SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4av6'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1A7Y_A_DVAA8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.77A	1a7yA-4av6A: undetectable	1a7yA-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1A7Y_B_DVAB2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.85A	1a7yB-4av6A: undetectable	1a7yB-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1A7Y_B_DVAB8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.81A	1a7yB-4av6A: undetectable	1a7yB-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AV2_D_DVAD8_0 (GRAMICIDIN A)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	VAL A 690 VAL A 685 TRP A 659	None	0.90A	1av2C-4av6A: undetectable 1av2D-4av6A: undetectable	1av2C-4av6A: 3.69 1av2D-4av6A: 3.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CTR_A_TFPA153_1 (CALMODULIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 9	ILE A 257 LEU A 513 GLU A 246 ALA A 180 VAL A 253	None	1.17A	1ctrA-4av6A: undetectable	1ctrA-4av6A: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DHJ_A_MTXA161_1 (DIHYDROFOLATE REDUCTASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 509 SER A 184 ILE A 704 ARG A 191 ILE A 706	None	0.96A	1dhjA-4av6A: undetectable	1dhjA-4av6A: 11.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DSC_C_DVAC8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.72A	1dscC-4av6A: undetectable	1dscC-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EE2_A_CHDA1150_0 (ALCOHOL DEHYDROGENASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 11	SER A 454 LEU A 244 LEU A 424 SER A 505 ILE A 376	None	1.29A	1ee2A-4av6A: undetectable	1ee2A-4av6A: 19.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EE2_B_CHDB1250_1 (ALCOHOL DEHYDROGENASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 11	SER A 454 LEU A 244 LEU A 424 SER A 505 ILE A 376	None	1.28A	1ee2B-4av6A: undetectable	1ee2B-4av6A: 19.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EUP_A_ASDA452_1 (CYTOCHROME P450ERYF)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	SER A 254 ILE A 257 LEU A 258 LEU A 513	None	0.73A	1eupA-4av6A: 0.0	1eupA-4av6A: 22.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FJA_C_DVAC8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.85A	1fjaC-4av6A: undetectable	1fjaC-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FJA_D_DVAD8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.85A	1fjaD-4av6A: undetectable	1fjaD-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FXV_B_PNNB1001_0 (PENICILLIN ACYLASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	PHE A 430 SER A 372 ALA A 431 PHE A 508	None	1.21A	1fxvA-4av6A: undetectable 1fxvB-4av6A: 1.6	1fxvA-4av6A: 15.07 1fxvB-4av6A: 21.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTI_D_CCSD47_0 (GLUTATHIONE S-TRANSFERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	TRP A 659 THR A 652 GLY A 413 LEU A 410	None	0.96A	1gtiD-4av6A: 1.2	1gtiD-4av6A: 14.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_E_TRPE81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	THR A 384 SER A 416 GLY A 377 ILE A 376	None	0.89A	1gtnD-4av6A: undetectable 1gtnE-4av6A: undetectable	1gtnD-4av6A: 8.17 1gtnE-4av6A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_G_TRPG81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	THR A 384 SER A 416 GLY A 377 ILE A 376	None	0.88A	1gtnF-4av6A: undetectable 1gtnG-4av6A: undetectable	1gtnF-4av6A: 8.17 1gtnG-4av6A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_G_TRPG81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	THR A 384 SER A 416 GLY A 500 ILE A 503	None	0.87A	1gtnF-4av6A: undetectable 1gtnG-4av6A: undetectable	1gtnF-4av6A: 8.17 1gtnG-4av6A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_K_TRPK81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	THR A 384 SER A 416 GLY A 377 ILE A 376	None	0.87A	1gtnJ-4av6A: undetectable 1gtnK-4av6A: undetectable	1gtnJ-4av6A: 8.17 1gtnK-4av6A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_K_TRPK81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	THR A 384 SER A 416 GLY A 500 ILE A 503	None	0.89A	1gtnJ-4av6A: undetectable 1gtnK-4av6A: undetectable	1gtnJ-4av6A: 8.17 1gtnK-4av6A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_E_DVAE2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.84A	1i3wE-4av6A: undetectable	1i3wE-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_E_DVAE8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.80A	1i3wE-4av6A: undetectable	1i3wE-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_F_DVAF8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.80A	1i3wF-4av6A: undetectable	1i3wF-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_G_DVAG2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.83A	1i3wG-4av6A: undetectable	1i3wG-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_G_DVAG8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.78A	1i3wG-4av6A: undetectable	1i3wG-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I3W_H_DVAH8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.77A	1i3wH-4av6A: undetectable	1i3wH-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1J8U_A_H4BA429_1 (PHENYLALANINE-4-HYDR OXYLASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	LEU A 445 LEU A 448 LEU A 245 ALA A 137	None	0.81A	1j8uA-4av6A: undetectable	1j8uA-4av6A: 17.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1K5Q_B_PACB559_0 (PENICILLIN G ACYLASE ALPHA SUBUNIT PENICILLIN G ACYLASE BETA SUBUNIT)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	SER A 459 ALA A 464 SER A 127 ALA A  98	None	1.07A	1k5qA-4av6A: 0.6 1k5qB-4av6A: 1.7	1k5qA-4av6A: 14.41 1k5qB-4av6A: 21.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MNV_D_DVAD2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.78A	1mnvD-4av6A: undetectable	1mnvD-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MNV_D_DVAD8_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.76A	1mnvD-4av6A: undetectable	1mnvD-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MZ9_A_VDYA1002_3 (CARTILAGE OLIGOMERIC MATRIX PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 5	ILE A  70 LEU A  67 VAL A  63 ALA A  56	None	0.98A	1mz9C-4av6A: undetectable	1mz9C-4av6A: 4.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N2X_B_SAMB402_1 (S-ADENOSYL-METHYLTRA NSFERASE MRAW)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 5	ASP A 458 VAL A 457 SER A 456 ASP A 243	None	1.36A	1n2xB-4av6A: undetectable	1n2xB-4av6A: 17.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OS6_A_DXCA75_0 (PPCA)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	LEU A 325 PHE A 501 MET A 447 GLY A 373	None	1.07A	1os6A-4av6A: undetectable	1os6A-4av6A: 7.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OVF_B_DVAB2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.85A	1ovfB-4av6A: undetectable	1ovfB-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QFI_A_DVAA8_0 (ACTINOMYCIN X2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.78A	1qfiA-4av6A: undetectable	1qfiA-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QFI_B_DVAB8_0 (ACTINOMYCIN X2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.82A	1qfiB-4av6A: undetectable	1qfiB-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS7_A_ACTA860_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 5	GLY A 182 ILE A 186 VAL A 249 SER A  87	None	1.10A	1rs7A-4av6A: undetectable	1rs7A-4av6A: 19.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TLS_A_C2FA266_0 (THYMIDYLATE SYNTHASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	SER A 184 LEU A 244 GLY A 241 VAL A 451 ALA A 452	None	1.12A	1tlsA-4av6A: undetectable	1tlsA-4av6A: 16.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TLS_B_C2FB266_0 (THYMIDYLATE SYNTHASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	SER A 184 LEU A 244 GLY A 241 VAL A 451 ALA A 452	None	1.12A	1tlsB-4av6A: undetectable	1tlsB-4av6A: 16.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_F_DVAF2_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.78A	1unjF-4av6A: undetectable	1unjF-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_F_DVAF8_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.79A	1unjF-4av6A: undetectable	1unjF-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_L_DVAL2_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.77A	1unjL-4av6A: undetectable	1unjL-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_L_DVAL8_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.74A	1unjL-4av6A: undetectable	1unjL-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_R_DVAR2_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.76A	1unjR-4av6A: undetectable	1unjR-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_R_DVAR8_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.74A	1unjR-4av6A: undetectable	1unjR-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_W_DVAW8_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.72A	1unjW-4av6A: undetectable	1unjW-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_X_DVAX2_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.73A	1unjX-4av6A: undetectable	1unjX-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNJ_X_DVAX8_0 (7-AMINO-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.72A	1unjX-4av6A: undetectable	1unjX-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNM_E_DVAE2_0 (7-AMINOACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.74A	1unmE-4av6A: undetectable	1unmE-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNM_E_DVAE8_0 (7-AMINOACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.72A	1unmE-4av6A: undetectable	1unmE-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNM_F_DVAF2_0 (7-AMINOACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.78A	1unmF-4av6A: undetectable	1unmF-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UNM_F_DVAF8_0 (7-AMINOACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.74A	1unmF-4av6A: undetectable	1unmF-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1W5U_D_DVAD8_0 (GRAMICIDIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	VAL A 690 VAL A 685 TRP A 659	None	0.88A	1w5uC-4av6A: undetectable 1w5uD-4av6A: undetectable	1w5uC-4av6A: 3.69 1w5uD-4av6A: 3.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XDS_A_SAMA5635_0 (PROTEIN RDMB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	GLY A 193 GLY A 194 GLY A 195 LEU A 562 SER A 604	None	1.19A	1xdsA-4av6A: undetectable	1xdsA-4av6A: 19.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YA4_C_CTXC3_2 (CES1 PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	LEU A 347 PRO A 264 ILE A 287 LEU A 286	None	1.15A	1ya4C-4av6A: undetectable	1ya4C-4av6A: 23.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	209D_C_DVAC2_0 (N8-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 PRO A 419 THR A 423	None	0.72A	209dC-4av6A: undetectable	209dC-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	209D_C_DVAC8_0 (N8-ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 421 THR A 423 PRO A 420	None	0.85A	209dC-4av6A: undetectable	209dC-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HYY_A_STIA600_2 (PROTO-ONCOGENE TYROSINE-PROTEIN KINASE ABL1)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	LEU A 131 VAL A 103 VAL A  25 ILE A 463	None	0.98A	2hyyA-4av6A: undetectable	2hyyA-4av6A: 17.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IGT_C_SAMC1003_1 (SAM DEPENDENT METHYLTRANSFERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	ASP A 243 ASP A 190 ASP A 458 GLY A 235	None	1.42A	2igtC-4av6A: undetectable	2igtC-4av6A: 19.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IZQ_A_DVAA8_0 (GRAMICIDIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	VAL A 685 TRP A 659 VAL A 690	None	0.89A	2izqA-4av6A: undetectable 2izqB-4av6A: undetectable	2izqA-4av6A: 3.69 2izqB-4av6A: 3.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2KCE_B_D16B568_1 (THYMIDYLATE SYNTHASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	SER A 184 LEU A 244 GLY A 241 VAL A 451 ALA A 452	None	1.12A	2kceB-4av6A: undetectable	2kceB-4av6A: 16.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_B_KLNB1499_1 (CYTOCHROME P450 3A4)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	SER A 260 ILE A 287 THR A 340 GLY A 439	None	0.86A	2v0mB-4av6A: undetectable	2v0mB-4av6A: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VH3_A_DAHA2_1 (RANASMURFIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 9	ALA A 441 ALA A 251 GLY A 504 SER A 512 ALA A 510	None	1.41A	2vh3A-4av6A: 0.8	2vh3A-4av6A: 10.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WD9_A_IBPA1570_1 (ACYL-COENZYME A SYNTHETASE ACSM2A, MITOCHONDRIAL)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ILE A 704 LEU A 705 GLY A 645 GLY A 699	None	0.82A	2wd9A-4av6A: undetectable	2wd9A-4av6A: 23.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WEK_B_DIFB1376_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	TYR A 289 GLY A 358 ALA A 359 LEU A 347	None	0.92A	2wekB-4av6A: undetectable	2wekB-4av6A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZW9_B_SAMB801_0 (LEUCINE CARBOXYL METHYLTRANSFERASE 2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	GLY A 195 GLY A 239 ASP A 190 ASP A 692 GLU A  53	None None None MG  A1731 ( 2.4A) None	1.20A	2zw9B-4av6A: undetectable	2zw9B-4av6A: 22.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ARR_A_PNXA607_1 (CHITINASE A)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	VAL A 698 SER A 559 THR A 652 TRP A 659	None	1.20A	3arrA-4av6A: undetectable	3arrA-4av6A: 22.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_B_SVRB512_2 (PHOSPHOLIPASE A2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	VAL A 698 ILE A 503 GLY A 504 LEU A 448	None	0.76A	3bjwB-4av6A: 1.1	3bjwB-4av6A: 10.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_F_SVRF509_3 (PHOSPHOLIPASE A2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	VAL A 698 ILE A 503 GLY A 504 LEU A 448	None	0.85A	3bjwF-4av6A: undetectable	3bjwF-4av6A: 10.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_H_SVRH511_3 (PHOSPHOLIPASE A2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	VAL A 698 ILE A 503 GLY A 504 LEU A 448	None	0.72A	3bjwH-4av6A: 1.0	3bjwH-4av6A: 10.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CLB_D_TMQD614_1 (DHFR-TS)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	VAL A 440 ALA A 509 MET A 447 PRO A 420 ILE A 428	None	1.25A	3clbD-4av6A: undetectable	3clbD-4av6A: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_V_DR7V100_2 (PROTEASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	ASP A 541 ILE A 545 GLY A 547 GLY A 636 LEU A 638	None	0.95A	3em4V-4av6A: undetectable	3em4V-4av6A: 8.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3GYQ_B_SAMB270_0 (RRNA (ADENOSINE-2'-O-)-ME THYLTRANSFERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 11	LEU A 651 ALA A 653 GLY A 409 ILE A 650 SER A 416	None	1.13A	3gyqB-4av6A: undetectable	3gyqB-4av6A: 18.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HBB_D_TMQD614_1 (DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	VAL A 440 ALA A 509 MET A 447 PRO A 420 ILE A 428	None	1.26A	3hbbD-4av6A: undetectable	3hbbD-4av6A: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HCP_B_CHDB1_0 (FERROCHELATASE, MITOCHONDRIAL)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	LEU A 623 ILE A 619 SER A 520 GLY A 178 MET A 174	None	1.23A	3hcpB-4av6A: undetectable	3hcpB-4av6A: 18.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HS6_B_EPAB1_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	GLY A 551 GLY A 630 ALA A 631 GLY A 636 LEU A 638	None	1.01A	3hs6B-4av6A: undetectable	3hs6B-4av6A: 22.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3J6P_B_TA1B502_1 (TUBULIN BETA CHAIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	VAL A 440 ASP A 432 SER A 512 GLY A 354 LEU A 353	None	1.30A	3j6pB-4av6A: undetectable	3j6pB-4av6A: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L8L_D_DVAD8_0 (GRAMICIDIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	VAL A 690 VAL A 685 TRP A 659	None	0.91A	3l8lC-4av6A: undetectable 3l8lD-4av6A: undetectable	3l8lC-4av6A: 3.69 3l8lD-4av6A: 3.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N2O_C_AG2C1002_1 (BIOSYNTHETIC ARGININE DECARBOXYLASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	HIS A 681 ASP A 228 ASP A 688 ASP A 660	None MG  A1729 (-3.6A) MG  A1731 (-3.3A) PO4  A1727 (-2.9A)	0.97A	3n2oC-4av6A: undetectable 3n2oD-4av6A: undetectable	3n2oC-4av6A: 23.03 3n2oD-4av6A: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N2O_C_AG2C1002_1 (BIOSYNTHETIC ARGININE DECARBOXYLASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	HIS A 681 ASP A 232 ASP A 688 ASP A 660	None MG  A1732 (-1.9A) MG  A1731 (-3.3A) PO4  A1727 (-2.9A)	1.06A	3n2oC-4av6A: undetectable 3n2oD-4av6A: undetectable	3n2oC-4av6A: 23.03 3n2oD-4av6A: 23.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PFG_A_SAMA264_0 (N-METHYLTRANSFERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 443 GLY A 369 LEU A 445 SER A 449 PHE A 364	None	1.33A	3pfgA-4av6A: undetectable	3pfgA-4av6A: 16.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SEL_X_DXCX75_0 (CYTOCHROME C7)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	LEU A 325 PHE A 501 MET A 447 GLY A 373	None	1.01A	3selX-4av6A: undetectable	3selX-4av6A: 7.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SGL_A_SAMA692_0 (TRNA 5-METHYLAMINOMETHYL- 2-THIOURIDINE BIOSYNTHESIS BIFUNCTIONAL PROTEIN MNMC)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	GLY A 178 GLY A  77 LEU A  67 VAL A 253 GLY A 182	None	1.06A	3sglA-4av6A: undetectable	3sglA-4av6A: 22.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SJ1_X_DXCX75_0 (CYTOCHROME C7)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	LEU A 325 PHE A 501 MET A 447 GLY A 373	None	0.85A	3sj1X-4av6A: undetectable	3sj1X-4av6A: 7.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V7P_A_BEZA430_0 (AMIDOHYDROLASE FAMILY PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 7	ILE A 376 GLY A 504 SER A 505 PHE A 450 LEU A 448	None	1.27A	3v7pA-4av6A: undetectable	3v7pA-4av6A: 19.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ACA_C_DXCC1475_0 (TRANSLATION ELONGATION FACTOR SELB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ILE A 256 VAL A 144 GLN A 154 GLY A 149	None	0.80A	4acaC-4av6A: undetectable	4acaC-4av6A: 22.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_B_ACTB860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 5	GLY A 182 ILE A 186 VAL A 249 SER A  87	None	0.84A	4d33B-4av6A: undetectable	4d33B-4av6A: 20.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D39_B_ACTB860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	GLY A 182 ILE A 186 VAL A 249 SER A  87	None	0.85A	4d39B-4av6A: undetectable	4d39B-4av6A: 20.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D7B_A_TCWA1126_1 (TRANSTHYRETIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	LEU A 325 ALA A 329 SER A 301 THR A 332	None	1.25A	4d7bB-4av6A: undetectable	4d7bB-4av6A: 11.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DM8_B_REAB1501_1 (RETINOIC ACID RECEPTOR BETA)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	LEU A 244 ILE A 186 ARG A 191 GLY A  83 LEU A 141	None	1.03A	4dm8B-4av6A: undetectable	4dm8B-4av6A: 17.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.01A	4feuB-4av6A: undetectable	4feuB-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 488 ASP A 202 ASN A 229 ASP A 232	PO4  A1727 (-3.3A) MG  A1729 (-2.2A) MG  A1730 ( 4.3A) MG  A1732 (-1.9A)	1.13A	4feuB-4av6A: undetectable	4feuB-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 696 ASP A 488 ASP A 485	MG  A1729 (-2.2A) PO4  A1728 ( 3.3A) PO4  A1727 (-3.3A) None	0.82A	4feuD-4av6A: undetectable	4feuD-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.05A	4feuF-4av6A: undetectable	4feuF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEU_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.20A	4feuF-4av6A: undetectable	4feuF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4fevD-4av6A: undetectable	4fevD-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.16A	4fevD-4av6A: undetectable	4fevD-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.05A	4fevF-4av6A: undetectable	4fevF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEV_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.21A	4fevF-4av6A: undetectable	4fevF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4fewD-4av6A: 0.8	4fewD-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_D_KAND301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.17A	4fewD-4av6A: 0.8	4fewD-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.02A	4fewF-4av6A: undetectable	4fewF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEW_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.19A	4fewF-4av6A: undetectable	4fewF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FEX_B_KANB301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.03A	4fexB-4av6A: 1.0	4fexB-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FOX_D_D16D301_1 (THYMIDYLATE SYNTHASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	SER A 184 LEU A 244 GLY A 241 VAL A 451 ALA A 452	None	1.13A	4foxD-4av6A: undetectable	4foxD-4av6A: 17.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.06A	4gkhF-4av6A: undetectable	4gkhF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_F_KANF301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.17A	4gkhF-4av6A: undetectable	4gkhF-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4gkhG-4av6A: undetectable	4gkhG-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.20A	4gkhG-4av6A: undetectable	4gkhG-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKH_K_KANK301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4gkhC-4av6A: 0.9 4gkhK-4av6A: undetectable	4gkhC-4av6A: 15.78 4gkhK-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_A_KANA301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4gkiA-4av6A: undetectable	4gkiA-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_A_KANA301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 465 ASP A 692 GLU A 667 ASP A 228	PO4  A1727 (-2.2A) MG  A1731 ( 2.4A) None MG  A1729 (-3.6A)	1.16A	4gkiA-4av6A: undetectable	4gkiA-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GKI_G_KANG301_1 (AMINOGLYCOSIDE 3'-PHOSPHOTRANSFERAS E APHA1-IAB)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 8	ASP A 202 ASP A 660 GLU A 667 ASP A 465	MG  A1729 (-2.2A) PO4  A1727 (-2.9A) None PO4  A1727 (-2.2A)	1.04A	4gkiE-4av6A: undetectable 4gkiG-4av6A: 1.0	4gkiE-4av6A: 15.78 4gkiG-4av6A: 15.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HBF_A_DXCA75_0 (PPCA)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	LEU A 325 PHE A 501 MET A 447 GLY A 373	None	0.87A	4hbfA-4av6A: undetectable	4hbfA-4av6A: 7.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HC3_A_DXCA75_0 (PPCA)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	LEU A 325 PHE A 501 MET A 447 GLY A 373	None	1.01A	4hc3A-4av6A: undetectable	4hc3A-4av6A: 7.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HIV_D_DVAD2_0 (ACTINOMYCIN D)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	THR A 423 PRO A 420 THR A 421	None	0.83A	4hivD-4av6A: undetectable	4hivD-4av6A: 2.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J7X_A_SASA806_1 (SEPIAPTERIN REDUCTASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	LEU A 286 PHE A 355 PRO A 290 ALA A 366 ASP A 432	None	1.30A	4j7xA-4av6A: undetectable	4j7xA-4av6A: 19.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L9Q_B_9TPB601_1 (SERUM ALBUMIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 444 ILE A 287 LEU A 141 GLY A 149 LYS A 150	None	1.14A	4l9qB-4av6A: undetectable	4l9qB-4av6A: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LBG_A_ADNA402_1 (PROBABLE SUGAR KINASE PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	SER A 247 ILE A 708 CYH A 183 ALA A 187 ILE A 704	None	0.95A	4lbgA-4av6A: undetectable	4lbgA-4av6A: 20.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDA_A_RLTA403_1 (MARINER MOS1 TRANSPOSASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	ASP A 688 ASP A 206 ALA A 204 ASP A 692	MG  A1731 (-3.3A) MG  A1729 (-3.5A) None MG  A1731 ( 2.4A)	1.12A	4mdaA-4av6A: undetectable	4mdaA-4av6A: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MDB_A_RLTA401_1 (MARINER MOS1 TRANSPOSASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	ASP A 688 ASP A 206 ALA A 204 ASP A 692	MG  A1731 (-3.3A) MG  A1729 (-3.5A) None MG  A1731 ( 2.4A)	1.17A	4mdbA-4av6A: undetectable	4mdbA-4av6A: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N49_A_SAMA601_1 (CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-M ETHYLTRANSFERASE 1)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	ASN A 492 GLY A 491 ASP A 190 ASP A 232	PO4  A1728 ( 2.5A) None None MG  A1732 (-1.9A)	1.15A	4n49A-4av6A: undetectable	4n49A-4av6A: 21.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QB9_E_PARE500_1 (ENHANCED INTRACELLULAR SURVIVAL PROTEIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	PHE A 450 LEU A 321 SER A 456 TYR A 123 GLY A 498	None	1.26A	4qb9E-4av6A: 0.1	4qb9E-4av6A: 23.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WZM_A_ACTA503_0 (RNA DEPENDENT RNA POLYMERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	ASP A 228 ASP A 206 ASP A 688 ALA A 205	MG  A1729 (-3.6A) MG  A1729 (-3.5A) MG  A1731 (-3.3A) None	1.43A	4wzmA-4av6A: 0.0	4wzmA-4av6A: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WZM_A_ACTA503_0 (RNA DEPENDENT RNA POLYMERASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	ASP A 228 ASP A 206 ASP A 692 ALA A 205	MG  A1729 (-3.6A) MG  A1729 (-3.5A) MG  A1731 ( 2.4A) None	1.42A	4wzmA-4av6A: 0.0	4wzmA-4av6A: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_C_STRC603_1 (CYTOCHROME P450 21-HYDROXYLASE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ASP A 243 SER A 247 LEU A 244 ILE A 503 LEU A 448	None	1.02A	4y8wC-4av6A: undetectable	4y8wC-4av6A: 20.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ALA A 444 ASP A 243 GLY A 500 THR A 652	None	1.01A	5bs8A-4av6A: 1.6 5bs8B-4av6A: undetectable 5bs8C-4av6A: 1.8	5bs8A-4av6A: 22.51 5bs8B-4av6A: 17.69 5bs8C-4av6A: 22.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	ALA A 444 ASP A 243 GLY A 500 THR A 652	None	1.01A	5btdA-4av6A: 1.6 5btdC-4av6A: 1.8 5btdD-4av6A: undetectable	5btdA-4av6A: 22.51 5btdC-4av6A: 22.51 5btdD-4av6A: 17.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DZK_3_BEZ3801_0 (ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT 1 BEZ-LEU-LEU)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 4	LEU A  68 ILE A  64 GLY A 178 ILE A 185	None	0.90A	5dzk3-4av6A: undetectable 5dzkm-4av6A: undetectable	5dzk3-4av6A: 2.60 5dzkm-4av6A: 12.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DZK_Y_BEZY801_0 (ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT 1 ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT 2 BEZ-LEU-LEU)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 5	ILE A  64 GLY A 178 ILE A 185 LEU A  68	None	0.90A	5dzkd-4av6A: undetectable 5dzkk-4av6A: undetectable 5dzky-4av6A: undetectable	5dzkd-4av6A: 14.19 5dzkk-4av6A: 12.83 5dzky-4av6A: 2.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I3C_A_AC2A301_1 (PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 9	GLY A 640 ALA A 646 VAL A 642 MET A 647 ILE A 639	None	1.41A	5i3cA-4av6A: undetectable	5i3cA-4av6A: 17.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGJ_A_CTYA402_1 (MACROLIDE 2'-PHOSPHOTRANSFERAS E)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ILE A 706 ALA A 443 ALA A 444 MET A 447 GLY A 427	None	1.10A	5igjA-4av6A: undetectable	5igjA-4av6A: 18.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKQ_A_JMSA602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	LEU A  15 VAL A 133 GLY A 135 ALA A 137 LEU A 141	None	1.11A	5ikqA-4av6A: undetectable	5ikqA-4av6A: 21.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKT_A_TLFA601_0 (PROSTAGLANDIN G/H SYNTHASE 2)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	LEU A  15 VAL A 133 GLY A 135 ALA A 137 LEU A 141	None	1.08A	5iktA-4av6A: undetectable	5iktA-4av6A: 21.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JGL_B_SAMB301_0 (UBIE/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 431 LEU A 429 ALA A 366 GLY A 369 SER A 372	None	1.06A	5jglB-4av6A: undetectable	5jglB-4av6A: 17.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JGL_B_SAMB301_0 (UBIE/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 653 GLY A 657 ALA A 649 ALA A 380 GLY A 500	None	1.16A	5jglB-4av6A: undetectable	5jglB-4av6A: 17.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JGL_B_SAMB301_0 (UBIE/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 653 GLY A 657 ALA A 649 LEU A 702 ALA A 495	None None None None K  A1733 (-3.7A)	1.20A	5jglB-4av6A: undetectable	5jglB-4av6A: 17.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JGL_B_SAMB301_0 (UBIE/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ALA A 653 GLY A 657 LEU A 651 ALA A 649 ALA A 495	None None None None K  A1733 (-3.7A)	1.31A	5jglB-4av6A: undetectable	5jglB-4av6A: 17.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L4I_B_6J3B201_0 (TRANSTHYRETIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	LEU A 325 ALA A 329 SER A 301 THR A 332	None	1.17A	5l4iB-4av6A: undetectable	5l4iB-4av6A: 11.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5O96_A_SAMA501_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE E)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 11	LEU A 412 GLU A 381 LEU A 394 THR A 384 ALA A 658	None	0.94A	5o96A-4av6A: undetectable 5o96B-4av6A: undetectable	5o96A-4av6A: 17.23 5o96B-4av6A: 17.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UXD_A_ZITA501_1 (MACROLIDE 2'-PHOSPHOTRANSFERAS E MPHH)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	GLU A 381 TYR A 388 ALA A 489 GLY A 491	None	0.96A	5uxdA-4av6A: 1.3	5uxdA-4av6A: 18.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X80_B_SALB203_1 (UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 6	PRO A 614 GLY A 612 TYR A 613 VAL A 192	None	0.89A	5x80A-4av6A: 1.1 5x80B-4av6A: 1.2	5x80A-4av6A: 14.20 5x80B-4av6A: 14.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X80_C_SALC201_1 (UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	VAL A 192 PRO A 614 GLY A 612 TYR A 613	None	0.92A	5x80C-4av6A: 1.2 5x80D-4av6A: undetectable	5x80C-4av6A: 14.20 5x80D-4av6A: 14.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YBB_B_SAMB601_1 (TYPE I RESTRICTION-MODIFICA TION SYSTEM METHYLTRANSFERASE SUBUNIT)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	4 / 7	GLY A 195 GLY A 235 ASN A 606 THR A 603	None	0.70A	5ybbB-4av6A: 3.4	5ybbB-4av6A: 21.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DWN_D_AQ4D602_0 (CYTOCHROME P450 1A1)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 12	ILE A 186 GLY A 239 ALA A 238 ILE A  92 LEU A  50	None	1.10A	6dwnD-4av6A: 2.0	6dwnD-4av6A: 7.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6E5Z_A_CCSA106_0 (PROTEIN/NUCLEIC ACID DEGLYCASE DJ-1)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	5 / 10	GLY A 500 GLY A 498 ILE A 376 ALA A 502 GLY A 373	None	1.12A	6e5zA-4av6A: undetectable	6e5zA-4av6A: 15.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGC_A_ACTA810_0 (GEPHYRIN)	4av6	K(+)-STIMULATED PYROPHOSPHATE-ENERGI ZED SODIUM PUMP (Thermotoga maritima)	3 / 3	LEU A  50 SER A  48 PHE A  49	None	0.66A	6fgcA-4av6A: undetectable	6fgcA-4av6A: 21.88