v0mD-3redA:undetectable","2v0mD-3redA:22.57"],["2VAX_I_CSCI1384_1","ACETYL-COA--DEACETYLCEPHALOSPORIN C ACETYLTRANSFERASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"THR A 184;LEU A 183;THR A 318;ASN A 190;VAL A 146","None","1.47A","2vaxI-3redA:undetectable","2vaxI-3redA:21.49"],["2Y7K_A_SALA1303_1","LYSR-TYPE REGULATORY PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PRO A 492;ILE A 121;PRO A 366;GLY A 365","None","0.92A","2y7kA-3redA:undetectable","2y7kA-3redA:18.81"],["3HUO_B_PNNB301_0","CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"CYH A  39;GLY A  38;GLY A  34;GLY A 104;ARG A  56","None;None;None;None;FAD A 773 (-4.2A)","0.89A","3huoB-3redA:undetectable","3huoB-3redA:19.66"],["3IJD_B_C2FB314_1","UNCHARACTERIZED PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",3,"THR A 119;LYS A   1;GLU A 178","None","0.86A","3ijdB-3redA:undetectable","3ijdB-3redA:20.61"],["3K8M_B_ACRB820_1","ALPHA-AMYLASE, SUSG","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"TYR A 509;GLU A 517;LEU A 506;TRP A 129","None","1.38A","3k8mB-3redA:undetectable","3k8mB-3redA:21.40"],["3K9F_F_LFXF0_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"SER A 197;ARG A  99;GLY A 100;GLU A  87","None","1.28A","3k9fA-3redA:undetectable;3k9fB-3redA:undetectable;3k9fC-3redA:undetectable","3k9fA-3redA:19.65;3k9fB-3redA:19.65;3k9fC-3redA:17.68"],["3K9F_H_LFXH0_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"SER A 107;ARG A 508;GLY A 507;GLU A  47","None","1.13A","3k9fA-3redA:undetectable;3k9fB-3redA:undetectable;3k9fD-3redA:undetectable","3k9fA-3redA:19.65;3k9fB-3redA:19.65;3k9fD-3redA:17.68"],["3LN1_A_CELA682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.96A","3ln1A-3redA:undetectable","3ln1A-3redA:21.14"],["3LN1_B_CELB682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.97A","3ln1B-3redA:undetectable","3ln1B-3redA:21.14"],["3LN1_C_CELC682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.96A","3ln1C-3redA:undetectable","3ln1C-3redA:21.14"],["3LN1_D_CELD682_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.96A","3ln1D-3redA:undetectable","3ln1D-3redA:21.14"],["3N8W_A_FLPA701_1","PROSTAGLANDIN G\/H SYNTHASE 1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","1.05A","3n8wA-3redA:undetectable","3n8wA-3redA:22.15"],["3O9M_B_BEZB999_0","CHOLINESTERASE","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"GLY A 105;GLY A 104;SER A 107;LEU A 200","FAD A 773 (-3.3A);None;None;None","0.81A","3o9mB-3redA:undetectable","3o9mB-3redA:22.15"],["3PGH_C_FLPC701_1","CYCLOOXYGENASE-2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","0.97A","3pghC-3redA:0.7","3pghC-3redA:21.14"],["3RR3_A_FLRA700_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","0.94A","3rr3A-3redA:undetectable","3rr3A-3redA:20.99"],["3RR3_B_FLRB700_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","0.93A","3rr3B-3redA:undetectable","3rr3B-3redA:20.99"],["3SOA_A_DB8A445_1","CALCIUM\/CALMODULIN-DEPENDENT PROTEIN KINASE TYPE II SUBUNIT ALPHA WITH A BETA 7 LINKER","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"LEU A 471;VAL A 467;PHE A 491;VAL A 486","None","1.03A","3soaA-3redA:undetectable","3soaA-3redA:22.66"],["3UWL_B_FOZB316_0","THYMIDYLATE SYNTHASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 296;GLY A 370;PHE A 388;ASN A 389;ILE A 372","None","0.96A","3uwlB-3redA:undetectable","3uwlB-3redA:21.52"],["3UWL_D_FOZD316_0","THYMIDYLATE SYNTHASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 296;GLY A 370;PHE A 388;ASN A 389;ILE A 372","None","0.95A","3uwlD-3redA:undetectable","3uwlD-3redA:21.52"],["3W9T_B_W9TB502_1","HEMOLYTIC LECTIN CEL-III","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"GLU A 253;GLY A 252;LEU A  45;TYR A  49","None","1.05A","3w9tB-3redA:undetectable","3w9tB-3redA:20.70"],["3W9T_E_W9TE502_1","HEMOLYTIC LECTIN CEL-III","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"GLU A 253;GLY A 252;LEU A  45;TYR A  49","None","1.06A","3w9tE-3redA:undetectable","3w9tE-3redA:20.70"],["3W9T_F_W9TF503_1","HEMOLYTIC LECTIN CEL-III","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"GLU A 253;GLY A 252;LEU A  45;TYR A  49","None","1.05A","3w9tF-3redA:undetectable","3w9tF-3redA:20.70"],["4CCQ_A_ACTA1317_0","THIOREDOXIN REDUCTASE","3red","HYDROXYNITRILE LYASE","Prunus mume",3,"LEU A 515;GLU A 517;SER A 519","None","0.71A","4ccqA-3redA:undetectable","4ccqA-3redA:21.39"],["4EVR_A_BEZA401_0","PUTATIVE ABC TRANSPORTER SUBUNIT, SUBSTRATE-BINDING COMPONENT","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 266;VAL A 256;ALA A 231;PHE A 222;SER A 270","FAD A 773 ( 4.6A);None;None;None;None","1.35A","4evrA-3redA:3.0","4evrA-3redA:22.12"],["4I1R_A_LZUA801_1","MUCOSA-ASSOCIATED LYMPHOID TISSUE LYMPHOMA TRANSLOCATION PROTEIN 1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 209;VAL A  51;ALA A  43;GLU A  47;LEU A 515","None","1.03A","4i1rA-3redA:undetectable","4i1rA-3redA:23.02"],["4KIC_B_SAMB401_1","METHYLTRANSFERASE MPPJ","3red","HYDROXYNITRILE LYASE","Prunus mume",3,"ARG A 452;ASP A  93;ASP A  97","None","0.71A","4kicB-3redA:undetectable","4kicB-3redA:20.07"],["4KOE_F_TR6F101_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B;E-SITE DNA2","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"ARG A  99;GLY A 488;ASP A 487;GLY A 464","None;FAD A 773 (-3.3A);FAD A 773 (-4.4A);None","1.04A","4koeA-3redA:undetectable;4koeB-3redA:undetectable;4koeC-3redA:undetectable","4koeA-3redA:19.65;4koeB-3redA:19.65;4koeC-3redA:17.68"],["4KOT_A_CE3A205_1","UNCHARACTERIZED PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"PHE A 343;ARG A 194;GLY A 112;ASN A 110;PHE A 331","None;None;FAD A 773 (-3.9A);FAD A 773 (-4.3A);None","1.42A","4kotA-3redA:undetectable","4kotA-3redA:15.36"],["4KOU_A_C04A206_1","UNCHARACTERIZED PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"PHE A 343;ARG A 194;GLY A 112;ASN A 110;PHE A 331","None;None;FAD A 773 (-3.9A);FAD A 773 (-4.3A);None","1.40A","4kouA-3redA:undetectable","4kouA-3redA:15.36"],["4KOW_A_CFXA204_1","UNCHARACTERIZED PROTEIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"PHE A 343;ARG A 194;GLY A 112;ASN A 110;PHE A 331","None;None;FAD A 773 (-3.9A);FAD A 773 (-4.3A);None","1.39A","4kowA-3redA:undetectable","4kowA-3redA:15.36"],["4LNX_A_T44A501_1","THYROID HORMONE RECEPTOR ALPHA","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"SER A 107;GLN A 500;VAL A 141;THR A 144","None;FAD A 773 (-4.4A);None;None","1.32A","4lnxA-3redA:undetectable","4lnxA-3redA:19.39"],["4PGH_B_SAMB401_0","CAFFEIC ACID O-METHYLTRANSFERASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"SER A 197;GLY A 100;THR A  36;ASP A  80;ILE A 109","None;None;FAD A 773 (-3.1A);None;None","1.21A","4pghB-3redA:undetectable","4pghB-3redA:23.03"],["4PH9_A_IBPA601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","1.00A","4ph9A-3redA:undetectable","4ph9A-3redA:20.60"],["4PH9_B_IBPB601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 485;VAL A 272;LEU A 267;GLY A 479;LEU A 483","None","0.99A","4ph9B-3redA:undetectable","4ph9B-3redA:20.60"],["4QVY_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.34A","4qvyV-3redA:undetectable;4qvyb-3redA:undetectable","4qvyV-3redA:17.33;4qvyb-3redA:17.88"],["4QVY_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.34A","4qvyH-3redA:undetectable;4qvyN-3redA:undetectable","4qvyH-3redA:17.33;4qvyN-3redA:17.88"],["4RTM_A_SAMA301_0","DNA ADENINE METHYLASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"GLY A  35;GLY A  34;GLY A 259;ALA A 258;SER A 494","FAD A 773 (-3.4A);None;FAD A 773 (-3.5A);FAD A 773 (-3.6A);None","1.04A","4rtmA-3redA:2.3","4rtmA-3redA:20.34"],["4TVT_A_ASCA303_0","THAUMATIN-1","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"LEU A 267;SER A 270;ILE A 220;VAL A 234","None","1.04A","4tvtA-3redA:undetectable","4tvtA-3redA:17.71"],["4XUM_A_IMNA501_1","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ILE A 145;PHE A   9;HIS A   7;LEU A  67;LEU A  66","None","1.26A","4xumA-3redA:undetectable","4xumA-3redA:20.19"],["4Y8W_A_STRA604_1","CYTOCHROME P450 21-HYDROXYLASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 470;SER A 489;VAL A 272;LEU A 268;LEU A 296","None","1.08A","4y8wA-3redA:undetectable","4y8wA-3redA:21.74"],["4Y8W_B_STRB603_1","CYTOCHROME P450 21-HYDROXYLASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"VAL A 470;SER A 489;VAL A 272;LEU A 268;LEU A 296","None","1.08A","4y8wB-3redA:undetectable","4y8wB-3redA:21.74"],["4Z69_I_DIFI1006_1","SERUM ALBUMIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ARG A  56;ARG A  99;LEU A 374;ILE A 372;ALA A 383","FAD A 773 (-4.2A);None;None;None;None","1.30A","4z69I-3redA:undetectable","4z69I-3redA:21.90"],["4ZE1_A_X2NA602_2","LANOSTEROL 14-ALPHA DEMETHYLASE","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"VAL A 256;TYR A 138;PRO A  40;THR A 187","None","1.34A","4ze1A-3redA:undetectable","4ze1A-3redA:23.32"],["5BTI_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"SER A 270;ARG A  56;GLY A  33;GLU A  55","None;FAD A 773 (-4.2A);FAD A 773 (-3.2A);FAD A 773 (-2.8A)","1.16A","5btiA-3redA:undetectable;5btiB-3redA:undetectable","5btiA-3redA:23.29;5btiB-3redA:21.26"],["5BTI_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"SER A 270;ARG A  56;GLY A  33;GLU A  55","None;FAD A 773 (-4.2A);FAD A 773 (-3.2A);FAD A 773 (-2.8A)","1.19A","5btiC-3redA:undetectable;5btiD-3redA:undetectable","5btiC-3redA:23.29;5btiD-3redA:21.26"],["5DBY_A_NPSA602_1","SERUM ALBUMIN","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 466;PHE A 475;LEU A 506;TYR A 503;SER A 125","None;None;None;FAD A 773 (-4.2A);None","1.50A","5dbyA-3redA:undetectable","5dbyA-3redA:21.28"],["5EB5_A_010A609_0","HNL ISOENZYME 5","3red","HYDROXYNITRILE LYASE","Prunus mume",7,"ALA A 111;ARG A 301;HIS A 358;VAL A 360;TYR A 458;TRP A 459;HIS A 498","FAD A 773 (-3.0A);None;None;None;None;FAD A 773 (-3.8A);FAD A 773 (-4.4A)","0.34A","5eb5A-3redA:64.0","5eb5A-3redA:76.72"],["5EB5_B_010B607_0","HNL ISOENZYME 5","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ALA A 111;ARG A 301;HIS A 358;VAL A 360;HIS A 460","FAD A 773 (-3.0A);None;None;None;FAD A 773 ( 4.4A)","1.45A","5eb5B-3redA:64.1","5eb5B-3redA:76.72"],["5EB5_B_010B607_0","HNL ISOENZYME 5","3red","HYDROXYNITRILE LYASE","Prunus mume",7,"ALA A 111;ARG A 301;HIS A 358;VAL A 360;TYR A 458;TRP A 459;HIS A 498","FAD A 773 (-3.0A);None;None;None;None;FAD A 773 (-3.8A);FAD A 773 (-4.4A)","0.40A","5eb5B-3redA:64.1","5eb5B-3redA:76.72"],["5G08_A_Z80A1187_1","FREQUENIN 2","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"ILE A 427;PHE A 359;THR A 158;TRP A 154","None","1.33A","5g08A-3redA:undetectable","5g08A-3redA:15.43"],["5IGJ_A_CTYA402_2","MACROLIDE 2'-PHOSPHOTRANSFERASE","3red","HYDROXYNITRILE LYASE","Prunus mume",4,"PRO A 300;HIS A 498;LEU A 410;PHE A 331","None;FAD A 773 (-4.4A);None;None","1.43A","5igjA-3redA:undetectable","5igjA-3redA:22.18"],["5IKT_B_TLFB601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",3,"TYR A  11;TYR A 147;SER A   5","None","0.87A","5iktB-3redA:undetectable","5iktB-3redA:21.85"],["5JW1_A_CELA602_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.96A","5jw1A-3redA:undetectable","5jw1A-3redA:20.56"],["5KIR_A_RCXA601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.98A","5kirA-3redA:undetectable","5kirA-3redA:21.85"],["5KIR_B_RCXB601_1","PROSTAGLANDIN G\/H SYNTHASE 2","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 458;ALA A 496;VAL A 113;GLY A 112;ALA A 111","None;None;FAD A 773 (-3.7A);FAD A 773 (-3.9A);FAD A 773 (-3.0A)","0.97A","5kirB-3redA:undetectable","5kirB-3redA:21.85"],["5L5F_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.33A","5l5fV-3redA:undetectable;5l5fb-3redA:undetectable","5l5fV-3redA:17.33;5l5fb-3redA:17.88"],["5L5F_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.33A","5l5fH-3redA:undetectable;5l5fN-3redA:undetectable","5l5fH-3redA:17.33;5l5fN-3redA:17.88"],["5L5Z_B_BO2B201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.34A","5l5zV-3redA:undetectable;5l5zb-3redA:undetectable","5l5zV-3redA:17.33;5l5zb-3redA:17.88"],["5L5Z_N_BO2N201_1","PROTEASOME SUBUNIT BETA TYPE-2;PROTEASOME SUBUNIT BETA TYPE-1","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"HIS A 177;SER A 497;THR A 158;THR A 181;SER A 330","None","1.33A","5l5zH-3redA:undetectable;5l5zN-3redA:undetectable","5l5zH-3redA:17.33;5l5zN-3redA:17.88"],["5VKQ_A_PCFA1803_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"TYR A 419;ILE A 306;ILE A 432;ILE A 312;ASN A 310","None","1.23A","5vkqA-3redA:undetectable;5vkqD-3redA:undetectable","5vkqA-3redA:15.96;5vkqD-3redA:15.96"],["5VKQ_B_PCFB1808_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ILE A 312;ASN A 310;TYR A 419;ILE A 306;ILE A 432","None","1.23A","5vkqA-3redA:undetectable;5vkqB-3redA:undetectable","5vkqA-3redA:15.96;5vkqB-3redA:15.96"],["5VKQ_D_PCFD1801_0","NO MECHANORECEPTOR POTENTIAL C ISOFORM L","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"ILE A 312;ASN A 310;TYR A 419;ILE A 306;ILE A 432","None","1.19A","5vkqC-3redA:undetectable;5vkqD-3redA:undetectable","5vkqC-3redA:15.96;5vkqD-3redA:15.96"],["6QXS_B_FOZB403_0","THYMIDYLATE SYNTHASE","3red","HYDROXYNITRILE LYASE","Prunus mume",5,"LEU A 296;GLY A 370;PHE A 388;ASN A 389;ILE A 372","None","0.91A","6qxsB-3redA:undetectable","6qxsB-3redA:21.52"]]