SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4a01'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DVX_B_DIFB125_1 (TRANSTHYRETIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	LEU A 743 ALA A 238 SER A 302 SER A 298	None	0.92A	1dvxA-4a01A: undetectable	1dvxA-4a01A: 11.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTI_E_CCSE47_0 (GLUTATHIONE S-TRANSFERASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	THR A 152 LEU A 154 GLY A 157 LEU A 159	None	1.01A	1gtiE-4a01A: 1.0	1gtiE-4a01A: 13.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HWI_A_115A2_2 (HMG-COA REDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	GLU A  12 ASN A 210 ALA A  19 LEU A 202	None	0.85A	1hwiB-4a01A: undetectable	1hwiB-4a01A: 21.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HWI_C_115C4_2 (HMG-COA REDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	GLU A  12 ASN A 210 ALA A  19 LEU A 202	None	0.87A	1hwiD-4a01A: undetectable	1hwiD-4a01A: 21.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HWI_D_115D3_1 (HMG-COA REDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	GLU A  12 ASN A 210 ALA A  19 LEU A 202	None	0.86A	1hwiC-4a01A: undetectable	1hwiC-4a01A: 21.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICR_A_NIOA604_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	SER A 634 THR A 635 PHE A  88 GLY A 244	None	1.33A	1icrA-4a01A: undetectable 1icrB-4a01A: undetectable	1icrA-4a01A: 14.99 1icrB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICR_A_NIOA604_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	SER A 634 THR A 635 PHE A  88 GLY A 245	None	1.20A	1icrA-4a01A: undetectable 1icrB-4a01A: undetectable	1icrA-4a01A: 14.99 1icrB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICR_B_NIOB602_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	GLY A 244 SER A 634 THR A 635 PHE A  88	None	1.30A	1icrA-4a01A: undetectable 1icrB-4a01A: undetectable	1icrA-4a01A: 14.99 1icrB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICR_B_NIOB602_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	GLY A 245 SER A 634 THR A 635 PHE A  88	None	1.20A	1icrA-4a01A: undetectable 1icrB-4a01A: undetectable	1icrA-4a01A: 14.99 1icrB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_A_NIOA221_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	SER A 634 THR A 635 PHE A  88 GLY A 245	None	1.16A	1icuA-4a01A: undetectable 1icuB-4a01A: undetectable	1icuA-4a01A: 14.99 1icuB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_C_NIOC225_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	SER A 634 THR A 635 PHE A  88 GLY A 245	None	1.15A	1icuC-4a01A: undetectable 1icuD-4a01A: undetectable	1icuC-4a01A: 14.99 1icuD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_D_NIOD223_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	GLY A 245 SER A 634 THR A 635 PHE A  88	None	1.11A	1icuC-4a01A: undetectable 1icuD-4a01A: undetectable	1icuC-4a01A: 14.99 1icuD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICV_B_NIOB702_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	GLY A 245 SER A 634 THR A 635 PHE A  88	None	1.14A	1icvA-4a01A: undetectable 1icvB-4a01A: undetectable	1icvA-4a01A: 14.99 1icvB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICV_C_NIOC708_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	SER A 634 THR A 635 PHE A  88 GLY A 244	None	1.30A	1icvC-4a01A: 0.0 1icvD-4a01A: undetectable	1icvC-4a01A: 14.99 1icvD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICV_C_NIOC708_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	SER A 634 THR A 635 PHE A  88 GLY A 245	None	1.13A	1icvC-4a01A: 0.0 1icvD-4a01A: undetectable	1icvC-4a01A: 14.99 1icvD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICV_D_NIOD706_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	GLY A 245 SER A 634 THR A 635 PHE A  88	None	1.09A	1icvC-4a01A: 0.0 1icvD-4a01A: undetectable	1icvC-4a01A: 14.99 1icvD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KQB_D_BEZD523_0 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	GLY A 245 SER A 634 THR A 635 PHE A  88	None	1.16A	1kqbC-4a01A: undetectable 1kqbD-4a01A: undetectable	1kqbC-4a01A: 15.02 1kqbD-4a01A: 15.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1M4I_A_KANA500_1 (AMINOGLYCOSIDE 2'-N-ACETYLTRANSFERA SE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 8	ASP A 691 ASP A 530 GLY A 503 ASP A 279 THR A 249	MG  A1771 ( 2.7A) MG  A1771 ( 4.1A) K  A1772 ( 4.5A) MG  A1768 ( 4.3A) None	1.22A	1m4iA-4a01A: undetectable	1m4iA-4a01A: 13.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1R5L_A_VIVA301_0 (PROTEIN (ALPHA-TOCOPHEROL TRANSFER PROTEIN))	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	VAL A 410 ILE A 545 ILE A 470 VAL A 677 ILE A 463	None	1.15A	1r5lA-4a01A: undetectable	1r5lA-4a01A: 15.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SQ5_B_PAUB6003_0 (PANTOTHENATE KINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	LYS A 541 GLY A 540 LEU A 295 ILE A 545 ASN A 738	None	1.39A	1sq5B-4a01A: undetectable	1sq5B-4a01A: 16.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SQ5_D_PAUD6004_0 (PANTOTHENATE KINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	LYS A 541 GLY A 540 LEU A 295 ILE A 545 ASN A 738	None	1.38A	1sq5D-4a01A: undetectable	1sq5D-4a01A: 16.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1X7P_B_SAMB302_0 (RRNA METHYLTRANSFERASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	THR A 732 ASP A 731 GLY A 245 GLY A 286 ALA A 251	None 2PN  A1773 (-3.9A) None None None	1.10A	1x7pA-4a01A: undetectable 1x7pB-4a01A: undetectable	1x7pA-4a01A: 16.16 1x7pB-4a01A: 16.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YKI_A_NFZA1219_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	PHE A 240 GLY A 245 THR A 635 PHE A  88	None	0.91A	1ykiA-4a01A: undetectable 1ykiB-4a01A: undetectable	1ykiA-4a01A: 14.99 1ykiB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YKI_B_NFZB2219_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	THR A 635 PHE A  88 PHE A 240 GLY A 245	None	0.91A	1ykiA-4a01A: undetectable 1ykiB-4a01A: undetectable	1ykiA-4a01A: 14.99 1ykiB-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YKI_C_NFZC3219_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	PHE A 240 GLY A 245 THR A 635 PHE A  88	None	0.92A	1ykiC-4a01A: undetectable 1ykiD-4a01A: undetectable	1ykiC-4a01A: 14.99 1ykiD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YKI_D_NFZD4219_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	THR A 635 PHE A  88 PHE A 240 GLY A 245	None	0.89A	1ykiC-4a01A: undetectable 1ykiD-4a01A: undetectable	1ykiC-4a01A: 14.99 1ykiD-4a01A: 14.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A1H_A_GBNA502_1 (BRANCHED CHAIN AMINOTRANSFERASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	THR A 536 GLY A 496 THR A 495 ALA A 498	None	0.88A	2a1hA-4a01A: undetectable 2a1hB-4a01A: undetectable	2a1hA-4a01A: 17.72 2a1hB-4a01A: 17.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOF_C_FRDC305_1 (POL POLYPROTEIN PEPTIDE INHIBITOR)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	ASP A   8 GLY A 316 PRO A 385 ALA A   4	None	0.93A	2aofA-4a01A: undetectable	2aofA-4a01A: 10.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2COJ_A_GBNA420_1 (BRANCHED CHAIN AMINOTRANSFERASE 1, CYTOSOLIC)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 11	TYR A 230 THR A 152 GLY A 297 ALA A 300 VAL A 204	None	1.18A	2cojA-4a01A: undetectable 2cojB-4a01A: undetectable	2cojA-4a01A: 18.54 2cojB-4a01A: 18.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FT9_A_CHDA130_0 (FATTY ACID-BINDING PROTEIN 2, LIVER)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	PHE A 474 ILE A 565 SER A 561 VAL A 575 PHE A 556	None	1.19A	2ft9A-4a01A: undetectable	2ft9A-4a01A: 10.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRC_A_CHDA701_0 (FERROCHELATASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 665 LEU A 669 ILE A 658 SER A 672 LEU A 740	None	1.13A	2hrcA-4a01A: undetectable	2hrcA-4a01A: 18.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NNH_A_9CRA502_1 (CYTOCHROME P450 2C8)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ILE A  81 SER A  82 ASN A 168 VAL A 631 ILE A 288	None	1.01A	2nnhA-4a01A: 1.9	2nnhA-4a01A: 19.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OXT_C_SAMC300_0 (NUCLEOSIDE-2'-O-METH YLTRANSFERASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	GLY A 722 GLY A 726 GLY A 688 ILE A 721 VAL A 448	None	0.96A	2oxtC-4a01A: undetectable	2oxtC-4a01A: 16.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PO5_A_CHDA501_0 (FERROCHELATASE, MITOCHONDRIAL)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 665 LEU A 669 ILE A 658 SER A 672 LEU A 740	None	1.14A	2po5A-4a01A: undetectable	2po5A-4a01A: 18.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7W_B_SALB1300_1 (LYSR-TYPE REGULATORY PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	THR A 495 ILE A 499 GLY A 496 PHE A 543 THR A 341	None	1.21A	2y7wB-4a01A: undetectable	2y7wB-4a01A: 14.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YDO_A_ADNA400_1 (ADENOSINE RECEPTOR A2A)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 749 THR A 228 LEU A 111 ILE A 107 SER A 142	None	1.49A	2ydoA-4a01A: 2.0	2ydoA-4a01A: 18.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JB2_A_SAMA1102_0 (STRUCTURAL PROTEIN VP3)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ILE A 725 GLY A 722 ALA A 693 ALA A 445 VAL A 448	None	0.98A	3jb2A-4a01A: 1.8	3jb2A-4a01A: 21.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JB3_A_SAMA1102_0 (STRUCTURAL PROTEIN VP3)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ILE A 725 GLY A 722 ALA A 693 ALA A 445 VAL A 448	None	0.97A	3jb3A-4a01A: undetectable	3jb3A-4a01A: 21.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K4V_D_ROCD201_2 (HIV-1 PROTEASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 4	GLY A 511 ASP A 283 GLY A 503 THR A 185	None MG  A1770 ( 2.7A) K  A1772 ( 4.5A) None	1.05A	3k4vC-4a01A: undetectable	3k4vC-4a01A: 10.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KEE_A_30BA500_1 (GENOME POLYPROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	6 / 12	GLY A 241 GLY A 150 SER A 153 PHE A 296 ALA A 300 CYH A 304	None	1.21A	3keeA-4a01A: undetectable	3keeA-4a01A: 12.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KEE_D_30BD500_1 (GENOME POLYPROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	GLY A 241 GLY A 150 SER A 153 PHE A 296 ALA A 300	None	1.10A	3keeD-4a01A: undetectable	3keeD-4a01A: 12.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KO0_H_TFPH202_1 (PROTEIN S100-A4)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	GLU A 747 LEU A 232 ILE A 107 PHE A  99 PHE A 240	None None None DMU  A1776 (-4.5A) None	1.39A	3ko0G-4a01A: undetectable 3ko0H-4a01A: 1.2 3ko0I-4a01A: 1.8 3ko0J-4a01A: 1.7	3ko0G-4a01A: 8.76 3ko0H-4a01A: 8.76 3ko0I-4a01A: 8.76 3ko0J-4a01A: 8.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KPD_B_SAMB1000_1 (UNCHARACTERIZED PROTEIN MJ0100)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	3 / 3	ASN A 534 ASN A 428 GLU A 358	MG  A1771 (-2.5A) None None	0.94A	3kpdC-4a01A: undetectable	3kpdC-4a01A: 10.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LMY_A_CP6A562_1 (BETA-HEXOSAMINIDASE SUBUNIT BETA)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ASP A 723 ASP A 727 ASP A 253 ASP A 527 GLU A 698	MG  A1769 ( 3.9A) MG  A1769 ( 2.5A) MG  A1767 (-2.4A) None None	1.20A	3lmyA-4a01A: undetectable	3lmyA-4a01A: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N2O_C_AG2C1002_1 (BIOSYNTHETIC ARGININE DECARBOXYLASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	HIS A 716 ASP A 507 ASP A 723 ASP A 691	None MG  A1768 (-2.5A) MG  A1769 ( 3.9A) MG  A1771 ( 2.7A)	1.12A	3n2oC-4a01A: undetectable 3n2oD-4a01A: undetectable	3n2oC-4a01A: 21.41 3n2oD-4a01A: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N8Y_B_DIFB585_1 (PROSTAGLANDIN G/H SYNTHASE 1)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ILE A 643 GLY A 646 ALA A 647 LEU A 651 LEU A 654	DMU  A1776 ( 4.9A) None DMU  A1776 ( 4.1A) DMU  A1775 ( 4.9A) None	0.73A	3n8yB-4a01A: undetectable	3n8yB-4a01A: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N8Z_B_FLPB1701_1 (PROSTAGLANDIN G/H SYNTHASE 1)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 239 ILE A 643 GLY A 646 ALA A 647 LEU A 651	None DMU  A1776 ( 4.9A) None DMU  A1776 ( 4.1A) DMU  A1775 ( 4.9A)	0.94A	3n8zB-4a01A: 0.5	3n8zB-4a01A: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXV_A_478A200_1 (HIV-1 PROTEASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	GLU A 620 PRO A 274 ARG A 272 GLY A 617	None	1.15A	3oxvA-4a01A: undetectable	3oxvA-4a01A: 9.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S45_B_478B201_1 (PROTEASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ALA A 485 ILE A 470 GLY A 546 ILE A 418 ILE A 468	None	0.99A	3s45A-4a01A: undetectable	3s45A-4a01A: 9.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUE_C_SUEC1201_1 (NS3 PROTEASE, NS4A PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	GLY A 241 GLY A 150 SER A 153 PHE A 296 ALA A 300	None	1.08A	3sueC-4a01A: undetectable	3sueC-4a01A: 14.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUF_C_SUEC1201_1 (NS3 PROTEASE, NS4A PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 11	GLY A 241 GLY A 150 SER A 153 PHE A 296 ALA A 300	None	1.13A	3sufC-4a01A: undetectable	3sufC-4a01A: 14.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUF_D_SUED1201_1 (NS3 PROTEASE, NS4A PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	6 / 12	GLY A 241 GLY A 150 SER A 153 PHE A 296 ALA A 300 CYH A 304	None	1.47A	3sufD-4a01A: undetectable	3sufD-4a01A: 14.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T7V_A_SAMA992_0 (METHYLORNITHINE SYNTHASE PYLB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	THR A 732 GLY A 244 GLY A 286 VAL A 597 ALA A 601	None	1.24A	3t7vA-4a01A: undetectable	3t7vA-4a01A: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UJ6_A_SAMA300_1 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 4	SER A 519 ASP A 527 ASP A 507 ALA A 513	None None MG  A1768 (-2.5A) None	1.19A	3uj6A-4a01A: undetectable	3uj6A-4a01A: 16.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VM4_A_IZPA1_1 (FATTY ACID ALPHA-HYDROXYLASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	LEU A 749 PHE A 559 PRO A 753 ALA A 563	None	1.21A	3vm4A-4a01A: 0.0	3vm4A-4a01A: 19.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AC9_B_DXCB1473_0 (MJ0495-LIKE PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 11	ILE A 499 ASP A 500 ILE A 539 GLY A 540 GLY A 415	None	0.99A	4ac9B-4a01A: undetectable 4ac9C-4a01A: undetectable	4ac9B-4a01A: 20.90 4ac9C-4a01A: 20.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ACA_B_DXCB1473_0 (TRANSLATION ELONGATION FACTOR SELB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ASP A 500 ILE A 539 GLY A 540 PHE A 543 GLY A 415	None	1.30A	4acaB-4a01A: undetectable 4acaC-4a01A: undetectable	4acaB-4a01A: 20.90 4acaC-4a01A: 20.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BLV_B_SAMB1281_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	GLY A 157 TYR A  93 GLY A 241 LEU A 196 GLY A 194	None	1.21A	4blvB-4a01A: undetectable	4blvB-4a01A: 15.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BVA_B_T3B1314_1 (THIOMORPHOLINE-CARBO XYLATE DEHYDROGENASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ARG A 562 PHE A 751 PHE A 754 HIS A 758 GLU A 225	None None None DMU  A1778 (-3.9A) None	1.24A	4bvaB-4a01A: undetectable	4bvaB-4a01A: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EAT_B_BEZB1000_0 (BENZOATE-COENZYME A LIGASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ALA A 486 ALA A 414 GLY A 415 GLY A 546 ILE A 466	None	0.97A	4eatB-4a01A: undetectable	4eatB-4a01A: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ENH_A_FVXA602_1 (CHOLESTEROL 24-HYDROXYLASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 454 THR A 422 GLY A 533 ALA A 689 THR A 426	None None K  A1772 ( 4.6A) None None	1.01A	4enhA-4a01A: undetectable	4enhA-4a01A: 19.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EVR_A_BEZA401_0 (PUTATIVE ABC TRANSPORTER SUBUNIT, SUBSTRATE-BINDING COMPONENT)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 11	LEU A 743 VAL A 649 PHE A  99 SER A 236 PHE A 103	None None DMU  A1776 (-4.5A) None None	1.17A	4evrA-4a01A: undetectable	4evrA-4a01A: 20.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.09A	4feuB-4a01A: undetectable	4feuB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 269 ASP A 287 ASN A 280 ASP A 507	MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A) MG  A1768 (-2.5A)	0.94A	4feuB-4a01A: undetectable	4feuB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.11A	4feuB-4a01A: undetectable	4feuB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.90A	4feuB-4a01A: undetectable	4feuB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.88A	4feuD-4a01A: undetectable	4feuD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.13A	4feuF-4a01A: undetectable	4feuF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.11A	4feuF-4a01A: undetectable	4feuF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.94A	4feuF-4a01A: undetectable	4feuF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.16A	4fevB-4a01A: undetectable	4fevB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.86A	4fevB-4a01A: undetectable	4fevB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4fevD-4a01A: undetectable	4fevD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.08A	4fevD-4a01A: undetectable	4fevD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.87A	4fevD-4a01A: undetectable	4fevD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.11A	4fevF-4a01A: undetectable	4fevF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.12A	4fevF-4a01A: undetectable	4fevF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.91A	4fevF-4a01A: undetectable	4fevF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.13A	4fewB-4a01A: 0.7	4fewB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.89A	4fewB-4a01A: 0.7	4fewB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.13A	4fewD-4a01A: undetectable	4fewD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.12A	4fewD-4a01A: undetectable	4fewD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.89A	4fewD-4a01A: undetectable	4fewD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4fewF-4a01A: 0.7	4fewF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.10A	4fewF-4a01A: 0.7	4fewF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.90A	4fewF-4a01A: 0.7	4fewF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEX_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.08A	4fexB-4a01A: undetectable	4fexB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEX_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.18A	4fexB-4a01A: undetectable	4fexB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEX_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.92A	4fexB-4a01A: undetectable	4fexB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FGJ_A_1PQA303_0 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	GLY A 244 GLY A 246 GLU A  92 ILE A 739 PHE A 589	None	1.30A	4fgjA-4a01A: undetectable 4fgjB-4a01A: undetectable	4fgjA-4a01A: 16.29 4fgjB-4a01A: 16.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G10_A_ACTA301_0 (GLUTATHIONE S-TRANSFERASE HOMOLOG)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ILE A 140 TYR A 216 TYR A 215 PHE A 141	None	1.21A	4g10A-4a01A: undetectable	4g10A-4a01A: 15.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G10_A_ACTA301_0 (GLUTATHIONE S-TRANSFERASE HOMOLOG)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	PRO A 134 ILE A 140 TYR A 215 PHE A 141	None	1.04A	4g10A-4a01A: undetectable	4g10A-4a01A: 15.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G24_A_ACAA1004_1 (PENTATRICOPEPTIDE REPEAT-CONTAINING PROTEIN AT2G32230, MITOCHONDRIAL)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ALA A 199 ASN A 200 LEU A 203 VAL A 204	None	0.87A	4g24A-4a01A: undetectable	4g24A-4a01A: 22.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4gkhB-4a01A: undetectable	4gkhB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.16A	4gkhB-4a01A: undetectable	4gkhB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.89A	4gkhB-4a01A: undetectable	4gkhB-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.15A	4gkhD-4a01A: undetectable	4gkhD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.86A	4gkhD-4a01A: undetectable	4gkhD-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.11A	4gkhF-4a01A: undetectable	4gkhF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.08A	4gkhF-4a01A: undetectable	4gkhF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.88A	4gkhF-4a01A: undetectable	4gkhF-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.11A	4gkhG-4a01A: undetectable	4gkhG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.11A	4gkhG-4a01A: undetectable	4gkhG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.91A	4gkhG-4a01A: undetectable	4gkhG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_J_KANJ301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.14A	4gkhJ-4a01A: undetectable	4gkhJ-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_J_KANJ301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.85A	4gkhJ-4a01A: undetectable	4gkhJ-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_J_KANJ301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 723 ASP A 257 ASP A 287 GLU A 268	MG  A1769 ( 3.9A) MG  A1767 (-2.5A) 2PN  A1773 (-3.9A) 2PN  A1773 (-3.7A)	1.28A	4gkhJ-4a01A: undetectable	4gkhJ-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_K_KANK301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4gkhC-4a01A: undetectable 4gkhK-4a01A: 0.7	4gkhC-4a01A: 16.82 4gkhK-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_K_KANK301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 269 ASP A 283 GLU A 268 ASP A 731	MG  A1768 ( 3.9A) MG  A1770 ( 2.7A) 2PN  A1773 (-3.7A) 2PN  A1773 (-3.9A)	1.14A	4gkhC-4a01A: undetectable 4gkhK-4a01A: 0.7	4gkhC-4a01A: 16.82 4gkhK-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_K_KANK301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.10A	4gkhC-4a01A: undetectable 4gkhK-4a01A: 0.7	4gkhC-4a01A: 16.82 4gkhK-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_K_KANK301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.91A	4gkhC-4a01A: undetectable 4gkhK-4a01A: 0.7	4gkhC-4a01A: 16.82 4gkhK-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_A_KANA301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.14A	4gkiA-4a01A: undetectable	4gkiA-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_A_KANA301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.09A	4gkiA-4a01A: undetectable	4gkiA-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_A_KANA301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.90A	4gkiA-4a01A: undetectable	4gkiA-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_C_KANC301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4gkiC-4a01A: undetectable	4gkiC-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_C_KANC301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.90A	4gkiC-4a01A: undetectable	4gkiC-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 257 ASP A 269 ASP A 287 ASN A 280	MG  A1767 (-2.5A) MG  A1768 ( 3.9A) 2PN  A1773 (-3.9A) MG  A1768 ( 4.9A)	1.10A	4gkiE-4a01A: undetectable 4gkiG-4a01A: undetectable	4gkiE-4a01A: 16.82 4gkiG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 269 ASP A 283 GLU A 268 ASP A 731	MG  A1768 ( 3.9A) MG  A1770 ( 2.7A) 2PN  A1773 (-3.7A) 2PN  A1773 (-3.9A)	1.10A	4gkiE-4a01A: undetectable 4gkiG-4a01A: undetectable	4gkiE-4a01A: 16.82 4gkiG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 507 ASP A 269 ASP A 727 GLU A 698	MG  A1768 (-2.5A) MG  A1768 ( 3.9A) MG  A1769 ( 2.5A) None	1.10A	4gkiE-4a01A: undetectable 4gkiG-4a01A: undetectable	4gkiE-4a01A: 16.82 4gkiG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 691 ASP A 727 ASP A 269 ASP A 257	MG  A1771 ( 2.7A) MG  A1769 ( 2.5A) MG  A1768 ( 3.9A) MG  A1767 (-2.5A)	0.92A	4gkiE-4a01A: undetectable 4gkiG-4a01A: undetectable	4gkiE-4a01A: 16.82 4gkiG-4a01A: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_1 (S-ADENOSYLMETHIONINE SYNTHASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	ASP A 500 LYS A 541 ALA A 538 ASP A 287	None None None 2PN  A1773 (-3.9A)	1.06A	4k0bB-4a01A: undetectable	4k0bB-4a01A: 21.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KM0_A_CP6A201_1 (DIHYDROFOLATE REDUCTASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	ILE A 227 PHE A 224 LEU A 321 ILE A 209 THR A 138	None	1.20A	4km0A-4a01A: undetectable	4km0A-4a01A: 12.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LB2_A_DM5A602_1 (SERUM ALBUMIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	VAL A 605 MET A 604 ALA A 601 TYR A 248	None	1.16A	4lb2A-4a01A: undetectable	4lb2A-4a01A: 21.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDA_A_RLTA403_1 (MARINER MOS1 TRANSPOSASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 283 ASP A 507 ALA A 531 ASP A 287	MG  A1770 ( 2.7A) MG  A1768 (-2.5A) None 2PN  A1773 (-3.9A)	0.97A	4mdaA-4a01A: undetectable	4mdaA-4a01A: 14.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDA_A_RLTA403_1 (MARINER MOS1 TRANSPOSASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 691 ASN A 692 ALA A 689 ASP A 727	MG  A1771 ( 2.7A) None None MG  A1769 ( 2.5A)	0.95A	4mdaA-4a01A: undetectable	4mdaA-4a01A: 14.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDA_A_RLTA403_1 (MARINER MOS1 TRANSPOSASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 691 ASN A 692 ALA A 693 ASP A 727	MG  A1771 ( 2.7A) None None MG  A1769 ( 2.5A)	1.18A	4mdaA-4a01A: undetectable	4mdaA-4a01A: 14.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDB_A_RLTA401_1 (MARINER MOS1 TRANSPOSASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 283 ASP A 507 ALA A 531 ASP A 287	MG  A1770 ( 2.7A) MG  A1768 (-2.5A) None 2PN  A1773 (-3.9A)	0.93A	4mdbA-4a01A: undetectable	4mdbA-4a01A: 14.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OBW_D_SAMD601_1 (2-METHOXY-6-POLYPREN YL-1,4-BENZOQUINOL METHYLASE, MITOCHONDRIAL)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	3 / 3	ASN A 280 ASP A 507 ASP A 527	MG  A1768 ( 4.9A) MG  A1768 (-2.5A) None	0.84A	4obwD-4a01A: undetectable	4obwD-4a01A: 15.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QWU_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ALA A 164 THR A 165 ALA A 167 MET A 291 GLY A 157	None	1.17A	4qwuK-4a01A: undetectable 4qwuL-4a01A: undetectable	4qwuK-4a01A: 16.15 4qwuL-4a01A: 12.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R1Z_B_AERB601_1 (CYP17A1 PROTEIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ALA A 483 GLY A 557 ALA A 558 SER A 313	None	0.76A	4r1zB-4a01A: undetectable	4r1zB-4a01A: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R38_A_RBFA201_1 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ARG A 242 ILE A 288 LEU A 197 MET A 193 GLY A 194	None	1.20A	4r38A-4a01A: undetectable	4r38A-4a01A: 11.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R38_C_RBFC201_1 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ARG A 242 ILE A 288 LEU A 197 MET A 193 GLY A 194	None	1.19A	4r38C-4a01A: undetectable	4r38C-4a01A: 11.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_F_377F402_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 8	ALA A 558 ALA A 310 SER A 313 ALA A 306 ALA A 554	None	1.50A	4twdF-4a01A: 2.1 4twdG-4a01A: 0.1 4twdH-4a01A: 0.4 4twdI-4a01A: undetectable 4twdJ-4a01A: undetectable	4twdF-4a01A: 17.15 4twdG-4a01A: 17.15 4twdH-4a01A: 17.15 4twdI-4a01A: 17.15 4twdJ-4a01A: 17.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4TWD_F_377F402_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	SER A 713 ALA A 719 ALA A 437 ALA A 705	None	0.78A	4twdF-4a01A: 2.1 4twdG-4a01A: 0.1 4twdH-4a01A: 0.4 4twdI-4a01A: undetectable 4twdJ-4a01A: undetectable	4twdF-4a01A: 17.15 4twdG-4a01A: 17.15 4twdH-4a01A: 17.15 4twdI-4a01A: 17.15 4twdJ-4a01A: 17.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XK8_A_PQNA845_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A1)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	PHE A 108 ALA A 137 LEU A 136 GLY A 112	None	0.93A	4xk8a-4a01A: undetectable	4xk8a-4a01A: 23.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_C_STRC603_1 (CYTOCHROME P450 21-HYDROXYLASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ASP A 294 SER A 298 LEU A 295 ILE A 545 LEU A 490	None	0.96A	4y8wC-4a01A: 0.8	4y8wC-4a01A: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YHA_A_MZMA303_1 (ALPHA-CARBONIC ANHYDRASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ASP A  67 VAL A  70 LEU A 173 THR A 172 ALA A 175	None	1.36A	4yhaA-4a01A: undetectable	4yhaA-4a01A: 14.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZPH_A_PRLA501_0 (ARYL HYDROCARBON RECEPTOR NUCLEAR TRANSLOCATOR ENDOTHELIAL PAS DOMAIN-CONTAINING PROTEIN 1)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	VAL A 649 LEU A 239 SER A 235 GLU A 301	None	0.97A	4zphA-4a01A: undetectable 4zphB-4a01A: 0.0	4zphA-4a01A: 18.09 4zphB-4a01A: 18.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZ8_A_GCSA208_1 (GLUCANASE/CHITOSANAS E)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	GLU A  92 TYR A  93 ASP A 294 ALA A 238	None	1.13A	4zz8A-4a01A: undetectable	4zz8A-4a01A: 11.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ALB_L_TIQL1210_2 (MEDI2452 LIGHT CHAIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 8	SER A 506 GLY A 503 TYR A 166 GLY A 190	None K  A1772 ( 4.5A) None None	0.85A	5albL-4a01A: undetectable	5albL-4a01A: 14.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ALA A 186 ASP A 527 GLY A 511 GLU A 514	None	0.97A	5bs8A-4a01A: undetectable 5bs8B-4a01A: undetectable 5bs8C-4a01A: 0.7	5bs8A-4a01A: 21.54 5bs8B-4a01A: 15.78 5bs8C-4a01A: 21.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ALA A 186 ASP A 527 GLY A 511 GLU A 514	None	0.97A	5btdA-4a01A: 0.6 5btdB-4a01A: undetectable 5btdC-4a01A: 0.7	5btdA-4a01A: 21.54 5btdB-4a01A: 15.78 5btdC-4a01A: 21.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	ALA A 186 ASP A 527 GLY A 511 GLU A 514	None	0.98A	5btdA-4a01A: 0.6 5btdC-4a01A: 0.7 5btdD-4a01A: undetectable	5btdA-4a01A: 21.54 5btdC-4a01A: 21.54 5btdD-4a01A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DL9_A_ACTA214_0 (LYSOZYME C)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 5	ASP A 691 TRP A 690 VAL A 720 ALA A 719	MG  A1771 ( 2.7A) None None None	1.09A	5dl9A-4a01A: undetectable	5dl9A-4a01A: 10.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ERO_C_210C804_1 (FUSICOCCADIENE SYNTHASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 10	ASP A 530 ASP A 527 ARG A 523 ASP A 279 ASP A 253	MG  A1771 ( 4.1A) None None MG  A1768 ( 4.3A) MG  A1767 (-2.4A)	1.10A	5eroC-4a01A: 2.3	5eroC-4a01A: 18.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ERS_A_ACTA803_0 (GEPHYRIN)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	3 / 3	THR A 426 ALA A 538 ASN A 685	None	0.58A	5ersA-4a01A: undetectable	5ersA-4a01A: 20.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HP1_C_PPFC601_1 (HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 727 GLY A 726 ASP A 723 LYS A 250	MG  A1769 ( 2.5A) None MG  A1769 ( 3.9A) 2PN  A1773 (-3.1A)	1.44A	5hp1C-4a01A: 0.9	5hp1C-4a01A: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JS5_A_ASCA202_0 (CYTOCHROME C')	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	3 / 3	CYH A 715 LYS A 717 HIS A 716	None	1.23A	5js5A-4a01A: 1.4	5js5A-4a01A: 9.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KBW_B_RBFB201_1 (RIBOFLAVIN TRANSPORTER RIBU)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	ASP A 269 GLY A 511 ALA A 164 ASN A 284 VAL A 281	MG  A1768 ( 3.9A) None None None None	1.39A	5kbwB-4a01A: 1.9	5kbwB-4a01A: 14.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KQY_B_017B101_2 (PROTEASE E35D-DRV)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	GLY A 503 ASP A 287 GLY A 540 ILE A 539	K  A1772 ( 4.5A) 2PN  A1773 (-3.9A) None None	0.69A	5kqyB-4a01A: undetectable	5kqyB-4a01A: 10.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5Z_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5,PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6,PROTEASOME SUBUNIT BETA TYPE-1,PROTEASOME SUBUNIT BETA TYPE-6,PROTEASOME SUBUNIT BETA TYPE-1,PROTEASOME SUBUNIT BETA TYPE-6)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ALA A 251 ALA A 637 ALA A 600 GLY A 282 ALA A 278	None	1.11A	5l5zK-4a01A: undetectable 5l5zL-4a01A: undetectable	5l5zK-4a01A: 16.15 5l5zL-4a01A: 11.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L5Z_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5,PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6,PROTEASOME SUBUNIT BETA TYPE-1,PROTEASOME SUBUNIT BETA TYPE-6,PROTEASOME SUBUNIT BETA TYPE-1,PROTEASOME SUBUNIT BETA TYPE-6)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 9	ALA A 251 ALA A 637 ALA A 600 GLY A 282 ALA A 278	None	1.11A	5l5zY-4a01A: undetectable 5l5zZ-4a01A: undetectable	5l5zY-4a01A: 16.15 5l5zZ-4a01A: 11.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5PHH_A_LDPA414_1 (LYSINE-SPECIFIC DEMETHYLASE 4D)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	GLU A 301 ALA A 745 LEU A 743 SER A 552	None	1.03A	5phhA-4a01A: undetectable	5phhA-4a01A: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UXD_A_ZITA501_1 (MACROLIDE 2'-PHOSPHOTRANSFERAS E MPHH)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 7	GLU A 423 TYR A 430 ALA A 531 GLY A 533	None DMU  A1774 (-4.7A) None K  A1772 ( 4.6A)	0.93A	5uxdA-4a01A: 1.1	5uxdA-4a01A: 17.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DJZ_B_GMJB301_1 (SIGMA NON-OPIOID INTRACELLULAR RECEPTOR 1)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	4 / 6	ASP A 257 VAL A 254 GLU A 268 ALA A 531	MG  A1767 (-2.5A) None 2PN  A1773 (-3.7A) None	1.12A	6djzB-4a01A: undetectable	6djzB-4a01A: 14.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_A_DCFA401_0 (ADENOSINE DEAMINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 490 ILE A 741 SER A 552 ALA A 548 ASP A 294	None	1.07A	6n91A-4a01A: undetectable	6n91A-4a01A: 7.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_A_DCFA401_0 (ADENOSINE DEAMINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 490 ILE A 741 SER A 552 ALA A 548 ASP A 294	None	1.09A	6n91A-4a01A: undetectable	6n91A-4a01A: 7.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_B_DCFB401_0 (ADENOSINE DEAMINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 490 ILE A 741 SER A 552 ALA A 548 ASP A 294	None	1.04A	6n91B-4a01A: undetectable	6n91B-4a01A: 7.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_B_DCFB401_0 (ADENOSINE DEAMINASE)	4a01	PROTON PYROPHOSPHATASE (Vigna radiata)	5 / 12	LEU A 490 ILE A 741 SER A 552 ALA A 548 ASP A 294	None	1.08A	6n91B-4a01A: undetectable	6n91B-4a01A: 7.88