SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3t7v'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PJ7_A_FFOA2887_1 (N,N-DIMETHYLGLYCINE OXIDASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	3 / 3	ASP A 279 THR A 298 GLU A 205	MD0 A 993 (-3.6A) MD0 A 993 (-3.4A) None	0.71A	1pj7A-3t7vA: undetectable	1pj7A-3t7vA: 18.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VID_A_SAMA301_1 (CATECHOL O-METHYLTRANSFERASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 5	SER A 222 GLU A 171 TYR A 169 SER A 76	None SAM A 992 (-2.8A) SAM A 992 ( 4.6A) None	1.44A	1vidA-3t7vA: undetectable	1vidA-3t7vA: 22.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZGY_A_BRLA503_1 (PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	PHE A 64 SER A 305 TYR A 89 LEU A 91 LEU A 113	MD0 A 993 (-3.7A) None None None None	1.28A	1zgyA-3t7vA: undetectable	1zgyA-3t7vA: 21.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XZ5_C_ACHC1211_0 (SOLUBLE ACETYLCHOLINE RECEPTOR)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 8	THR A 99 SER A 305 TYR A 66 TYR A 89	None	1.32A	2xz5A-3t7vA: undetectable 2xz5C-3t7vA: undetectable	2xz5A-3t7vA: 20.45 2xz5C-3t7vA: 20.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZVJ_A_SAMA301_1 (CATECHOL O-METHYLTRANSFERASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 6	SER A 222 GLU A 171 TYR A 169 SER A 76	None SAM A 992 (-2.8A) SAM A 992 ( 4.6A) None	1.40A	2zvjA-3t7vA: undetectable	2zvjA-3t7vA: 22.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DEU_B_SALB306_1 (TRANSCRIPTIONAL REGULATOR SLYA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 6	THR A 219 SER A 257 LEU A 256 THR A 210	None	0.93A	3deuB-3t7vA: undetectable	3deuB-3t7vA: 18.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IV6_C_SAMC301_0 (PUTATIVE ZN-DEPENDENT ALCOHOL DEHYDROGENASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	ARG A 340 GLY A 107 ASP A 323 ILE A 300 LEU A 61	None	1.28A	3iv6C-3t7vA: undetectable	3iv6C-3t7vA: 22.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUF_B_SUEB1201_2 (NS3 PROTEASE, NS4A PROTEIN)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	3 / 3	TYR A 54 LEU A 61 ARG A 51	None	0.81A	3sufB-3t7vA: undetectable	3sufB-3t7vA: 21.22
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3T7V_A_SAMA992_0 (METHYLORNITHINE SYNTHASE PYLB)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	6 / 12	THR A 114 GLY A 116 GLY A 148 TYR A 169 ARG A 190 MET A 237	MD0 A 993 (-4.0A) SF4 A 991 ( 3.7A) SAM A 992 ( 3.8A) SAM A 992 ( 4.6A) SAM A 992 (-3.3A) MD0 A 993 (-3.9A)	1.03A	3t7vA-3t7vA: 63.9	3t7vA-3t7vA: 100.00
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3T7V_A_SAMA992_0 (METHYLORNITHINE SYNTHASE PYLB)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	12 / 12	THR A 114 GLY A 116 GLY A 148 TYR A 169 GLU A 171 ARG A 182 ARG A 190 LEU A 209 MET A 237 GLN A 242 VAL A 310 ALA A 311	MD0 A 993 (-4.0A) SF4 A 991 ( 3.7A) SAM A 992 ( 3.8A) SAM A 992 ( 4.6A) SAM A 992 (-2.8A) SAM A 992 ( 2.7A) SAM A 992 (-3.3A) SAM A 992 (-4.8A) MD0 A 993 (-3.9A) SAM A 992 (-4.2A) SAM A 992 (-3.7A) SAM A 992 ( 3.8A)	0.03A	3t7vA-3t7vA: 63.9	3t7vA-3t7vA: 100.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V81_A_NVPA901_1 (HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 8	LEU A 166 LYS A 198 LEU A 155 TYR A 202	None	1.07A	3v81A-3t7vA: undetectable	3v81A-3t7vA: 21.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DX5_B_MIYB1103_1 (ACRIFLAVINE RESISTANCE PROTEIN B)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	GLY A 285 ASP A 279 ALA A 276 VAL A 297 ARG A 322	None MD0 A 993 (-3.6A) None None None	0.89A	4dx5B-3t7vA: undetectable	4dx5B-3t7vA: 17.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J24_A_ESTA600_1 (ESTROGEN RECEPTOR BETA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	LEU A 209 GLU A 171 MET A 226 ILE A 262 ILE A 274	SAM A 992 (-4.8A) SAM A 992 (-2.8A) None None None	1.12A	4j24A-3t7vA: undetectable	4j24A-3t7vA: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J24_B_ESTB600_1 (ESTROGEN RECEPTOR BETA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	LEU A 209 GLU A 171 MET A 226 ILE A 262 ILE A 274	SAM A 992 (-4.8A) SAM A 992 (-2.8A) None None None	1.08A	4j24B-3t7vA: undetectable	4j24B-3t7vA: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J24_C_ESTC600_1 (ESTROGEN RECEPTOR BETA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	LEU A 209 GLU A 171 MET A 226 ILE A 262 ILE A 274	SAM A 992 (-4.8A) SAM A 992 (-2.8A) None None None	1.11A	4j24C-3t7vA: undetectable	4j24C-3t7vA: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J26_B_ESTB600_1 (ESTROGEN RECEPTOR BETA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	LEU A 209 GLU A 171 MET A 226 ILE A 262 ILE A 274	SAM A 992 (-4.8A) SAM A 992 (-2.8A) None None None	1.06A	4j26B-3t7vA: undetectable	4j26B-3t7vA: 22.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6X_I_HCYI900_2 (GLUCOCORTICOID RECEPTOR)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	3 / 3	MET A 150 MET A 144 TYR A 121	None MD0 A 993 ( 4.5A) None	1.25A	4p6xI-3t7vA: undetectable	4p6xI-3t7vA: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4U95_B_MIYB1102_1 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	GLY A 285 ASP A 279 ALA A 276 VAL A 297 ARG A 322	None MD0 A 993 (-3.6A) None None None	0.92A	4u95B-3t7vA: undetectable	4u95B-3t7vA: 17.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UHX_A_LZUA3008_1 (ALDEHYDE OXIDASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 8	GLU A 117 ASP A 118 ARG A 90 PRO A 147	None	1.14A	4uhxA-3t7vA: undetectable	4uhxA-3t7vA: 13.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UHX_A_RTZA3009_1 (ALDEHYDE OXIDASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 8	GLU A 117 ASP A 118 ARG A 90 PRO A 147	None	1.14A	4uhxA-3t7vA: undetectable	4uhxA-3t7vA: 13.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YMG_B_SAMB1001_1 (PUTATIVE SAM-DEPENDENT O-METHYLTRANFERASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	3 / 3	SER A 277 GLU A 171 GLU A 117	MD0 A 993 (-2.6A) SAM A 992 (-2.8A) None	0.76A	4ymgB-3t7vA: undetectable	4ymgB-3t7vA: 19.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 7	ARG A 48 ARG A 289 THR A 238 GLU A 258	None	0.74A	5bs8A-3t7vA: undetectable 5bs8C-3t7vA: undetectable 5bs8D-3t7vA: undetectable	5bs8A-3t7vA: 24.86 5bs8C-3t7vA: 24.86 5bs8D-3t7vA: 23.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 7	ARG A 48 ARG A 289 THR A 238 GLU A 258	None	0.74A	5btaA-3t7vA: undetectable 5btaC-3t7vA: undetectable 5btaD-3t7vA: undetectable	5btaA-3t7vA: 24.86 5btaC-3t7vA: 24.86 5btaD-3t7vA: 23.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 6	ARG A 289 THR A 238 GLU A 258 ARG A 48	None	0.74A	5btaA-3t7vA: undetectable 5btaB-3t7vA: undetectable 5btaC-3t7vA: undetectable	5btaA-3t7vA: 24.86 5btaB-3t7vA: 23.90 5btaC-3t7vA: 24.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 6	ARG A 289 THR A 238 GLU A 258 ARG A 48	None	0.76A	5btcA-3t7vA: undetectable 5btcB-3t7vA: undetectable 5btcC-3t7vA: undetectable	5btcA-3t7vA: 24.86 5btcB-3t7vA: 23.90 5btcC-3t7vA: 24.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 7	ARG A 289 THR A 238 GLU A 258 ARG A 48	None	0.79A	5btfA-3t7vA: undetectable 5btfB-3t7vA: undetectable 5btfC-3t7vA: undetectable	5btfA-3t7vA: 24.86 5btfB-3t7vA: 23.90 5btfC-3t7vA: 24.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 6	ARG A 289 THR A 238 GLU A 258 ARG A 48	None	0.73A	5btgA-3t7vA: undetectable 5btgB-3t7vA: undetectable 5btgC-3t7vA: undetectable	5btgA-3t7vA: 24.86 5btgB-3t7vA: 23.90 5btgC-3t7vA: 24.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 7	ARG A 48 ARG A 289 THR A 238 GLU A 258	None	0.89A	5btgA-3t7vA: undetectable 5btgC-3t7vA: undetectable 5btgD-3t7vA: undetectable	5btgA-3t7vA: 24.86 5btgC-3t7vA: 24.86 5btgD-3t7vA: 23.90
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5FEP_A_SAMA407_0 ([FEFE] HYDROGENASE MATURASE SUBUNIT HYDE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	CYH A 78 GLY A 148 LEU A 168 ARG A 190 TYR A 66	SF4 A 991 (-2.3A) SAM A 992 ( 3.8A) None SAM A 992 (-3.3A) None	0.83A	5fepA-3t7vA: 38.3	5fepA-3t7vA: 30.49
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5FEP_A_SAMA407_0 ([FEFE] HYDROGENASE MATURASE SUBUNIT HYDE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	CYH A 78 SER A 146 GLY A 148 LEU A 168 ARG A 190	SF4 A 991 (-2.3A) MD0 A 993 (-2.8A) SAM A 992 ( 3.8A) None SAM A 992 (-3.3A)	0.51A	5fepA-3t7vA: 38.3	5fepA-3t7vA: 30.49
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5FES_A_SAMA408_0 ([FEFE] HYDROGENASE MATURASE SUBUNIT HYDE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	CYH A 78 GLY A 148 LEU A 168 ARG A 190 TYR A 66	SF4 A 991 (-2.3A) SAM A 992 ( 3.8A) None SAM A 992 (-3.3A) None	0.80A	5fesA-3t7vA: 38.5	5fesA-3t7vA: 30.49
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5FES_A_SAMA408_0 ([FEFE] HYDROGENASE MATURASE SUBUNIT HYDE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	5 / 12	CYH A 78 SER A 146 GLY A 148 LEU A 168 ARG A 190	SF4 A 991 (-2.3A) MD0 A 993 (-2.8A) SAM A 992 ( 3.8A) None SAM A 992 (-3.3A)	0.51A	5fesA-3t7vA: 38.5	5fesA-3t7vA: 30.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHR_A_SAMA303_1 (CATECHOL O-METHYLTRANSFERASE)	3t7v	METHYLORNITHINE SYNTHASE PYLB (Methanosarcina barkeri)	4 / 5	SER A 222 GLU A 171 TYR A 169 SER A 76	None SAM A 992 (-2.8A) SAM A 992 ( 4.6A) None	1.44A	5fhrA-3t7vA: undetectable	5fhrA-3t7vA: 22.73

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1PJ7_A_FFOA2887_1","N,N-DIMETHYLGLYCINE OXIDASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",3,"ASP A 279;THR A 298;GLU A 205","MD0 A 993 (-3.6A);MD0 A 993 (-3.4A);None","0.71A","1pj7A-3t7vA:undetectable","1pj7A-3t7vA:18.83"],["1VID_A_SAMA301_1","CATECHOL O-METHYLTRANSFERASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"SER A 222;GLU A 171;TYR A 169;SER A  76","None;SAM A 992 (-2.8A);SAM A 992 ( 4.6A);None","1.44A","1vidA-3t7vA:undetectable","1vidA-3t7vA:22.35"],["1ZGY_A_BRLA503_1","PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"PHE A  64;SER A 305;TYR A  89;LEU A  91;LEU A 113","MD0 A 993 (-3.7A);None;None;None;None","1.28A","1zgyA-3t7vA:undetectable","1zgyA-3t7vA:21.95"],["2XZ5_C_ACHC1211_0","SOLUBLE ACETYLCHOLINE RECEPTOR","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"THR A  99;SER A 305;TYR A  66;TYR A  89","None","1.32A","2xz5A-3t7vA:undetectable;2xz5C-3t7vA:undetectable","2xz5A-3t7vA:20.45;2xz5C-3t7vA:20.45"],["2ZVJ_A_SAMA301_1","CATECHOL O-METHYLTRANSFERASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"SER A 222;GLU A 171;TYR A 169;SER A  76","None;SAM A 992 (-2.8A);SAM A 992 ( 4.6A);None","1.40A","2zvjA-3t7vA:undetectable","2zvjA-3t7vA:22.35"],["3DEU_B_SALB306_1","TRANSCRIPTIONAL REGULATOR SLYA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"THR A 219;SER A 257;LEU A 256;THR A 210","None","0.93A","3deuB-3t7vA:undetectable","3deuB-3t7vA:18.98"],["3IV6_C_SAMC301_0","PUTATIVE ZN-DEPENDENT ALCOHOL DEHYDROGENASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"ARG A 340;GLY A 107;ASP A 323;ILE A 300;LEU A  61","None","1.28A","3iv6C-3t7vA:undetectable","3iv6C-3t7vA:22.01"],["3SUF_B_SUEB1201_2","NS3 PROTEASE, NS4A PROTEIN","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",3,"TYR A  54;LEU A  61;ARG A  51","None","0.81A","3sufB-3t7vA:undetectable","3sufB-3t7vA:21.22"],["3T7V_A_SAMA992_0","METHYLORNITHINE SYNTHASE PYLB","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",6,"THR A 114;GLY A 116;GLY A 148;TYR A 169;ARG A 190;MET A 237","MD0 A 993 (-4.0A);SF4 A 991 ( 3.7A);SAM A 992 ( 3.8A);SAM A 992 ( 4.6A);SAM A 992 (-3.3A);MD0 A 993 (-3.9A)","1.03A","3t7vA-3t7vA:63.9","3t7vA-3t7vA:100.00"],["3T7V_A_SAMA992_0","METHYLORNITHINE SYNTHASE PYLB","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",12,"THR A 114;GLY A 116;GLY A 148;TYR A 169;GLU A 171;ARG A 182;ARG A 190;LEU A 209;MET A 237;GLN A 242;VAL A 310;ALA A 311","MD0 A 993 (-4.0A);SF4 A 991 ( 3.7A);SAM A 992 ( 3.8A);SAM A 992 ( 4.6A);SAM A 992 (-2.8A);SAM A 992 ( 2.7A);SAM A 992 (-3.3A);SAM A 992 (-4.8A);MD0 A 993 (-3.9A);SAM A 992 (-4.2A);SAM A 992 (-3.7A);SAM A 992 ( 3.8A)","0.03A","3t7vA-3t7vA:63.9","3t7vA-3t7vA:100.00"],["3V81_A_NVPA901_1","HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"LEU A 166;LYS A 198;LEU A 155;TYR A 202","None","1.07A","3v81A-3t7vA:undetectable","3v81A-3t7vA:21.07"],["4DX5_B_MIYB1103_1","ACRIFLAVINE RESISTANCE PROTEIN B","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"GLY A 285;ASP A 279;ALA A 276;VAL A 297;ARG A 322","None;MD0 A 993 (-3.6A);None;None;None","0.89A","4dx5B-3t7vA:undetectable","4dx5B-3t7vA:17.16"],["4J24_A_ESTA600_1","ESTROGEN RECEPTOR BETA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"LEU A 209;GLU A 171;MET A 226;ILE A 262;ILE A 274","SAM A 992 (-4.8A);SAM A 992 (-2.8A);None;None;None","1.12A","4j24A-3t7vA:undetectable","4j24A-3t7vA:22.50"],["4J24_B_ESTB600_1","ESTROGEN RECEPTOR BETA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"LEU A 209;GLU A 171;MET A 226;ILE A 262;ILE A 274","SAM A 992 (-4.8A);SAM A 992 (-2.8A);None;None;None","1.08A","4j24B-3t7vA:undetectable","4j24B-3t7vA:22.50"],["4J24_C_ESTC600_1","ESTROGEN RECEPTOR BETA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"LEU A 209;GLU A 171;MET A 226;ILE A 262;ILE A 274","SAM A 992 (-4.8A);SAM A 992 (-2.8A);None;None;None","1.11A","4j24C-3t7vA:undetectable","4j24C-3t7vA:22.50"],["4J26_B_ESTB600_1","ESTROGEN RECEPTOR BETA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"LEU A 209;GLU A 171;MET A 226;ILE A 262;ILE A 274","SAM A 992 (-4.8A);SAM A 992 (-2.8A);None;None;None","1.06A","4j26B-3t7vA:undetectable","4j26B-3t7vA:22.50"],["4P6X_I_HCYI900_2","GLUCOCORTICOID RECEPTOR","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",3,"MET A 150;MET A 144;TYR A 121","None;MD0 A 993 ( 4.5A);None","1.25A","4p6xI-3t7vA:undetectable","4p6xI-3t7vA:20.56"],["4U95_B_MIYB1102_1","MULTIDRUG EFFLUX PUMP SUBUNIT ACRB","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"GLY A 285;ASP A 279;ALA A 276;VAL A 297;ARG A 322","None;MD0 A 993 (-3.6A);None;None;None","0.92A","4u95B-3t7vA:undetectable","4u95B-3t7vA:17.16"],["4UHX_A_LZUA3008_1","ALDEHYDE OXIDASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"GLU A 117;ASP A 118;ARG A  90;PRO A 147","None","1.14A","4uhxA-3t7vA:undetectable","4uhxA-3t7vA:13.48"],["4UHX_A_RTZA3009_1","ALDEHYDE OXIDASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"GLU A 117;ASP A 118;ARG A  90;PRO A 147","None","1.14A","4uhxA-3t7vA:undetectable","4uhxA-3t7vA:13.48"],["4YMG_B_SAMB1001_1","PUTATIVE SAM-DEPENDENT O-METHYLTRANFERASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",3,"SER A 277;GLU A 171;GLU A 117","MD0 A 993 (-2.6A);SAM A 992 (-2.8A);None","0.76A","4ymgB-3t7vA:undetectable","4ymgB-3t7vA:19.42"],["5BS8_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A  48;ARG A 289;THR A 238;GLU A 258","None","0.74A","5bs8A-3t7vA:undetectable;5bs8C-3t7vA:undetectable;5bs8D-3t7vA:undetectable","5bs8A-3t7vA:24.86;5bs8C-3t7vA:24.86;5bs8D-3t7vA:23.90"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A  48;ARG A 289;THR A 238;GLU A 258","None","0.74A","5btaA-3t7vA:undetectable;5btaC-3t7vA:undetectable;5btaD-3t7vA:undetectable","5btaA-3t7vA:24.86;5btaC-3t7vA:24.86;5btaD-3t7vA:23.90"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A 289;THR A 238;GLU A 258;ARG A  48","None","0.74A","5btaA-3t7vA:undetectable;5btaB-3t7vA:undetectable;5btaC-3t7vA:undetectable","5btaA-3t7vA:24.86;5btaB-3t7vA:23.90;5btaC-3t7vA:24.86"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A 289;THR A 238;GLU A 258;ARG A  48","None","0.76A","5btcA-3t7vA:undetectable;5btcB-3t7vA:undetectable;5btcC-3t7vA:undetectable","5btcA-3t7vA:24.86;5btcB-3t7vA:23.90;5btcC-3t7vA:24.86"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A 289;THR A 238;GLU A 258;ARG A  48","None","0.79A","5btfA-3t7vA:undetectable;5btfB-3t7vA:undetectable;5btfC-3t7vA:undetectable","5btfA-3t7vA:24.86;5btfB-3t7vA:23.90;5btfC-3t7vA:24.86"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A 289;THR A 238;GLU A 258;ARG A  48","None","0.73A","5btgA-3t7vA:undetectable;5btgB-3t7vA:undetectable;5btgC-3t7vA:undetectable","5btgA-3t7vA:24.86;5btgB-3t7vA:23.90;5btgC-3t7vA:24.86"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"ARG A  48;ARG A 289;THR A 238;GLU A 258","None","0.89A","5btgA-3t7vA:undetectable;5btgC-3t7vA:undetectable;5btgD-3t7vA:undetectable","5btgA-3t7vA:24.86;5btgC-3t7vA:24.86;5btgD-3t7vA:23.90"],["5FEP_A_SAMA407_0","[FEFE] HYDROGENASE MATURASE SUBUNIT HYDE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"CYH A  78;GLY A 148;LEU A 168;ARG A 190;TYR A  66","SF4 A 991 (-2.3A);SAM A 992 ( 3.8A);None;SAM A 992 (-3.3A);None","0.83A","5fepA-3t7vA:38.3","5fepA-3t7vA:30.49"],["5FEP_A_SAMA407_0","[FEFE] HYDROGENASE MATURASE SUBUNIT HYDE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"CYH A  78;SER A 146;GLY A 148;LEU A 168;ARG A 190","SF4 A 991 (-2.3A);MD0 A 993 (-2.8A);SAM A 992 ( 3.8A);None;SAM A 992 (-3.3A)","0.51A","5fepA-3t7vA:38.3","5fepA-3t7vA:30.49"],["5FES_A_SAMA408_0","[FEFE] HYDROGENASE MATURASE SUBUNIT HYDE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"CYH A  78;GLY A 148;LEU A 168;ARG A 190;TYR A  66","SF4 A 991 (-2.3A);SAM A 992 ( 3.8A);None;SAM A 992 (-3.3A);None","0.80A","5fesA-3t7vA:38.5","5fesA-3t7vA:30.49"],["5FES_A_SAMA408_0","[FEFE] HYDROGENASE MATURASE SUBUNIT HYDE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",5,"CYH A  78;SER A 146;GLY A 148;LEU A 168;ARG A 190","SF4 A 991 (-2.3A);MD0 A 993 (-2.8A);SAM A 992 ( 3.8A);None;SAM A 992 (-3.3A)","0.51A","5fesA-3t7vA:38.5","5fesA-3t7vA:30.49"],["5FHR_A_SAMA303_1","CATECHOL O-METHYLTRANSFERASE","3t7v","METHYLORNITHINE SYNTHASE PYLB","Methanosarcina barkeri",4,"SER A 222;GLU A 171;TYR A 169;SER A  76","None;SAM A 992 (-2.8A);SAM A 992 ( 4.6A);None","1.44A","5fhrA-3t7vA:undetectable","5fhrA-3t7vA:22.73"]]