SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3swd'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_A_EAAA223_1 (GLUTATHIONE TRANSFERASE A1-1)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 8	PHE A 30 GLY A 98 LEU A 129 VAL A 122	None None None EPZ A 501 (-4.2A)	1.06A	1gsfA-3swdA: undetectable	1gsfA-3swdA: 19.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_B_EAAB223_1 (GLUTATHIONE TRANSFERASE A1-1)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 8	PHE A 30 GLY A 98 LEU A 129 VAL A 122	None None None EPZ A 501 (-4.2A)	1.07A	1gsfB-3swdA: undetectable	1gsfB-3swdA: 19.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_D_EAAD223_1 (GLUTATHIONE TRANSFERASE A1-1)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 8	PHE A 30 GLY A 98 LEU A 129 VAL A 122	None None None EPZ A 501 (-4.2A)	1.07A	1gsfD-3swdA: undetectable	1gsfD-3swdA: 19.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HXB_A_ROCA100_1 (HIV-1 PROTEASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	GLY A 133 ALA A 134 GLY A 98 ILE A 169 ILE A 136	None	0.88A	1hxbA-3swdA: undetectable	1hxbA-3swdA: 13.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WMQ_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.84A	1wmqA-3swdA: undetectable	1wmqA-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WMQ_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.84A	1wmqB-3swdA: undetectable	1wmqB-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WPU_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.84A	1wpuA-3swdA: undetectable	1wpuA-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WPU_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.84A	1wpuB-3swdA: undetectable	1wpuB-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WRQ_A_HISA2001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.81A	1wrqA-3swdA: undetectable	1wrqA-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WRQ_B_HISB1001_0 (HUT OPERON POSITIVE REGULATORY PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ILE A 117 GLY A 118 ALA A 119	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) QPA A 115 ( 4.2A) None	0.81A	1wrqB-3swdA: undetectable	1wrqB-3swdA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VUF_B_FUAB2002_1 (SERUM ALBUMIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 9	ILE A 413 ALA A 374 VAL A 377 CYH A 381	None	0.89A	2vufB-3swdA: undetectable	2vufB-3swdA: 20.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MDT_A_VORA506_1 (CHOLESTEROL 24-HYDROXYLASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 9	LEU A 57 VAL A 50 ILE A 28 ALA A 25 ALA A 92	None None None None EPZ A 501 ( 4.0A)	1.29A	3mdtA-3swdA: undetectable	3mdtA-3swdA: 23.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXV_C_478C200_1 (HIV-1 PROTEASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 9	GLY A 270 ALA A 271 ASP A 283 VAL A 240 ILE A 273	None	0.98A	3oxvC-3swdA: undetectable	3oxvC-3swdA: 14.39
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3SU9_A_ACTA426_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	GLN A 108 GLU A 139 LYS A 144	None	0.36A	3su9A-3swdA: 69.8	3su9A-3swdA: 93.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_C_RTZC1_1 (CYTOCHROME P450 2D6)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	LEU A 198 PHE A 197 GLY A 98 LEU A 100 PHE A 104	None	1.32A	3tbgC-3swdA: undetectable	3tbgC-3swdA: 21.39
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_A_ACTA502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 5	TYR A 84 VAL A 87 SER A 110 GLY A 113	None	0.25A	3v4tA-3swdA: 68.7 3v4tD-3swdA: 69.2	3v4tA-3swdA: 93.30 3v4tD-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_C_ACTC502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	PRO A 256 ASP A 257 GLU A 277	None	0.48A	3v4tC-3swdA: 68.6	3v4tC-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_D_ACTD502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	GLY A 8 THR A 10 ASN A 412	None	0.17A	3v4tD-3swdA: 69.2	3v4tD-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_E_ACTE502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	LYS A 22 ARG A 120 LEU A 370	EPZ A 501 (-2.7A) EPZ A 501 (-4.1A) EPZ A 501 ( 4.6A)	0.78A	3v4tE-3swdA: 68.5	3v4tE-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_E_ACTE502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	LYS A 22 ARG A 331 LEU A 370	EPZ A 501 (-2.7A) EPZ A 501 ( 4.2A) EPZ A 501 ( 4.6A)	0.97A	3v4tE-3swdA: 68.5	3v4tE-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_E_ACTE503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	GLN A 7 THR A 10 ASN A 412	None	0.73A	3v4tE-3swdA: 68.5	3v4tE-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_H_ACTH502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	SER A 206 GLY A 207 GLN A 208	None	0.20A	3v4tH-3swdA: 68.9	3v4tH-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_H_ACTH503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	6 / 7	ALA A 92 ILE A 94 TRP A 95 ARG A 120 HIS A 125 GLY A 164	EPZ A 501 ( 4.0A) None None EPZ A 501 (-4.1A) None EPZ A 501 (-3.2A)	0.42A	3v4tH-3swdA: 68.9	3v4tH-3swdA: 93.30
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3V4T_H_ACTH503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 7	ARG A 91 ALA A 92 ILE A 94 ARG A 120 HIS A 125	QPA A 115 ( 4.1A) EPZ A 501 ( 4.0A) None EPZ A 501 (-4.1A) None	0.76A	3v4tH-3swdA: 68.9	3v4tH-3swdA: 93.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VRM_A_VD3A502_1 (VITAMIN D(3) 25-HYDROXYLASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	6 / 12	ILE A 244 MET A 306 LEU A 312 ALA A 379 ILE A 249 LEU A 406	None	1.50A	3vrmA-3swdA: undetectable	3vrmA-3swdA: 23.55
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4E7C_C_ACTC506_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 5	ARG A 91 ILE A 94 TRP A 95 GLY A 164	QPA A 115 ( 4.1A) None None EPZ A 501 (-3.2A)	0.80A	4e7cC-3swdA: 62.3	4e7cC-3swdA: 93.54
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4E7C_C_ACTC506_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 5	ILE A 94 TRP A 95 HIS A 125 GLY A 164	None None None EPZ A 501 (-3.2A)	0.36A	4e7cC-3swdA: 62.3	4e7cC-3swdA: 93.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FWD_A_BO2A801_1 (TTC1975 PEPTIDASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 9	VAL A 214 VAL A 157 ILE A 156 GLY A 153 ALA A 173	None	1.20A	4fwdA-3swdA: undetectable	4fwdA-3swdA: 22.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4I1N_A_FOLA201_0 (DIHYDROFOLATE REDUCTASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 11	ILE A 41 ALA A 24 ASP A 193 PHE A 197 LEU A 201	None	1.36A	4i1nA-3swdA: undetectable	4i1nA-3swdA: 17.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L6V_1_PQN12001_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A1 FUSION PROTEIN OF PHOTOSYSTEM I SUBUNIT III AND SUBUNIT IX)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 11	GLY A 14 ALA A 242 LEU A 12 GLY A 410 ALA A 367	None	1.13A	4l6v1-3swdA: undetectable 4l6v6-3swdA: undetectable	4l6v1-3swdA: 20.79 4l6v6-3swdA: 15.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWZ_A_SAMA301_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	ILE A 182 GLY A 128 MET A 158 ILE A 126 LEU A 97	None	1.09A	4mwzA-3swdA: undetectable	4mwzA-3swdA: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R29_D_SAMD301_0 (UNCHARACTERIZED PROTEIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	GLY A 68 GLN A 42 ILE A 28 ALA A 24 GLU A 234	IAS A 67 ( 2.4A) None None None None	1.03A	4r29D-3swdA: undetectable	4r29D-3swdA: 20.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_A_AG2A506_1 (HOMOSPERMIDINE SYNTHASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ARG A 331 ARG A 371 ASP A 369	EPZ A 501 (-4.1A) EPZ A 501 ( 4.2A) None None	1.42A	4xqeA-3swdA: undetectable	4xqeA-3swdA: 24.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_B_AG2B505_1 (HOMOSPERMIDINE SYNTHASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ARG A 120 ARG A 331 ARG A 371 ASP A 369	EPZ A 501 (-4.1A) EPZ A 501 ( 4.2A) None None	1.36A	4xqeB-3swdA: undetectable	4xqeB-3swdA: 24.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z69_A_DIFA1007_1 (SERUM ALBUMIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 9	ARG A 103 LEU A 100 LEU A 56 SER A 58 ALA A 62	None	1.34A	4z69A-3swdA: undetectable	4z69A-3swdA: 20.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5AXA_A_ADNA502_2 (ADENOSYLHOMOCYSTEINA SE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 5	GLU A 325 THR A 324 HIS A 344 LEU A 315	None	1.12A	5axaA-3swdA: undetectable	5axaA-3swdA: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 7	SER A 69 ASP A 73 ARG A 75 GLY A 223 GLU A 37	None	1.36A	5btaA-3swdA: undetectable 5btaC-3swdA: undetectable 5btaD-3swdA: undetectable	5btaA-3swdA: 24.81 5btaC-3swdA: 24.81 5btaD-3swdA: 22.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 7	SER A 69 ASP A 73 ARG A 75 GLY A 223 GLU A 37	None	1.39A	5btfA-3swdA: undetectable 5btfB-3swdA: undetectable 5btfC-3swdA: undetectable	5btfA-3swdA: 24.81 5btfB-3swdA: 22.33 5btfC-3swdA: 24.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HS6_A_J3ZA302_1 (17-BETA-HYDROXYSTERO ID DEHYDROGENASE 14)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 8	HIS A 334 GLN A 307 LEU A 376 THR A 237	None	1.15A	5hs6A-3swdA: undetectable	5hs6A-3swdA: 23.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MO4_A_NILA601_2 (TYROSINE-PROTEIN KINASE ABL1)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	ALA A 203 VAL A 228 ILE A 41 LEU A 34 ALA A 31	None	0.78A	5mo4A-3swdA: undetectable	5mo4A-3swdA: 25.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UMD_A_YMZA3801_1 (60S RIBOSOMAL PROTEIN L28 28S RIBOSOMAL RNA 60S RIBOSOMAL PROTEIN L4)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	4 / 6	ALA A 92 PRO A 112 VAL A 87 ASP A 49	EPZ A 501 ( 4.0A) None None None	0.90A	5umd2-3swdA: undetectable 5umdF-3swdA: undetectable	5umd2-3swdA: 11.55 5umdF-3swdA: 12.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VLM_D_CVID301_0 (REGULATORY PROTEIN TETR)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	ALA A 96 LEU A 26 TYR A 226 ASP A 193 PHE A 197	None	1.49A	5vlmD-3swdA: undetectable	5vlmD-3swdA: 19.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BXL_B_SAMB401_0 (2-(3-AMINO-3-CARBOXY PROPYL)HISTIDINE SYNTHASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	TYR A 393 LEU A 47 GLY A 398 VAL A 389 ASP A 369	None	1.38A	6bxlB-3swdA: undetectable	6bxlB-3swdA: 24.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EKU_A_ZMRA901_1 (SIALIDASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	ARG A 120 ILE A 117 ASN A 23 ARG A 397 ASP A 49	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) EPZ A 501 (-3.1A) QPA A 115 ( 2.9A) None	1.28A	6ekuA-3swdA: undetectable	6ekuA-3swdA: 19.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EKU_A_ZMRA901_1 (SIALIDASE)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	5 / 12	ARG A 120 ILE A 117 ASP A 369 ASN A 23 ASP A 49	EPZ A 501 (-4.1A) QPA A 115 ( 4.4A) None EPZ A 501 (-3.1A) None	1.28A	6ekuA-3swdA: undetectable	6ekuA-3swdA: 19.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA826_0 (GEPHYRIN)	3swd	UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE (Escherichia coli)	3 / 3	HIS A 155 ARG A 212 ILE A 181	None	0.51A	6fgdA-3swdA: undetectable	6fgdA-3swdA: 24.90

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1GSF_A_EAAA223_1","GLUTATHIONE TRANSFERASE A1-1","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"PHE A  30;GLY A  98;LEU A 129;VAL A 122","None;None;None;EPZ A 501 (-4.2A)","1.06A","1gsfA-3swdA:undetectable","1gsfA-3swdA:19.71"],["1GSF_B_EAAB223_1","GLUTATHIONE TRANSFERASE A1-1","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"PHE A  30;GLY A  98;LEU A 129;VAL A 122","None;None;None;EPZ A 501 (-4.2A)","1.07A","1gsfB-3swdA:undetectable","1gsfB-3swdA:19.71"],["1GSF_D_EAAD223_1","GLUTATHIONE TRANSFERASE A1-1","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"PHE A  30;GLY A  98;LEU A 129;VAL A 122","None;None;None;EPZ A 501 (-4.2A)","1.07A","1gsfD-3swdA:undetectable","1gsfD-3swdA:19.71"],["1HXB_A_ROCA100_1","HIV-1 PROTEASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"GLY A 133;ALA A 134;GLY A  98;ILE A 169;ILE A 136","None","0.88A","1hxbA-3swdA:undetectable","1hxbA-3swdA:13.56"],["1WMQ_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.84A","1wmqA-3swdA:undetectable","1wmqA-3swdA:19.17"],["1WMQ_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.84A","1wmqB-3swdA:undetectable","1wmqB-3swdA:19.17"],["1WPU_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.84A","1wpuA-3swdA:undetectable","1wpuA-3swdA:19.17"],["1WPU_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.84A","1wpuB-3swdA:undetectable","1wpuB-3swdA:19.17"],["1WRQ_A_HISA2001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.81A","1wrqA-3swdA:undetectable","1wrqA-3swdA:19.17"],["1WRQ_B_HISB1001_0","HUT OPERON POSITIVE REGULATORY PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ILE A 117;GLY A 118;ALA A 119","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);QPA A 115 ( 4.2A);None","0.81A","1wrqB-3swdA:undetectable","1wrqB-3swdA:19.17"],["2VUF_B_FUAB2002_1","SERUM ALBUMIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ILE A 413;ALA A 374;VAL A 377;CYH A 381","None","0.89A","2vufB-3swdA:undetectable","2vufB-3swdA:20.58"],["3MDT_A_VORA506_1","CHOLESTEROL 24-HYDROXYLASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"LEU A  57;VAL A  50;ILE A  28;ALA A  25;ALA A  92","None;None;None;None;EPZ A 501 ( 4.0A)","1.29A","3mdtA-3swdA:undetectable","3mdtA-3swdA:23.82"],["3OXV_C_478C200_1","HIV-1 PROTEASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"GLY A 270;ALA A 271;ASP A 283;VAL A 240;ILE A 273","None","0.98A","3oxvC-3swdA:undetectable","3oxvC-3swdA:14.39"],["3SU9_A_ACTA426_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"GLN A 108;GLU A 139;LYS A 144","None","0.36A","3su9A-3swdA:69.8","3su9A-3swdA:93.54"],["3TBG_C_RTZC1_1","CYTOCHROME P450 2D6","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"LEU A 198;PHE A 197;GLY A  98;LEU A 100;PHE A 104","None","1.32A","3tbgC-3swdA:undetectable","3tbgC-3swdA:21.39"],["3V4T_A_ACTA502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"TYR A  84;VAL A  87;SER A 110;GLY A 113","None","0.25A","3v4tA-3swdA:68.7;3v4tD-3swdA:69.2","3v4tA-3swdA:93.30;3v4tD-3swdA:93.30"],["3V4T_C_ACTC502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"PRO A 256;ASP A 257;GLU A 277","None","0.48A","3v4tC-3swdA:68.6","3v4tC-3swdA:93.30"],["3V4T_D_ACTD502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"GLY A   8;THR A  10;ASN A 412","None","0.17A","3v4tD-3swdA:69.2","3v4tD-3swdA:93.30"],["3V4T_E_ACTE502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"LYS A  22;ARG A 120;LEU A 370","EPZ A 501 (-2.7A);EPZ A 501 (-4.1A);EPZ A 501 ( 4.6A)","0.78A","3v4tE-3swdA:68.5","3v4tE-3swdA:93.30"],["3V4T_E_ACTE502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"LYS A  22;ARG A 331;LEU A 370","EPZ A 501 (-2.7A);EPZ A 501 ( 4.2A);EPZ A 501 ( 4.6A)","0.97A","3v4tE-3swdA:68.5","3v4tE-3swdA:93.30"],["3V4T_E_ACTE503_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"GLN A   7;THR A  10;ASN A 412","None","0.73A","3v4tE-3swdA:68.5","3v4tE-3swdA:93.30"],["3V4T_H_ACTH502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"SER A 206;GLY A 207;GLN A 208","None","0.20A","3v4tH-3swdA:68.9","3v4tH-3swdA:93.30"],["3V4T_H_ACTH503_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",6,"ALA A  92;ILE A  94;TRP A  95;ARG A 120;HIS A 125;GLY A 164","EPZ A 501 ( 4.0A);None;None;EPZ A 501 (-4.1A);None;EPZ A 501 (-3.2A)","0.42A","3v4tH-3swdA:68.9","3v4tH-3swdA:93.30"],["3V4T_H_ACTH503_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ARG A  91;ALA A  92;ILE A  94;ARG A 120;HIS A 125","QPA A 115 ( 4.1A);EPZ A 501 ( 4.0A);None;EPZ A 501 (-4.1A);None","0.76A","3v4tH-3swdA:68.9","3v4tH-3swdA:93.30"],["3VRM_A_VD3A502_1","VITAMIN D(3) 25-HYDROXYLASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",6,"ILE A 244;MET A 306;LEU A 312;ALA A 379;ILE A 249;LEU A 406","None","1.50A","3vrmA-3swdA:undetectable","3vrmA-3swdA:23.55"],["4E7C_C_ACTC506_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A  91;ILE A  94;TRP A  95;GLY A 164","QPA A 115 ( 4.1A);None;None;EPZ A 501 (-3.2A)","0.80A","4e7cC-3swdA:62.3","4e7cC-3swdA:93.54"],["4E7C_C_ACTC506_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ILE A  94;TRP A  95;HIS A 125;GLY A 164","None;None;None;EPZ A 501 (-3.2A)","0.36A","4e7cC-3swdA:62.3","4e7cC-3swdA:93.54"],["4FWD_A_BO2A801_1","TTC1975 PEPTIDASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"VAL A 214;VAL A 157;ILE A 156;GLY A 153;ALA A 173","None","1.20A","4fwdA-3swdA:undetectable","4fwdA-3swdA:22.51"],["4I1N_A_FOLA201_0","DIHYDROFOLATE REDUCTASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ILE A  41;ALA A  24;ASP A 193;PHE A 197;LEU A 201","None","1.36A","4i1nA-3swdA:undetectable","4i1nA-3swdA:17.79"],["4L6V_1_PQN12001_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A1;FUSION PROTEIN OF PHOTOSYSTEM I SUBUNIT III AND SUBUNIT IX","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"GLY A  14;ALA A 242;LEU A  12;GLY A 410;ALA A 367","None","1.13A","4l6v1-3swdA:undetectable;4l6v6-3swdA:undetectable","4l6v1-3swdA:20.79;4l6v6-3swdA:15.69"],["4MWZ_A_SAMA301_0","PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ILE A 182;GLY A 128;MET A 158;ILE A 126;LEU A  97","None","1.09A","4mwzA-3swdA:undetectable","4mwzA-3swdA:20.49"],["4R29_D_SAMD301_0","UNCHARACTERIZED PROTEIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"GLY A  68;GLN A  42;ILE A  28;ALA A  24;GLU A 234","IAS A  67 ( 2.4A);None;None;None;None","1.03A","4r29D-3swdA:undetectable","4r29D-3swdA:20.86"],["4XQE_A_AG2A506_1","HOMOSPERMIDINE SYNTHASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ARG A 331;ARG A 371;ASP A 369","EPZ A 501 (-4.1A);EPZ A 501 ( 4.2A);None;None","1.42A","4xqeA-3swdA:undetectable","4xqeA-3swdA:24.14"],["4XQE_B_AG2B505_1","HOMOSPERMIDINE SYNTHASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ARG A 120;ARG A 331;ARG A 371;ASP A 369","EPZ A 501 (-4.1A);EPZ A 501 ( 4.2A);None;None","1.36A","4xqeB-3swdA:undetectable","4xqeB-3swdA:24.14"],["4Z69_A_DIFA1007_1","SERUM ALBUMIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ARG A 103;LEU A 100;LEU A  56;SER A  58;ALA A  62","None","1.34A","4z69A-3swdA:undetectable","4z69A-3swdA:20.58"],["5AXA_A_ADNA502_2","ADENOSYLHOMOCYSTEINASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"GLU A 325;THR A 324;HIS A 344;LEU A 315","None","1.12A","5axaA-3swdA:undetectable","5axaA-3swdA:22.08"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"SER A  69;ASP A  73;ARG A  75;GLY A 223;GLU A  37","None","1.36A","5btaA-3swdA:undetectable;5btaC-3swdA:undetectable;5btaD-3swdA:undetectable","5btaA-3swdA:24.81;5btaC-3swdA:24.81;5btaD-3swdA:22.33"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"SER A  69;ASP A  73;ARG A  75;GLY A 223;GLU A  37","None","1.39A","5btfA-3swdA:undetectable;5btfB-3swdA:undetectable;5btfC-3swdA:undetectable","5btfA-3swdA:24.81;5btfB-3swdA:22.33;5btfC-3swdA:24.81"],["5HS6_A_J3ZA302_1","17-BETA-HYDROXYSTEROID DEHYDROGENASE 14","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"HIS A 334;GLN A 307;LEU A 376;THR A 237","None","1.15A","5hs6A-3swdA:undetectable","5hs6A-3swdA:23.08"],["5MO4_A_NILA601_2","TYROSINE-PROTEIN KINASE ABL1","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ALA A 203;VAL A 228;ILE A  41;LEU A  34;ALA A  31","None","0.78A","5mo4A-3swdA:undetectable","5mo4A-3swdA:25.19"],["5UMD_A_YMZA3801_1","60S RIBOSOMAL PROTEIN L28;28S RIBOSOMAL RNA;60S RIBOSOMAL PROTEIN L4","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",4,"ALA A  92;PRO A 112;VAL A  87;ASP A  49","EPZ A 501 ( 4.0A);None;None;None","0.90A","5umd2-3swdA:undetectable;5umdF-3swdA:undetectable","5umd2-3swdA:11.55;5umdF-3swdA:12.47"],["5VLM_D_CVID301_0","REGULATORY PROTEIN TETR","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ALA A  96;LEU A  26;TYR A 226;ASP A 193;PHE A 197","None","1.49A","5vlmD-3swdA:undetectable","5vlmD-3swdA:19.19"],["6BXL_B_SAMB401_0","2-(3-AMINO-3-CARBOXYPROPYL)HISTIDINE SYNTHASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"TYR A 393;LEU A  47;GLY A 398;VAL A 389;ASP A 369","None","1.38A","6bxlB-3swdA:undetectable","6bxlB-3swdA:24.55"],["6EKU_A_ZMRA901_1","SIALIDASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ARG A 120;ILE A 117;ASN A  23;ARG A 397;ASP A  49","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);EPZ A 501 (-3.1A);QPA A 115 ( 2.9A);None","1.28A","6ekuA-3swdA:undetectable","6ekuA-3swdA:19.79"],["6EKU_A_ZMRA901_1","SIALIDASE","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",5,"ARG A 120;ILE A 117;ASP A 369;ASN A  23;ASP A  49","EPZ A 501 (-4.1A);QPA A 115 ( 4.4A);None;EPZ A 501 (-3.1A);None","1.28A","6ekuA-3swdA:undetectable","6ekuA-3swdA:19.79"],["6FGD_A_ACTA826_0","GEPHYRIN","3swd","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","Escherichia coli",3,"HIS A 155;ARG A 212;ILE A 181","None","0.51A","6fgdA-3swdA:undetectable","6fgdA-3swdA:24.90"]]