SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4c22'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_J_TRPJ81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.76A	1c9sI-4c22A: undetectable 1c9sJ-4c22A: undetectable	1c9sI-4c22A: 8.11 1c9sJ-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_T_TRPT81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.75A	1c9sT-4c22A: undetectable 1c9sU-4c22A: undetectable	1c9sT-4c22A: 8.11 1c9sU-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_U_TRPU81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.76A	1c9sU-4c22A: undetectable 1c9sV-4c22A: undetectable	1c9sU-4c22A: 8.11 1c9sV-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CMA_A_SAMA105_0 (PROTEIN (MET REPRESSOR))	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	GLU A 210 ARG A 213 ARG A 214 LEU A 271	None	0.74A	1cmaA-4c22A: undetectable 1cmaB-4c22A: undetectable	1cmaA-4c22A: 11.88 1cmaB-4c22A: 11.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DVT_A_FLPA125_1 (TRANSTHYRETIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	LEU A 317 ALA A 295 LEU A 165 LEU A 169	None	0.96A	1dvtA-4c22A: undetectable 1dvtB-4c22A: undetectable	1dvtA-4c22A: 12.85 1dvtB-4c22A: 12.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_L_TRPL81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.74A	1gtfL-4c22A: undetectable 1gtfM-4c22A: undetectable	1gtfL-4c22A: 8.11 1gtfM-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_N_TRPN81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.74A	1gtfN-4c22A: undetectable 1gtfO-4c22A: undetectable	1gtfN-4c22A: 8.11 1gtfO-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_A_TRPA81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.75A	1gtnA-4c22A: undetectable 1gtnK-4c22A: undetectable	1gtnA-4c22A: 8.11 1gtnK-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_D_TRPD81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.81A	1gtnC-4c22A: undetectable 1gtnD-4c22A: undetectable	1gtnC-4c22A: 8.11 1gtnD-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_E_TRPE81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.78A	1gtnD-4c22A: undetectable 1gtnE-4c22A: undetectable	1gtnD-4c22A: 8.11 1gtnE-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_F_TRPF81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.73A	1gtnE-4c22A: undetectable 1gtnF-4c22A: undetectable	1gtnE-4c22A: 8.11 1gtnF-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_G_TRPG81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.74A	1gtnF-4c22A: undetectable 1gtnG-4c22A: undetectable	1gtnF-4c22A: 8.11 1gtnG-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_K_TRPK81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.77A	1gtnJ-4c22A: undetectable 1gtnK-4c22A: undetectable	1gtnJ-4c22A: 8.11 1gtnK-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KIA_A_SAMA293_0 (GLYCINE N-METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ILE A 105 ALA A 67 SER A 69 GLY A 91 TYR A 118	None	1.03A	1kiaA-4c22A: undetectable	1kiaA-4c22A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KIA_A_SAMA293_0 (GLYCINE N-METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ILE A 105 ALA A 68 SER A 69 GLY A 91 TYR A 118	None	1.09A	1kiaA-4c22A: undetectable	1kiaA-4c22A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KT5_A_RTLA176_0 (PLASMA RETINOL-BINDING PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	LEU A 43 ALA A 80 ALA A 161 LEU A 38 TYR A 45	None	1.22A	1kt5A-4c22A: undetectable	1kt5A-4c22A: 14.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NBH_B_SAMB1293_0 (GLYCINE N-METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ILE A 105 ALA A 67 SER A 69 GLY A 91 TYR A 118	None	1.02A	1nbhB-4c22A: undetectable	1nbhB-4c22A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NBH_B_SAMB1293_0 (GLYCINE N-METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ILE A 105 ALA A 68 SER A 69 GLY A 91 TYR A 118	None	1.06A	1nbhB-4c22A: undetectable	1nbhB-4c22A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q8J_B_C2FB802_0 (5-METHYLTETRAHYDROFO LATE S-HOMOCYSTEINE METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	SER A 40 ILE A 39 GLY A 8 SER A 56 ILE A 9	None	1.15A	1q8jB-4c22A: undetectable	1q8jB-4c22A: 22.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SG9_C_SAMC303_0 (HEMK PROTEIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ILE A 528 ALA A 333 VAL A 360 PHE A 501 ALA A 523	None	1.04A	1sg9C-4c22A: undetectable	1sg9C-4c22A: 19.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_I_TRPI81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	GLY A 400 THR A 499 THR A 449 THR A 395	None None None EDO A1590 (-4.9A)	0.74A	1utdI-4c22A: undetectable 1utdJ-4c22A: undetectable	1utdI-4c22A: 8.11 1utdJ-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1WU8_C_ADNC502_1 (HYPOTHETICAL PROTEIN PH0463)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	ASN A 336 TYR A 175 ASN A 203 VAL A 342	None	1.27A	1wu8A-4c22A: 2.2 1wu8C-4c22A: 0.9	1wu8A-4c22A: 18.95 1wu8C-4c22A: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2C49_A_ADNA1301_1 (SUGAR KINASE MJ0406)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	ASP A 311 GLY A 392 ASN A 390 THR A 304 GLN A 300	None None EDO A1590 (-4.6A) None CVU A1589 (-2.5A)	1.07A	2c49A-4c22A: undetectable	2c49A-4c22A: 20.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CBR_A_A80A201_1 (PROTEIN (CRABP-I))	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	VAL A 35 VAL A 153 THR A 539 LEU A 350 ARG A 162	None	1.18A	2cbrA-4c22A: undetectable	2cbrA-4c22A: 13.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OPX_A_DXCA1002_0 (ALDEHYDE DEHYDROGENASE A)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	GLY A 15 ARG A 21 TYR A 90	EDO A1591 (-4.2A) EDO A1591 (-4.0A) None	0.85A	2opxA-4c22A: undetectable	2opxA-4c22A: 23.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q63_A_1UNA1001_2 (PROTEASE RETROPEPSIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	ARG A 327 ASN A 347 THR A 395	None None EDO A1590 (-4.9A)	0.86A	2q63A-4c22A: undetectable	2q63A-4c22A: 10.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BA0_A_HAEA477_1 (MACROPHAGE METALLOELASTASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	HIS A 291 GLU A 204 HIS A 290	None	0.73A	3ba0A-4c22A: undetectable	3ba0A-4c22A: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_J_SAMJ300_0 (PUTATIVE RRNA METHYLASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	GLY A 392 ASN A 390 ASP A 493 ASP A 311 GLN A 257	None EDO A1590 (-4.6A) None None None	1.19A	3eeyJ-4c22A: 2.3	3eeyJ-4c22A: 16.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQA_A_DX4A270_0 (PTERIDINE REDUCTASE 1)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	SER A 444 PHE A 443 ASP A 241 PRO A 308	None	1.27A	3jqaA-4c22A: 7.0	3jqaA-4c22A: 20.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQA_B_DX4B270_0 (PTERIDINE REDUCTASE 1)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	SER A 444 PHE A 443 ASP A 241 PRO A 308	None	1.16A	3jqaB-4c22A: 7.0	3jqaB-4c22A: 20.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JQA_D_DX4D270_0 (PTERIDINE REDUCTASE 1)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	SER A 444 PHE A 443 ASP A 241 PRO A 308	None	1.29A	3jqaD-4c22A: 7.8	3jqaD-4c22A: 20.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L35_H_DHIH3_0 (GP41 N-PEPTIDE HIV ENTRY INHIBITOR PIE12)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	LEU A 386 TRP A 521 GLY A 522	None	0.78A	3l35A-4c22A: undetectable 3l35H-4c22A: undetectable	3l35A-4c22A: 5.68 3l35H-4c22A: 4.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ME6_B_CGEB501_1 (CYTOCHROME P450 2B4)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	PHE A 447 ILE A 528 THR A 353 VAL A 455	None	0.86A	3me6B-4c22A: undetectable	3me6B-4c22A: 23.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3QPS_A_CHDA211_0 (CMER)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 10	ALA A 133 PHE A 134 GLY A 135 ILE A 136 CYH A 89	None None EDO A1596 ( 4.2A) None None	1.47A	3qpsA-4c22A: undetectable	3qpsA-4c22A: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RXH_A_HSMA7_1 (CATIONIC TRYPSIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 5	ASP A 337 SER A 338 VAL A 190 GLY A 187	None	1.08A	3rxhA-4c22A: undetectable	3rxhA-4c22A: 15.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3THR_C_C2FC1410_0 (GLYCINE N-METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	ARG A 327 PRO A 46 PHE A 413	None	0.99A	3thrC-4c22A: undetectable	3thrC-4c22A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4GC9_A_SAMA401_0 (DIMETHYLADENOSINE TRANSFERASE 1, MITOCHONDRIAL)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	GLY A 379 VAL A 369 LEU A 480 PRO A 481 VAL A 484	None	0.88A	4gc9A-4c22A: undetectable	4gc9A-4c22A: 20.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J03_A_FVSA603_1 (BIFUNCTIONAL EPOXIDE HYDROLASE 2)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	TYR A 118 ILE A 60 PHE A 73 LEU A 43 LEU A 165	None	1.21A	4j03A-4c22A: 3.1	4j03A-4c22A: 21.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K87_A_ADNA602_1 (PROLINE--TRNA LIGASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	PHE A 316 GLY A 398 THR A 399 THR A 319	None	0.83A	4k87A-4c22A: 8.0	4k87A-4c22A: 23.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P6X_G_HCYG900_1 (GLUCOCORTICOID RECEPTOR)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	5 / 12	GLY A 475 LEU A 388 GLN A 355 THR A 351 ILE A 533	None	1.18A	4p6xG-4c22A: undetectable	4p6xG-4c22A: 19.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PAE_A_NIZA804_1 (CATALASE-PEROXIDASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	PHE A 385 LEU A 480 HIS A 375 THR A 373	None	1.19A	4paeA-4c22A: undetectable	4paeA-4c22A: 22.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QZU_D_ACTD201_0 (RETINOL-BINDING PROTEIN 2)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	ASP A 47 HIS A 4 LYS A 44	None	1.01A	4qzuD-4c22A: undetectable	4qzuD-4c22A: 11.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UCK_B_SAMB2409_1 (RNA-DIRECTED RNA POLYMERASE L)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	GLY A 495 ASP A 311 ASP A 241 ASP A 493	None	1.00A	4uckB-4c22A: undetectable	4uckB-4c22A: 20.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	SER A 23 ARG A 62 GLY A 61 GLU A 93	None	1.07A	5btcA-4c22A: 0.8 5btcC-4c22A: undetectable 5btcD-4c22A: 2.7	5btcA-4c22A: 21.86 5btcC-4c22A: 21.86 5btcD-4c22A: 18.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.75A	5eevL-4c22A: undetectable 5eevV-4c22A: undetectable	5eevL-4c22A: 8.11 5eevV-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.75A	5eewL-4c22A: undetectable 5eewV-4c22A: undetectable	5eewL-4c22A: 8.11 5eewV-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.75A	5eezL-4c22A: undetectable 5eezV-4c22A: undetectable	5eezL-4c22A: 8.11 5eezV-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.75A	5ef1L-4c22A: undetectable 5ef1V-4c22A: undetectable	5ef1L-4c22A: 8.11 5ef1V-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.74A	5ef2L-4c22A: undetectable 5ef2V-4c22A: undetectable	5ef2L-4c22A: 8.11 5ef2V-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF3_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	THR A 395 GLY A 400 THR A 499 THR A 449	EDO A1590 (-4.9A) None None None	0.74A	5ef3L-4c22A: undetectable 5ef3V-4c22A: undetectable	5ef3L-4c22A: 8.11 5ef3V-4c22A: 8.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EWU_B_BEZB1401_0 (MAGNESIUM-CHELATASE SUBUNIT CHLH, CHLOROPLASTIC)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 6	GLY A 91 THR A 94 SER A 125 VAL A 122	None	1.11A	5ewuB-4c22A: undetectable	5ewuB-4c22A: 20.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HIE_A_P06A801_2 (SERINE/THREONINE-PRO TEIN KINASE B-RAF)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	ILE A 189 GLY A 186 PHE A 332 PHE A 297	None	0.68A	5hieA-4c22A: undetectable	5hieA-4c22A: 18.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HIE_D_P06D801_2 (SERINE/THREONINE-PRO TEIN KINASE B-RAF)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 8	ILE A 189 GLY A 186 PHE A 332 PHE A 297	None	0.85A	5hieD-4c22A: undetectable	5hieD-4c22A: 18.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I9Y_A_1N1A1001_2 (EPHRIN TYPE-A RECEPTOR 2)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	ILE A 55 ILE A 39 MET A 29	None	0.71A	5i9yA-4c22A: undetectable	5i9yA-4c22A: 19.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N5D_B_SAMB303_1 (METHYLTRANSFERASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	GLY A 534 GLU A 474 ASP A 536 ASN A 347	None	1.11A	5n5dB-4c22A: 2.8	5n5dB-4c22A: 17.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6APH_A_ADNA501_2 (ADENOSYLHOMOCYSTEINA SE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 5	THR A 373 THR A 362 HIS A 387 LEU A 480	None	1.32A	6aphA-4c22A: 6.3	6aphA-4c22A: 21.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B58_A_ACTA608_0 (FUMARATE REDUCTASE FLAVOPROTEIN SUBUNIT)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	GLY A 61 THR A 94 GLU A 93	None	0.65A	6b58A-4c22A: undetectable	6b58A-4c22A: 23.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EKZ_A_SNPA413_0 (AROMATIC PEROXYGENASE)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 7	GLN A 257 GLY A 299 PHE A 297 GLY A 310	None	0.94A	6ekzA-4c22A: undetectable	6ekzA-4c22A: 9.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA826_0 (GEPHYRIN)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	3 / 3	HIS A 551 ARG A 560 ILE A 538	None	0.65A	6fgdA-4c22A: 7.2	6fgdA-4c22A: 21.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GBN_B_ADNB501_2 (-)	4c22	L-FUCOSE ISOMERASE (Streptococcus pneumoniae)	4 / 5	THR A 373 THR A 362 HIS A 387 LEU A 480	None	1.31A	6gbnB-4c22A: 6.1	6gbnB-4c22A: 21.94

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_J_TRPJ81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.76A","1c9sI-4c22A:undetectable;1c9sJ-4c22A:undetectable","1c9sI-4c22A:8.11;1c9sJ-4c22A:8.11"],["1C9S_T_TRPT81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.75A","1c9sT-4c22A:undetectable;1c9sU-4c22A:undetectable","1c9sT-4c22A:8.11;1c9sU-4c22A:8.11"],["1C9S_U_TRPU81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.76A","1c9sU-4c22A:undetectable;1c9sV-4c22A:undetectable","1c9sU-4c22A:8.11;1c9sV-4c22A:8.11"],["1CMA_A_SAMA105_0","PROTEIN (MET REPRESSOR)","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLU A 210;ARG A 213;ARG A 214;LEU A 271","None","0.74A","1cmaA-4c22A:undetectable;1cmaB-4c22A:undetectable","1cmaA-4c22A:11.88;1cmaB-4c22A:11.88"],["1DVT_A_FLPA125_1","TRANSTHYRETIN;TRANSTHYRETIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"LEU A 317;ALA A 295;LEU A 165;LEU A 169","None","0.96A","1dvtA-4c22A:undetectable;1dvtB-4c22A:undetectable","1dvtA-4c22A:12.85;1dvtB-4c22A:12.85"],["1GTF_L_TRPL81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.74A","1gtfL-4c22A:undetectable;1gtfM-4c22A:undetectable","1gtfL-4c22A:8.11;1gtfM-4c22A:8.11"],["1GTF_N_TRPN81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.74A","1gtfN-4c22A:undetectable;1gtfO-4c22A:undetectable","1gtfN-4c22A:8.11;1gtfO-4c22A:8.11"],["1GTN_A_TRPA81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.75A","1gtnA-4c22A:undetectable;1gtnK-4c22A:undetectable","1gtnA-4c22A:8.11;1gtnK-4c22A:8.11"],["1GTN_D_TRPD81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.81A","1gtnC-4c22A:undetectable;1gtnD-4c22A:undetectable","1gtnC-4c22A:8.11;1gtnD-4c22A:8.11"],["1GTN_E_TRPE81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.78A","1gtnD-4c22A:undetectable;1gtnE-4c22A:undetectable","1gtnD-4c22A:8.11;1gtnE-4c22A:8.11"],["1GTN_F_TRPF81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.73A","1gtnE-4c22A:undetectable;1gtnF-4c22A:undetectable","1gtnE-4c22A:8.11;1gtnF-4c22A:8.11"],["1GTN_G_TRPG81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.74A","1gtnF-4c22A:undetectable;1gtnG-4c22A:undetectable","1gtnF-4c22A:8.11;1gtnG-4c22A:8.11"],["1GTN_K_TRPK81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.77A","1gtnJ-4c22A:undetectable;1gtnK-4c22A:undetectable","1gtnJ-4c22A:8.11;1gtnK-4c22A:8.11"],["1KIA_A_SAMA293_0","GLYCINE N-METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ILE A 105;ALA A  67;SER A  69;GLY A  91;TYR A 118","None","1.03A","1kiaA-4c22A:undetectable","1kiaA-4c22A:20.49"],["1KIA_A_SAMA293_0","GLYCINE N-METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ILE A 105;ALA A  68;SER A  69;GLY A  91;TYR A 118","None","1.09A","1kiaA-4c22A:undetectable","1kiaA-4c22A:20.49"],["1KT5_A_RTLA176_0","PLASMA RETINOL-BINDING PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"LEU A  43;ALA A  80;ALA A 161;LEU A  38;TYR A  45","None","1.22A","1kt5A-4c22A:undetectable","1kt5A-4c22A:14.97"],["1NBH_B_SAMB1293_0","GLYCINE N-METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ILE A 105;ALA A  67;SER A  69;GLY A  91;TYR A 118","None","1.02A","1nbhB-4c22A:undetectable","1nbhB-4c22A:20.49"],["1NBH_B_SAMB1293_0","GLYCINE N-METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ILE A 105;ALA A  68;SER A  69;GLY A  91;TYR A 118","None","1.06A","1nbhB-4c22A:undetectable","1nbhB-4c22A:20.49"],["1Q8J_B_C2FB802_0","5-METHYLTETRAHYDROFOLATE S-HOMOCYSTEINE METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"SER A  40;ILE A  39;GLY A   8;SER A  56;ILE A   9","None","1.15A","1q8jB-4c22A:undetectable","1q8jB-4c22A:22.39"],["1SG9_C_SAMC303_0","HEMK PROTEIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ILE A 528;ALA A 333;VAL A 360;PHE A 501;ALA A 523","None","1.04A","1sg9C-4c22A:undetectable","1sg9C-4c22A:19.60"],["1UTD_I_TRPI81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 400;THR A 499;THR A 449;THR A 395","None;None;None;EDO A1590 (-4.9A)","0.74A","1utdI-4c22A:undetectable;1utdJ-4c22A:undetectable","1utdI-4c22A:8.11;1utdJ-4c22A:8.11"],["1WU8_C_ADNC502_1","HYPOTHETICAL PROTEIN PH0463;HYPOTHETICAL PROTEIN PH0463","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"ASN A 336;TYR A 175;ASN A 203;VAL A 342","None","1.27A","1wu8A-4c22A:2.2;1wu8C-4c22A:0.9","1wu8A-4c22A:18.95;1wu8C-4c22A:18.95"],["2C49_A_ADNA1301_1","SUGAR KINASE MJ0406","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ASP A 311;GLY A 392;ASN A 390;THR A 304;GLN A 300","None;None;EDO A1590 (-4.6A);None;CVU A1589 (-2.5A)","1.07A","2c49A-4c22A:undetectable","2c49A-4c22A:20.27"],["2CBR_A_A80A201_1","PROTEIN (CRABP-I)","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"VAL A  35;VAL A 153;THR A 539;LEU A 350;ARG A 162","None","1.18A","2cbrA-4c22A:undetectable","2cbrA-4c22A:13.52"],["2OPX_A_DXCA1002_0","ALDEHYDE DEHYDROGENASE A","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"GLY A  15;ARG A  21;TYR A  90","EDO A1591 (-4.2A);EDO A1591 (-4.0A);None","0.85A","2opxA-4c22A:undetectable","2opxA-4c22A:23.21"],["2Q63_A_1UNA1001_2","PROTEASE RETROPEPSIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"ARG A 327;ASN A 347;THR A 395","None;None;EDO A1590 (-4.9A)","0.86A","2q63A-4c22A:undetectable","2q63A-4c22A:10.45"],["3BA0_A_HAEA477_1","MACROPHAGE METALLOELASTASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"HIS A 291;GLU A 204;HIS A 290","None","0.73A","3ba0A-4c22A:undetectable","3ba0A-4c22A:22.30"],["3EEY_J_SAMJ300_0","PUTATIVE RRNA METHYLASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"GLY A 392;ASN A 390;ASP A 493;ASP A 311;GLN A 257","None;EDO A1590 (-4.6A);None;None;None","1.19A","3eeyJ-4c22A:2.3","3eeyJ-4c22A:16.27"],["3JQA_A_DX4A270_0","PTERIDINE REDUCTASE 1","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"SER A 444;PHE A 443;ASP A 241;PRO A 308","None","1.27A","3jqaA-4c22A:7.0","3jqaA-4c22A:20.72"],["3JQA_B_DX4B270_0","PTERIDINE REDUCTASE 1","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"SER A 444;PHE A 443;ASP A 241;PRO A 308","None","1.16A","3jqaB-4c22A:7.0","3jqaB-4c22A:20.72"],["3JQA_D_DX4D270_0","PTERIDINE REDUCTASE 1","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"SER A 444;PHE A 443;ASP A 241;PRO A 308","None","1.29A","3jqaD-4c22A:7.8","3jqaD-4c22A:20.72"],["3L35_H_DHIH3_0","GP41 N-PEPTIDE;HIV ENTRY INHIBITOR PIE12","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"LEU A 386;TRP A 521;GLY A 522","None","0.78A","3l35A-4c22A:undetectable;3l35H-4c22A:undetectable","3l35A-4c22A:5.68;3l35H-4c22A:4.03"],["3ME6_B_CGEB501_1","CYTOCHROME P450 2B4","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"PHE A 447;ILE A 528;THR A 353;VAL A 455","None","0.86A","3me6B-4c22A:undetectable","3me6B-4c22A:23.44"],["3QPS_A_CHDA211_0","CMER","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"ALA A 133;PHE A 134;GLY A 135;ILE A 136;CYH A  89","None;None;EDO A1596 ( 4.2A);None;None","1.47A","3qpsA-4c22A:undetectable","3qpsA-4c22A:16.67"],["3RXH_A_HSMA7_1","CATIONIC TRYPSIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"ASP A 337;SER A 338;VAL A 190;GLY A 187","None","1.08A","3rxhA-4c22A:undetectable","3rxhA-4c22A:15.02"],["3THR_C_C2FC1410_0","GLYCINE N-METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"ARG A 327;PRO A  46;PHE A 413","None","0.99A","3thrC-4c22A:undetectable","3thrC-4c22A:20.49"],["4GC9_A_SAMA401_0","DIMETHYLADENOSINE TRANSFERASE 1, MITOCHONDRIAL","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"GLY A 379;VAL A 369;LEU A 480;PRO A 481;VAL A 484","None","0.88A","4gc9A-4c22A:undetectable","4gc9A-4c22A:20.92"],["4J03_A_FVSA603_1","BIFUNCTIONAL EPOXIDE HYDROLASE 2","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"TYR A 118;ILE A  60;PHE A  73;LEU A  43;LEU A 165","None","1.21A","4j03A-4c22A:3.1","4j03A-4c22A:21.47"],["4K87_A_ADNA602_1","PROLINE--TRNA LIGASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"PHE A 316;GLY A 398;THR A 399;THR A 319","None","0.83A","4k87A-4c22A:8.0","4k87A-4c22A:23.91"],["4P6X_G_HCYG900_1","GLUCOCORTICOID RECEPTOR","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",5,"GLY A 475;LEU A 388;GLN A 355;THR A 351;ILE A 533","None","1.18A","4p6xG-4c22A:undetectable","4p6xG-4c22A:19.50"],["4PAE_A_NIZA804_1","CATALASE-PEROXIDASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"PHE A 385;LEU A 480;HIS A 375;THR A 373","None","1.19A","4paeA-4c22A:undetectable","4paeA-4c22A:22.11"],["4QZU_D_ACTD201_0","RETINOL-BINDING PROTEIN 2","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"ASP A  47;HIS A   4;LYS A  44","None","1.01A","4qzuD-4c22A:undetectable","4qzuD-4c22A:11.61"],["4UCK_B_SAMB2409_1","RNA-DIRECTED RNA POLYMERASE L","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 495;ASP A 311;ASP A 241;ASP A 493","None","1.00A","4uckB-4c22A:undetectable","4uckB-4c22A:20.35"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"SER A  23;ARG A  62;GLY A  61;GLU A  93","None","1.07A","5btcA-4c22A:0.8;5btcC-4c22A:undetectable;5btcD-4c22A:2.7","5btcA-4c22A:21.86;5btcC-4c22A:21.86;5btcD-4c22A:18.23"],["5EEV_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.75A","5eevL-4c22A:undetectable;5eevV-4c22A:undetectable","5eevL-4c22A:8.11;5eevV-4c22A:8.11"],["5EEW_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.75A","5eewL-4c22A:undetectable;5eewV-4c22A:undetectable","5eewL-4c22A:8.11;5eewV-4c22A:8.11"],["5EEZ_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.75A","5eezL-4c22A:undetectable;5eezV-4c22A:undetectable","5eezL-4c22A:8.11;5eezV-4c22A:8.11"],["5EF1_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.75A","5ef1L-4c22A:undetectable;5ef1V-4c22A:undetectable","5ef1L-4c22A:8.11;5ef1V-4c22A:8.11"],["5EF2_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.74A","5ef2L-4c22A:undetectable;5ef2V-4c22A:undetectable","5ef2L-4c22A:8.11;5ef2V-4c22A:8.11"],["5EF3_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 395;GLY A 400;THR A 499;THR A 449","EDO A1590 (-4.9A);None;None;None","0.74A","5ef3L-4c22A:undetectable;5ef3V-4c22A:undetectable","5ef3L-4c22A:8.11;5ef3V-4c22A:8.11"],["5EWU_B_BEZB1401_0","MAGNESIUM-CHELATASE SUBUNIT CHLH, CHLOROPLASTIC","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A  91;THR A  94;SER A 125;VAL A 122","None","1.11A","5ewuB-4c22A:undetectable","5ewuB-4c22A:20.30"],["5HIE_A_P06A801_2","SERINE\/THREONINE-PROTEIN KINASE B-RAF","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"ILE A 189;GLY A 186;PHE A 332;PHE A 297","None","0.68A","5hieA-4c22A:undetectable","5hieA-4c22A:18.89"],["5HIE_D_P06D801_2","SERINE\/THREONINE-PROTEIN KINASE B-RAF","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"ILE A 189;GLY A 186;PHE A 332;PHE A 297","None","0.85A","5hieD-4c22A:undetectable","5hieD-4c22A:18.89"],["5I9Y_A_1N1A1001_2","EPHRIN TYPE-A RECEPTOR 2","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"ILE A  55;ILE A  39;MET A  29","None","0.71A","5i9yA-4c22A:undetectable","5i9yA-4c22A:19.87"],["5N5D_B_SAMB303_1","METHYLTRANSFERASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLY A 534;GLU A 474;ASP A 536;ASN A 347","None","1.11A","5n5dB-4c22A:2.8","5n5dB-4c22A:17.32"],["6APH_A_ADNA501_2","ADENOSYLHOMOCYSTEINASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 373;THR A 362;HIS A 387;LEU A 480","None","1.32A","6aphA-4c22A:6.3","6aphA-4c22A:21.57"],["6B58_A_ACTA608_0","FUMARATE REDUCTASE FLAVOPROTEIN SUBUNIT","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"GLY A  61;THR A  94;GLU A  93","None","0.65A","6b58A-4c22A:undetectable","6b58A-4c22A:23.22"],["6EKZ_A_SNPA413_0","AROMATIC PEROXYGENASE","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"GLN A 257;GLY A 299;PHE A 297;GLY A 310","None","0.94A","6ekzA-4c22A:undetectable","6ekzA-4c22A:9.56"],["6FGD_A_ACTA826_0","GEPHYRIN","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",3,"HIS A 551;ARG A 560;ILE A 538","None","0.65A","6fgdA-4c22A:7.2","6fgdA-4c22A:21.80"],["6GBN_B_ADNB501_2","-","4c22","L-FUCOSE ISOMERASE","Streptococcus pneumoniae",4,"THR A 373;THR A 362;HIS A 387;LEU A 480","None","1.31A","6gbnB-4c22A:6.1","6gbnB-4c22A:21.94"]]