SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '3u95'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1A4G_B_ZMRB466_2 (NEURAMINIDASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 267 ARG A 270 ILE A 293	MN A 601 ( 4.6A) None None	0.82A	1a4gB-3u95A: undetectable	1a4gB-3u95A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JGS_A_SALA256_1 (MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN MARR)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	PRO A 161 VAL A 162 THR A 416 VAL A 136	None	0.96A	1jgsA-3u95A: undetectable	1jgsA-3u95A: 15.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N2X_B_SAMB402_1 (S-ADENOSYL-METHYLTRA NSFERASE MRAW)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 5	ASP A 116 VAL A 129 SER A 131 ASP A 438	None	1.44A	1n2xB-3u95A: 4.5	1n2xB-3u95A: 23.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VPT_A_SAMA400_1 (VP39)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 294 ARG A 299 ASP A 267	None None MN A 601 ( 4.6A)	0.78A	1vptA-3u95A: 3.1	1vptA-3u95A: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WU8_A_ADNA500_1 (HYPOTHETICAL PROTEIN PH0463)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 9	HIS A 92 ASP A 100 PHE A 459 ASN A 460 TYR A 128	None	1.32A	1wu8A-3u95A: 1.3 1wu8B-3u95A: 1.1	1wu8A-3u95A: 21.10 1wu8B-3u95A: 21.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WU8_B_ADNB501_1 (HYPOTHETICAL PROTEIN PH0463)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 11	HIS A 92 ASP A 100 PHE A 459 ASN A 460 TYR A 128	None	1.35A	1wu8B-3u95A: 1.1 1wu8C-3u95A: 1.2	1wu8B-3u95A: 21.10 1wu8C-3u95A: 21.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WU8_C_ADNC502_1 (HYPOTHETICAL PROTEIN PH0463)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	PHE A 459 ASN A 460 TYR A 128 HIS A 92	None	1.37A	1wu8A-3u95A: 1.2 1wu8C-3u95A: 1.3	1wu8A-3u95A: 21.10 1wu8C-3u95A: 21.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJF_B_ADNB2002_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 6	GLU A 394 ASN A 215 PRO A 383 ALA A 206	None	1.25A	2ejfB-3u95A: undetectable	2ejfB-3u95A: 21.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJG_A_ADNA1501_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	GLU A 394 ASN A 215 PRO A 383 ALA A 206	None	1.22A	2ejgA-3u95A: undetectable	2ejgA-3u95A: 21.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJG_B_ADNB1502_1 (235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA- CARBOXYLASE] LIGASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	GLU A 394 ASN A 215 PRO A 383 ALA A 206	None	1.31A	2ejgB-3u95A: undetectable	2ejgB-3u95A: 21.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NSI_A_H4BA600_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	MET A 249 ILE A 265 PHE A 191 GLU A 189	None	1.49A	2nsiA-3u95A: undetectable 2nsiB-3u95A: undetectable	2nsiA-3u95A: 21.63 2nsiB-3u95A: 21.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHF_A_NCAA493_0 (CHORISMATE SYNTHASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 11	THR A 32 ILE A 34 ILE A 347 ALA A 22 VAL A 62	None	1.12A	2qhfA-3u95A: undetectable	2qhfA-3u95A: 22.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QO4_A_CHDA130_0 (LIVER-BASIC FATTY ACID BINDING PROTEIN)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	TYR A 467 LEU A 431 ILE A 434 THR A 127 ASP A 116	None	1.19A	2qo4A-3u95A: undetectable	2qo4A-3u95A: 14.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QO6_A_CHDA130_0 (LIVER-BASIC FATTY ACID BINDING PROTEIN)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	TYR A 467 LEU A 431 ILE A 434 THR A 127 ASP A 116	None	1.20A	2qo6A-3u95A: undetectable	2qo6A-3u95A: 14.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5Q_D_1UND900_2 (PROTEASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 10	GLY A 76 ALA A 77 ASP A 78 ILE A 3 ILE A 80	None	0.93A	2r5qD-3u95A: undetectable	2r5qD-3u95A: 12.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X2N_D_X2ND1479_1 (LANOSTEROL 14-ALPHA-DEMETHYLASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	PHE A 79 TYR A 154 ALA A 354 ALA A 352 LEU A 361	None	1.39A	2x2nD-3u95A: undetectable	2x2nD-3u95A: 24.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XCT_H_CPFH1020_1 (DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ARG A 113 GLU A 296 SER A 250	None	0.88A	2xctD-3u95A: undetectable	2xctD-3u95A: 20.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DH0_A_SAMA220_0 (SAM DEPENDENT METHYLTRANSFERASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	VAL A 6 GLY A 7 GLY A 9 VAL A 39 LEU A 138	None	0.67A	3dh0A-3u95A: 4.1	3dh0A-3u95A: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEO_A_SAMA328_1 (MODIFICATION METHYLASE HHAI)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	GLU A 30 SER A 60 VAL A 55	None	0.67A	3eeoA-3u95A: 4.6	3eeoA-3u95A: 21.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ELZ_B_CHDB151_0 (ILEAL BILE ACID-BINDING PROTEIN)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 10	TYR A 408 ILE A 212 GLY A 272 TYR A 126 LEU A 409	None	1.26A	3elzB-3u95A: undetectable	3elzB-3u95A: 16.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LS4_H_TCIH220_1 (HEAVY CHAIN OF ANTIBODY FAB FRAGMENT)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 10	VAL A 450 LEU A 435 GLY A 106 VAL A 102 GLY A 114	None	1.02A	3ls4H-3u95A: undetectable	3ls4H-3u95A: 16.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MYU_A_VIBA500_1 (HIGH AFFINITY TRANSPORT SYSTEM PROTEIN P37)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 10	ASP A 100 HIS A 303 ASN A 460 ASP A 116 GLY A 95	None	1.21A	3myuA-3u95A: undetectable	3myuA-3u95A: 21.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3O14_A_NIOA300_1 (ANTI-ECFSIGMA FACTOR, CHRR)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	ALA A 14 VAL A 64 VAL A 18 LEU A 15	None	0.85A	3o14A-3u95A: undetectable	3o14A-3u95A: 18.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3R9C_A_ECLA452_1 (CYTOCHROME P450 164A2)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	LEU A 50 LEU A 15 ALA A 46 ASN A 45 LEU A 44	None	1.06A	3r9cA-3u95A: undetectable	3r9cA-3u95A: 22.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_A_W9TA1002_1 (HEMOLYTIC LECTIN CEL-III)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 20 GLU A 344 GLY A 343	None	0.59A	3w9tA-3u95A: undetectable	3w9tA-3u95A: 20.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_B_W9TB502_1 (HEMOLYTIC LECTIN CEL-III)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 6	ASP A 20 GLU A 344 GLY A 343 LEU A 17	None	1.16A	3w9tB-3u95A: undetectable	3w9tB-3u95A: 20.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_F_W9TF503_1 (HEMOLYTIC LECTIN CEL-III)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 6	ASP A 20 GLU A 344 GLY A 343 LEU A 17	None	1.16A	3w9tF-3u95A: undetectable	3w9tF-3u95A: 20.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A97_I_ZPCI1318_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	VAL A 162 ILE A 165 ASN A 160 GLU A 344	None None MN A 601 ( 4.8A) None	1.08A	4a97H-3u95A: undetectable	4a97H-3u95A: 20.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FP9_D_SAMD401_1 (METHYLTRANSFERASE NSUN4)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 294 ARG A 299 ASP A 267	None None MN A 601 ( 4.6A)	0.85A	4fp9D-3u95A: 5.2	4fp9D-3u95A: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FZV_A_SAMA401_1 (PUTATIVE METHYLTRANSFERASE NSUN4)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 294 ARG A 299 ASP A 267	None None MN A 601 ( 4.6A)	0.86A	4fzvA-3u95A: 4.6	4fzvA-3u95A: 21.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OBW_A_SAMA602_1 (2-METHOXY-6-POLYPREN YL-1,4-BENZOQUINOL METHYLASE, MITOCHONDRIAL)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ASP A 294 ASN A 121 SER A 96	None	0.81A	4obwA-3u95A: 4.0	4obwA-3u95A: 18.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QZT_A_RTLA201_0 (RETINOL-BINDING PROTEIN 2)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	MET A 149 THR A 67 TYR A 35 VAL A 65 SER A 4	None	1.41A	4qztA-3u95A: undetectable	4qztA-3u95A: 13.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UCI_B_ADNB2415_1 (RNA-DIRECTED RNA POLYMERASE L)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	GLU A 453 LYS A 108 TYR A 111 HIS A 109	None	1.41A	4uciB-3u95A: undetectable	4uciB-3u95A: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z7F_C_FOLC201_0 (FOLATE ECF TRANSPORTER)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	SER A 342 ALA A 51 PHE A 336 THR A 329 LEU A 313	None	1.43A	4z7fC-3u95A: undetectable	4z7fC-3u95A: 17.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZP0_A_DXCA500_0 (MULTIDRUG TRANSPORTER MDFA)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 10	ASP A 223 LEU A 194 LEU A 228 GLY A 186 GLN A 248	None	1.21A	4zp0A-3u95A: undetectable	4zp0A-3u95A: 21.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	ALA A 46 ASP A 93 ARG A 307 GLU A 304	None	0.96A	5btdA-3u95A: undetectable 5btdB-3u95A: 0.9 5btdC-3u95A: undetectable	5btdA-3u95A: 23.29 5btdB-3u95A: 19.74 5btdC-3u95A: 23.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	ALA A 46 ASP A 93 ARG A 307 GLU A 304	None	0.99A	5btdA-3u95A: undetectable 5btdC-3u95A: undetectable 5btdD-3u95A: undetectable	5btdA-3u95A: 23.29 5btdC-3u95A: 23.29 5btdD-3u95A: 19.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 7	ALA A 46 ASP A 93 ARG A 307 GLU A 304	None	0.92A	5btgA-3u95A: undetectable 5btgC-3u95A: undetectable 5btgD-3u95A: undetectable	5btgA-3u95A: 23.29 5btgC-3u95A: 23.29 5btgD-3u95A: 19.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDP_H_EVPH2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 6	GLU A 394 GLY A 266 ASP A 267 GLY A 186	None None MN A 601 ( 4.6A) None	0.93A	5cdpA-3u95A: undetectable 5cdpB-3u95A: undetectable	5cdpA-3u95A: 22.24 5cdpB-3u95A: 18.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EQB_A_1YNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	GLY A 7 PHE A 349 GLY A 390 THR A 83 MET A 156	None	1.07A	5eqbA-3u95A: undetectable	5eqbA-3u95A: 23.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FLC_C_RAPC999_1 (SERINE/THREONINE-PRO TEIN KINASE MTOR FKBP)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 8	GLU A 296 GLY A 106 THR A 127 TRP A 99	None	0.96A	5flcB-3u95A: undetectable	5flcB-3u95A: 17.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FLC_G_RAPG999_1 (SERINE/THREONINE-PRO TEIN KINASE MTOR FKBP)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	4 / 8	GLU A 296 GLY A 106 THR A 127 TRP A 99	None	0.96A	5flcF-3u95A: undetectable	5flcF-3u95A: 17.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GWX_A_SAMA301_1 (GLYCINE SARCOSINE N-METHYLTRANSFERASE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	ARG A 412 ASN A 419 ASP A 135	None	0.69A	5gwxA-3u95A: 4.2	5gwxA-3u95A: 20.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Y2T_A_8LXA501_0 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	5 / 12	LEU A 341 PHE A 336 LEU A 36 ILE A 21 LEU A 316	None	1.23A	5y2tA-3u95A: undetectable	5y2tA-3u95A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6ESM_A_PZEA307_1 (MATRIX METALLOPROTEINASE-9, MATRIX METALLOPROTEINASE-9)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	TYR A 276 HIS A 277 PHE A 287	None	1.06A	6esmA-3u95A: undetectable	6esmA-3u95A: 11.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EXI_A_ADNA503_1 (ADENOSYLHOMOCYSTEINA SE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	LEU A 341 GLN A 23 LYS A 357	None	0.80A	6exiB-3u95A: 4.1	6exiB-3u95A: 12.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EXI_B_ADNB503_0 (ADENOSYLHOMOCYSTEINA SE)	3u95	GLYCOSIDE HYDROLASE, FAMILY 4 (Thermotoga neapolitana)	3 / 3	LEU A 341 GLN A 23 LYS A 357	None	0.82A	6exiA-3u95A: 4.4	6exiA-3u95A: 12.01

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1A4G_B_ZMRB466_2","NEURAMINIDASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A 267;ARG A 270;ILE A 293"," MN A 601 ( 4.6A);None;None","0.82A","1a4gB-3u95A:undetectable","1a4gB-3u95A:19.89"],["1JGS_A_SALA256_1","MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN MARR","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"PRO A 161;VAL A 162;THR A 416;VAL A 136","None","0.96A","1jgsA-3u95A:undetectable","1jgsA-3u95A:15.94"],["1N2X_B_SAMB402_1","S-ADENOSYL-METHYLTRANSFERASE MRAW","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ASP A 116;VAL A 129;SER A 131;ASP A 438","None","1.44A","1n2xB-3u95A:4.5","1n2xB-3u95A:23.26"],["1VPT_A_SAMA400_1","VP39","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A 294;ARG A 299;ASP A 267","None;None; MN A 601 ( 4.6A)","0.78A","1vptA-3u95A:3.1","1vptA-3u95A:20.70"],["1WU8_A_ADNA500_1","HYPOTHETICAL PROTEIN PH0463;HYPOTHETICAL PROTEIN PH0463","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"HIS A  92;ASP A 100;PHE A 459;ASN A 460;TYR A 128","None","1.32A","1wu8A-3u95A:1.3;1wu8B-3u95A:1.1","1wu8A-3u95A:21.10;1wu8B-3u95A:21.10"],["1WU8_B_ADNB501_1","HYPOTHETICAL PROTEIN PH0463;HYPOTHETICAL PROTEIN PH0463","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"HIS A  92;ASP A 100;PHE A 459;ASN A 460;TYR A 128","None","1.35A","1wu8B-3u95A:1.1;1wu8C-3u95A:1.2","1wu8B-3u95A:21.10;1wu8C-3u95A:21.10"],["1WU8_C_ADNC502_1","HYPOTHETICAL PROTEIN PH0463;HYPOTHETICAL PROTEIN PH0463","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"PHE A 459;ASN A 460;TYR A 128;HIS A  92","None","1.37A","1wu8A-3u95A:1.2;1wu8C-3u95A:1.3","1wu8A-3u95A:21.10;1wu8C-3u95A:21.10"],["2EJF_B_ADNB2002_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 394;ASN A 215;PRO A 383;ALA A 206","None","1.25A","2ejfB-3u95A:undetectable","2ejfB-3u95A:21.50"],["2EJG_A_ADNA1501_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 394;ASN A 215;PRO A 383;ALA A 206","None","1.22A","2ejgA-3u95A:undetectable","2ejgA-3u95A:21.94"],["2EJG_B_ADNB1502_1","235AA LONG HYPOTHETICAL BIOTIN--[ACETYL-COA-CARBOXYLASE] LIGASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 394;ASN A 215;PRO A 383;ALA A 206","None","1.31A","2ejgB-3u95A:undetectable","2ejgB-3u95A:21.94"],["2NSI_A_H4BA600_1","PROTEIN (NITRIC OXIDE SYNTHASE);PROTEIN (NITRIC OXIDE SYNTHASE)","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"MET A 249;ILE A 265;PHE A 191;GLU A 189","None","1.49A","2nsiA-3u95A:undetectable;2nsiB-3u95A:undetectable","2nsiA-3u95A:21.63;2nsiB-3u95A:21.63"],["2QHF_A_NCAA493_0","CHORISMATE SYNTHASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"THR A  32;ILE A  34;ILE A 347;ALA A  22;VAL A  62","None","1.12A","2qhfA-3u95A:undetectable","2qhfA-3u95A:22.53"],["2QO4_A_CHDA130_0","LIVER-BASIC FATTY ACID BINDING PROTEIN","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"TYR A 467;LEU A 431;ILE A 434;THR A 127;ASP A 116","None","1.19A","2qo4A-3u95A:undetectable","2qo4A-3u95A:14.98"],["2QO6_A_CHDA130_0","LIVER-BASIC FATTY ACID BINDING PROTEIN","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"TYR A 467;LEU A 431;ILE A 434;THR A 127;ASP A 116","None","1.20A","2qo6A-3u95A:undetectable","2qo6A-3u95A:14.32"],["2R5Q_D_1UND900_2","PROTEASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"GLY A  76;ALA A  77;ASP A  78;ILE A   3;ILE A  80","None","0.93A","2r5qD-3u95A:undetectable","2r5qD-3u95A:12.64"],["2X2N_D_X2ND1479_1","LANOSTEROL 14-ALPHA-DEMETHYLASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"PHE A  79;TYR A 154;ALA A 354;ALA A 352;LEU A 361","None","1.39A","2x2nD-3u95A:undetectable","2x2nD-3u95A:24.18"],["2XCT_H_CPFH1020_1","DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ARG A 113;GLU A 296;SER A 250","None","0.88A","2xctD-3u95A:undetectable","2xctD-3u95A:20.77"],["3DH0_A_SAMA220_0","SAM DEPENDENT METHYLTRANSFERASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"VAL A   6;GLY A   7;GLY A   9;VAL A  39;LEU A 138","None","0.67A","3dh0A-3u95A:4.1","3dh0A-3u95A:20.96"],["3EEO_A_SAMA328_1","MODIFICATION METHYLASE HHAI","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"GLU A  30;SER A  60;VAL A  55","None","0.67A","3eeoA-3u95A:4.6","3eeoA-3u95A:21.88"],["3ELZ_B_CHDB151_0","ILEAL BILE ACID-BINDING PROTEIN","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"TYR A 408;ILE A 212;GLY A 272;TYR A 126;LEU A 409","None","1.26A","3elzB-3u95A:undetectable","3elzB-3u95A:16.36"],["3LS4_H_TCIH220_1","HEAVY CHAIN OF ANTIBODY FAB FRAGMENT","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"VAL A 450;LEU A 435;GLY A 106;VAL A 102;GLY A 114","None","1.02A","3ls4H-3u95A:undetectable","3ls4H-3u95A:16.85"],["3MYU_A_VIBA500_1","HIGH AFFINITY TRANSPORT SYSTEM PROTEIN P37","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"ASP A 100;HIS A 303;ASN A 460;ASP A 116;GLY A  95","None","1.21A","3myuA-3u95A:undetectable","3myuA-3u95A:21.68"],["3O14_A_NIOA300_1","ANTI-ECFSIGMA FACTOR, CHRR","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ALA A  14;VAL A  64;VAL A  18;LEU A  15","None","0.85A","3o14A-3u95A:undetectable","3o14A-3u95A:18.98"],["3R9C_A_ECLA452_1","CYTOCHROME P450 164A2","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"LEU A  50;LEU A  15;ALA A  46;ASN A  45;LEU A  44","None","1.06A","3r9cA-3u95A:undetectable","3r9cA-3u95A:22.03"],["3W9T_A_W9TA1002_1","HEMOLYTIC LECTIN CEL-III","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A  20;GLU A 344;GLY A 343","None","0.59A","3w9tA-3u95A:undetectable","3w9tA-3u95A:20.04"],["3W9T_B_W9TB502_1","HEMOLYTIC LECTIN CEL-III","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ASP A  20;GLU A 344;GLY A 343;LEU A  17","None","1.16A","3w9tB-3u95A:undetectable","3w9tB-3u95A:20.04"],["3W9T_F_W9TF503_1","HEMOLYTIC LECTIN CEL-III","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ASP A  20;GLU A 344;GLY A 343;LEU A  17","None","1.16A","3w9tF-3u95A:undetectable","3w9tF-3u95A:20.04"],["4A97_I_ZPCI1318_1","CYS-LOOP LIGAND-GATED ION CHANNEL;CYS-LOOP LIGAND-GATED ION CHANNEL","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"VAL A 162;ILE A 165;ASN A 160;GLU A 344","None;None; MN A 601 ( 4.8A);None","1.08A","4a97H-3u95A:undetectable","4a97H-3u95A:20.55"],["4FP9_D_SAMD401_1","METHYLTRANSFERASE NSUN4","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A 294;ARG A 299;ASP A 267","None;None; MN A 601 ( 4.6A)","0.85A","4fp9D-3u95A:5.2","4fp9D-3u95A:21.69"],["4FZV_A_SAMA401_1","PUTATIVE METHYLTRANSFERASE NSUN4","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A 294;ARG A 299;ASP A 267","None;None; MN A 601 ( 4.6A)","0.86A","4fzvA-3u95A:4.6","4fzvA-3u95A:21.53"],["4OBW_A_SAMA602_1","2-METHOXY-6-POLYPRENYL-1,4-BENZOQUINOL METHYLASE, MITOCHONDRIAL","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ASP A 294;ASN A 121;SER A  96","None","0.81A","4obwA-3u95A:4.0","4obwA-3u95A:18.58"],["4QZT_A_RTLA201_0","RETINOL-BINDING PROTEIN 2","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"MET A 149;THR A  67;TYR A  35;VAL A  65;SER A   4","None","1.41A","4qztA-3u95A:undetectable","4qztA-3u95A:13.84"],["4UCI_B_ADNB2415_1","RNA-DIRECTED RNA POLYMERASE L","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 453;LYS A 108;TYR A 111;HIS A 109","None","1.41A","4uciB-3u95A:undetectable","4uciB-3u95A:21.29"],["4Z7F_C_FOLC201_0","FOLATE ECF TRANSPORTER","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"SER A 342;ALA A  51;PHE A 336;THR A 329;LEU A 313","None","1.43A","4z7fC-3u95A:undetectable","4z7fC-3u95A:17.88"],["4ZP0_A_DXCA500_0","MULTIDRUG TRANSPORTER MDFA","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"ASP A 223;LEU A 194;LEU A 228;GLY A 186;GLN A 248","None","1.21A","4zp0A-3u95A:undetectable","4zp0A-3u95A:21.37"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ALA A  46;ASP A  93;ARG A 307;GLU A 304","None","0.96A","5btdA-3u95A:undetectable;5btdB-3u95A:0.9;5btdC-3u95A:undetectable","5btdA-3u95A:23.29;5btdB-3u95A:19.74;5btdC-3u95A:23.29"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ALA A  46;ASP A  93;ARG A 307;GLU A 304","None","0.99A","5btdA-3u95A:undetectable;5btdC-3u95A:undetectable;5btdD-3u95A:undetectable","5btdA-3u95A:23.29;5btdC-3u95A:23.29;5btdD-3u95A:19.74"],["5BTG_F_LFXF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"ALA A  46;ASP A  93;ARG A 307;GLU A 304","None","0.92A","5btgA-3u95A:undetectable;5btgC-3u95A:undetectable;5btgD-3u95A:undetectable","5btgA-3u95A:23.29;5btgC-3u95A:23.29;5btgD-3u95A:19.74"],["5CDP_H_EVPH2101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 394;GLY A 266;ASP A 267;GLY A 186","None;None; MN A 601 ( 4.6A);None","0.93A","5cdpA-3u95A:undetectable;5cdpB-3u95A:undetectable","5cdpA-3u95A:22.24;5cdpB-3u95A:18.28"],["5EQB_A_1YNA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"GLY A   7;PHE A 349;GLY A 390;THR A  83;MET A 156","None","1.07A","5eqbA-3u95A:undetectable","5eqbA-3u95A:23.33"],["5FLC_C_RAPC999_1","SERINE\/THREONINE-PROTEIN KINASE MTOR;FKBP","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 296;GLY A 106;THR A 127;TRP A  99","None","0.96A","5flcB-3u95A:undetectable","5flcB-3u95A:17.89"],["5FLC_G_RAPG999_1","SERINE\/THREONINE-PROTEIN KINASE MTOR;FKBP","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",4,"GLU A 296;GLY A 106;THR A 127;TRP A  99","None","0.96A","5flcF-3u95A:undetectable","5flcF-3u95A:17.89"],["5GWX_A_SAMA301_1","GLYCINE SARCOSINE N-METHYLTRANSFERASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"ARG A 412;ASN A 419;ASP A 135","None","0.69A","5gwxA-3u95A:4.2","5gwxA-3u95A:20.77"],["5Y2T_A_8LXA501_0","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",5,"LEU A 341;PHE A 336;LEU A  36;ILE A  21;LEU A 316","None","1.23A","5y2tA-3u95A:undetectable","5y2tA-3u95A:undetectable"],["6ESM_A_PZEA307_1","MATRIX METALLOPROTEINASE-9,MATRIX METALLOPROTEINASE-9","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"TYR A 276;HIS A 277;PHE A 287","None","1.06A","6esmA-3u95A:undetectable","6esmA-3u95A:11.22"],["6EXI_A_ADNA503_1","ADENOSYLHOMOCYSTEINASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"LEU A 341;GLN A  23;LYS A 357","None","0.80A","6exiB-3u95A:4.1","6exiB-3u95A:12.01"],["6EXI_B_ADNB503_0","ADENOSYLHOMOCYSTEINASE","3u95","GLYCOSIDE HYDROLASE, FAMILY 4","Thermotoga neapolitana",3,"LEU A 341;GLN A  23;LYS A 357","None","0.82A","6exiA-3u95A:4.4","6exiA-3u95A:12.01"]]