SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4f92'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DB1_A_VDXA428_1 (VITAMIN D NUCLEAR RECEPTOR)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	LEU B 628 LEU B 631 VAL B 632 CYH B 588 LEU B 500	None	1.29A	1db1A-4f92B: undetectable	1db1A-4f92B: 9.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTI_D_CCSD47_0 (GLUTATHIONE S-TRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	TRP B1652 THR B1352 LEU B1490 LEU B1458	None	0.99A	1gtiD-4f92B: undetectable	1gtiD-4f92B: 8.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HZ4_A_BEZA784_0 (MALT REGULATORY PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	HIS B 618 LEU B 882 LEU B 887 PRO B 888	None	1.22A	1hz4A-4f92B: 2.2	1hz4A-4f92B: 12.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IKW_A_EFZA2000_1 (POL POLYPROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	LEU B1597 VAL B1617 VAL B1632 GLY B1618 LEU B1590	None	1.42A	1ikwA-4f92B: undetectable	1ikwA-4f92B: 15.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KB9_A_PCFA514_0 (CYTOCHROME B CYTOCHROME C1, HEME PROTEIN UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX CORE PROTEIN I UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ILE B 538 VAL B 548 MET B 551 SER B 554	None	1.12A	1kb9A-4f92B: undetectable 1kb9C-4f92B: undetectable 1kb9D-4f92B: undetectable 1kb9E-4f92B: undetectable	1kb9A-4f92B: 13.57 1kb9C-4f92B: 12.08 1kb9D-4f92B: 9.02 1kb9E-4f92B: 7.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_C_BEZC505_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	TYR B1771 ILE B1459 PRO B1465 GLU B1468	None	1.41A	1oniA-4f92B: undetectable 1oniC-4f92B: undetectable	1oniA-4f92B: 6.15 1oniC-4f92B: 6.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6K_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.26A	1p6kA-4f92B: undetectable	1p6kA-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6K_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.16A	1p6kA-4f92B: undetectable	1p6kA-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6K_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.32A	1p6kB-4f92B: undetectable	1p6kB-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6K_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.07A	1p6kB-4f92B: undetectable	1p6kB-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PK2_A_ACAA91_1 (TISSUE-TYPE PLASMINOGEN ACTIVATOR)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	VAL B1452 TYR B1378 ASP B1392 TRP B1393	None	1.25A	1pk2A-4f92B: undetectable	1pk2A-4f92B: 4.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_B_FUAB703_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	VAL B1741 ALA B1738 HIS B1735	None	0.71A	1q23C-4f92B: undetectable	1q23C-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_E_FUAE706_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 4	ALA B1820 VAL B1741 ALA B1738 HIS B1735	None	1.25A	1q23F-4f92B: undetectable	1q23F-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_G_FUAG708_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	VAL B1741 ALA B1738 HIS B1735	None	0.72A	1q23H-4f92B: undetectable	1q23H-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_K_FUAK712_1 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.47A	1q23K-4f92B: undetectable	1q23K-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q23_K_FUAK712_2 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	VAL B1741 ALA B1738 HIS B1735	None	0.72A	1q23L-4f92B: undetectable	1q23L-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q8J_A_C2FA801_0 (5-METHYLTETRAHYDROFO LATE S-HOMOCYSTEINE METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B1468 ARG B1762 GLY B1460 SER B1726 ILE B1459	None	1.28A	1q8jA-4f92B: undetectable	1q8jA-4f92B: 16.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q8J_B_C2FB802_0 (5-METHYLTETRAHYDROFO LATE S-HOMOCYSTEINE METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B1468 SER B1491 GLY B1460 SER B1726 ILE B1459	None	1.22A	1q8jB-4f92B: 2.0	1q8jB-4f92B: 16.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS6_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.33A	1rs6A-4f92B: undetectable	1rs6A-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS6_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.17A	1rs6A-4f92B: undetectable	1rs6A-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS6_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.10A	1rs6B-4f92B: undetectable	1rs6B-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS7_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.30A	1rs7B-4f92B: undetectable	1rs7B-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS7_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	0.97A	1rs7B-4f92B: undetectable	1rs7B-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZQ_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.29A	1zzqA-4f92B: undetectable	1zzqA-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZQ_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.12A	1zzqB-4f92B: undetectable	1zzqB-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.18A	1zzuA-4f92B: undetectable	1zzuA-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.12A	1zzuA-4f92B: undetectable	1zzuA-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.30A	1zzuB-4f92B: undetectable	1zzuB-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_B_MTLB871_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.10A	1zzuB-4f92B: undetectable	1zzuB-4f92B: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A15_A_NCAA1001_0 (HYPOTHETICAL PROTEIN RV0760C)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	VAL B 661 ILE B 889 LEU B 620 LEU B 614 LEU B 628	None	1.29A	2a15A-4f92B: undetectable	2a15A-4f92B: 6.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BR4_F_SAMF301_1 (CEPHALOSPORIN HYDROXYLASE CMCI)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	LYS B1918 ASP B1734 CYH B1731	None	1.12A	2br4F-4f92B: undetectable	2br4F-4f92B: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXE_B_1FLB2002_1 (SERUM ALBUMIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	ALA B 507 ALA B 503 LEU B 501 GLU B 616 VAL B 512	None	1.14A	2bxeB-4f92B: 3.0	2bxeB-4f92B: 15.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2C6N_B_LPRB705_2 (ANGIOTENSIN-CONVERTI NG ENZYME, SOMATIC ISOFORM)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	ALA B1497 THR B1511 PHE B1759	None	0.78A	2c6nB-4f92B: undetectable	2c6nB-4f92B: 15.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DDW_B_PXLB1005_1 (PYRIDOXINE KINASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	LEU B1571 THR B1569 HIS B1621 GLY B1618	None	0.84A	2ddwB-4f92B: undetectable	2ddwB-4f92B: 11.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E7F_A_C2FA3000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B 890 PHE B 416 ILE B 617 LEU B 665 ILE B 889	None	1.22A	2e7fA-4f92B: undetectable	2e7fA-4f92B: 9.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E7F_B_C2FB4000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B 890 PHE B 416 ILE B 617 LEU B 665 ILE B 889	None	1.17A	2e7fB-4f92B: undetectable	2e7fB-4f92B: 9.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2H42_C_VIAC903_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	LEU B1320 LEU B1365 ALA B1363 ILE B1426 PHE B1397	None	0.85A	2h42C-4f92B: undetectable	2h42C-4f92B: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OGY_A_C2FA3000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B 890 PHE B 416 ILE B 617 LEU B 665 ILE B 889	None	1.20A	2ogyA-4f92B: undetectable	2ogyA-4f92B: 9.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OGY_B_C2FB4000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLU B 890 PHE B 416 ILE B 617 LEU B 665 ILE B 889	None	1.17A	2ogyB-4f92B: undetectable	2ogyB-4f92B: 9.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WX2_A_TPFA1460_1 (LANOSTEROL 14-ALPHA-DEMETHYLASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	MET B2109 TYR B2107 ALA B1939 ALA B1941	None	0.92A	2wx2A-4f92B: undetectable	2wx2A-4f92B: 14.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YVL_C_SAMC604_1 (HYPOTHETICAL PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 4	GLY B1074 GLU B1036 ASP B1080 TYR B 834	None	1.34A	2yvlC-4f92B: 2.8	2yvlC-4f92B: 10.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZJ0_C_2FAC500_2 (ADENOSYLHOMOCYSTEINA SE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	LEU B1781 GLN B1766 THR B1765 THR B1756	None	1.18A	2zj0C-4f92B: undetectable	2zj0C-4f92B: 14.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A25_A_SAMA279_1 (UNCHARACTERIZED PROTEIN PH0793)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	MET B 641 GLU B 602 ASP B 594	None	1.06A	3a25A-4f92B: 2.9	3a25A-4f92B: 11.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3APV_B_TP0B190_1 (ALPHA-1-ACID GLYCOPROTEIN 2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	PHE B 979 TYR B 972 VAL B 970 LEU B 411 HIS B 958	None	1.43A	3apvB-4f92B: undetectable	3apvB-4f92B: 9.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_B_SVRB501_2 (PHOSPHOLIPASE A2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	VAL B 970 LEU B 969 GLY B 985 ILE B 987 LYS B 592	None	1.15A	3bjwB-4f92B: undetectable	3bjwB-4f92B: 5.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_E_SVRE503_1 (PHOSPHOLIPASE A2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	VAL B 970 LEU B 969 GLY B 985 ILE B 987 LYS B 592	None	1.31A	3bjwE-4f92B: undetectable	3bjwE-4f92B: 5.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_F_SVRF502_3 (PHOSPHOLIPASE A2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	VAL B 970 LEU B 969 GLY B 985 ILE B 987 LYS B 592	None	1.23A	3bjwF-4f92B: undetectable	3bjwF-4f92B: 5.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CE6_B_ADNB500_2 (ADENOSYLHOMOCYSTEINA SE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	LEU B1781 GLN B1766 THR B1765 THR B1756	None	1.12A	3ce6B-4f92B: undetectable	3ce6B-4f92B: 15.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CZH_A_D2VA602_2 (CYTOCHROME P450 2R1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	LEU B 631 GLU B 602 ILE B 596	None	0.53A	3czhA-4f92B: undetectable	3czhA-4f92B: 13.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DCJ_B_THHB401_0 (PROBABLE 5'-PHOSPHORIBOSYLGLY CINAMIDE FORMYLTRANSFERASE PURN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	SER B 420 LEU B 887 LEU B 655 THR B 831	None	0.85A	3dcjB-4f92B: undetectable	3dcjB-4f92B: 9.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3J7Z_A_ERYA9000_0 (23S RRNA 50S RIBOSOMAL PROTEIN L22 ERMCL NASCENT CHAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	LYS B1716 ILE B1268 PHE B1267	None	0.85A	3j7zS-4f92B: undetectable 3j7za-4f92B: undetectable	3j7zS-4f92B: 5.33 3j7za-4f92B: 1.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K37_B_BCZB468_1 (NEURAMINIDASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	ARG B 558 GLU B 550 TYR B 540	None	0.86A	3k37B-4f92B: undetectable	3k37B-4f92B: 12.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3M7R_A_VDXA425_1 (VITAMIN D3 RECEPTOR)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	LEU B 628 LEU B 631 VAL B 632 CYH B 588 LEU B 500	None	1.28A	3m7rA-4f92B: undetectable	3m7rA-4f92B: 9.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MDT_A_VORA506_1 (CHOLESTEROL 24-HYDROXYLASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 9	SER B 881 ILE B 849 ALA B 846 ALA B 653 THR B 505	None	1.18A	3mdtA-4f92B: undetectable	3mdtA-4f92B: 14.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N62_A_MTLA870_0 (NITRIC OXIDE SYNTHASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.01A	3n62A-4f92B: 1.2	3n62A-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N62_B_MTLB870_0 (NITRIC OXIDE SYNTHASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.03A	3n62B-4f92B: undetectable	3n62B-4f92B: 13.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N66_B_MTLB870_0 (NITRIC OXIDE SYNTHASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.09A	3n66B-4f92B: 1.3	3n66B-4f92B: 13.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NRR_A_D16A520_1 (DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	ALA B1088 LEU B1114 ILE B1046 PRO B1045 LEU B1014	None	0.99A	3nrrA-4f92B: undetectable	3nrrA-4f92B: 15.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NRR_B_D16B520_1 (DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	ALA B1088 LEU B1114 ILE B1046 PRO B1045 LEU B1014	None	1.01A	3nrrB-4f92B: undetectable	3nrrB-4f92B: 15.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OI8_A_ADNA2_1 (UNCHARACTERIZED PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	ASN B1463 PRO B1381 LEU B1458 ASP B1683	None	1.11A	3oi8A-4f92B: undetectable	3oi8A-4f92B: 7.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUF_B_SUEB1201_3 (NS3 PROTEASE, NS4A PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	ARG B 858 PRO B 859 TYR B 861 VAL B 683	None	1.39A	3sufC-4f92B: undetectable	3sufC-4f92B: 8.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3Z_B_9PLB501_1 (CYTOCHROME P450 2E1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	LEU B1613 ALA B1646 THR B1569 LEU B1624	None	1.00A	3t3zB-4f92B: undetectable	3t3zB-4f92B: 14.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TGV_C_BEZC1_0 (HEME-BINDING PROTEIN HUTZ)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	TYR B1266 PHE B1286 PRO B1263 LEU B1289	None	1.43A	3tgvC-4f92B: undetectable	3tgvC-4f92B: 6.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_E_CLME221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.47A	3u9fE-4f92B: undetectable	3u9fE-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_K_CLMK221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.44A	3u9fK-4f92B: undetectable	3u9fK-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_N_CLMN221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.45A	3u9fN-4f92B: undetectable 3u9fO-4f92B: undetectable	3u9fN-4f92B: 9.26 3u9fO-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_P_CLMP221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 9	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.49A	3u9fP-4f92B: undetectable	3u9fP-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U9F_S_CLMS221_0 (CHLORAMPHENICOL ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	THR B1194 LEU B1494 VAL B1500 PHE B1759 VAL B1724	None	1.44A	3u9fP-4f92B: undetectable 3u9fS-4f92B: undetectable	3u9fP-4f92B: 9.26 3u9fS-4f92B: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_A_W9TA1002_1 (HEMOLYTIC LECTIN CEL-III)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	ASP B1415 GLU B1411 GLY B1410	None	0.67A	3w9tA-4f92B: undetectable	3w9tA-4f92B: 13.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A97_D_ZPCD1318_1 (CYS-LOOP LIGAND-GATED ION CHANNEL)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	VAL B1099 MET B1092 ILE B1095 GLU B1226	None	1.07A	4a97C-4f92B: undetectable	4a97C-4f92B: 10.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4AC9_C_DXCC1477_0 (MJ0495-LIKE PROTEIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	THR B 561 GLY B 563 ILE B 531 LEU B 559	None	1.11A	4ac9C-4f92B: 3.4	4ac9C-4f92B: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ACA_C_DXCC1477_0 (TRANSLATION ELONGATION FACTOR SELB)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	THR B 561 GLY B 563 ILE B 531 LEU B 559	None	1.07A	4acaC-4f92B: undetectable	4acaC-4f92B: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ACB_C_DXCC1477_0 (TRANSLATION ELONGATION FACTOR SELB)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	THR B 561 GLY B 563 ILE B 531 LEU B 559	None	1.05A	4acbC-4f92B: undetectable	4acbC-4f92B: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ARC_A_LEUA1001_0 (LEUCINE--TRNA LIGASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	LEU B 500 TYR B 675 SER B 652 TYR B 924	None	1.33A	4arcA-4f92B: undetectable	4arcA-4f92B: 18.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DF3_B_SAMB301_1 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	TYR B 675 THR B 654 GLU B 659	None	0.82A	4df3B-4f92B: 2.3	4df3B-4f92B: 8.91
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	4F93_B_SANB3004_1 (U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	8 / 8	GLU B1097 TRP B1222 HIS B1236 GLU B1237 ASN B1531 GLN B1707 GLY B1708 SER B1709	SAN  B2201 (-3.1A) None SAN  B2201 (-3.4A) None SAN  B2201 (-3.3A) SAN  B2201 (-3.6A) SAN  B2201 (-3.6A) SAN  B2201 (-3.7A)	0.27A	4f93B-4f92B: 56.1	4f93B-4f92B: 100.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KCN_B_MTLB806_0 (NITRIC OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.07A	4kcnB-4f92B: 1.0	4kcnB-4f92B: 13.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OKX_A_198A1002_1 (ANDROGEN RECEPTOR)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	GLN B1528 MET B1664 MET B1705 THR B1572 VAL B1645	None	1.36A	4okxA-4f92B: undetectable	4okxA-4f92B: 9.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PO0_A_NPSA601_1 (SERUM ALBUMIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	PHE B1397 LEU B1368 VAL B1452 LEU B1450 ARG B1486	None	1.23A	4po0A-4f92B: 3.1	4po0A-4f92B: 16.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QTU_D_SAMD301_1 (PUTATIVE METHYLTRANSFERASE BUD23)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	LEU B1540 SER B1541 ASP B1665 ASP B1678	None	1.17A	4qtuD-4f92B: 4.3	4qtuD-4f92B: 8.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QWP_A_GCSA303_1 (CHITOSANASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	GLU B 843 TYR B 878 ILE B 849 HIS B 726	None	1.05A	4qwpA-4f92B: undetectable	4qwpA-4f92B: 9.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R3A_B_RBFB402_2 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	ALA B 471 ARG B 558 ALA B 513 ILE B 585 GLY B 522	None	1.02A	4r3aB-4f92B: undetectable	4r3aB-4f92B: 11.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RV6_A_RPBA1103_1 (POLY [ADP-RIBOSE] POLYMERASE 1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	GLU B1361 GLY B1353 TYR B1378 ALA B1350 SER B1354	None	1.45A	4rv6A-4f92B: undetectable	4rv6A-4f92B: 12.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RV6_B_RPBB1103_1 (POLY [ADP-RIBOSE] POLYMERASE 1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 11	GLU B1361 GLY B1353 TYR B1378 ALA B1350 SER B1354	None	1.44A	4rv6B-4f92B: undetectable	4rv6B-4f92B: 12.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4W5O_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	PHE B1514 PRO B1516 VAL B1518 ALA B1350	None	1.14A	4w5oA-4f92B: 2.1	4w5oA-4f92B: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WS0_A_URFA301_1 (URACIL-DNA GLYCOSYLASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	GLY B 908 GLN B 911 ASN B 909 HIS B1548	None	0.91A	4ws0A-4f92B: undetectable	4ws0A-4f92B: 10.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WS1_A_URFA301_1 (URACIL-DNA GLYCOSYLASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	GLY B 908 GLN B 911 ASN B 909 HIS B1548	None	0.94A	4ws1A-4f92B: undetectable	4ws1A-4f92B: 10.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X20_B_LOCB502_1 (TUBULIN BETA CHAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	6 / 12	LEU B 500 LEU B 488 LEU B 651 ALA B 513 ALA B 492 ILE B 613	None	1.25A	4x20B-4f92B: undetectable	4x20B-4f92B: 14.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XUM_A_IMNA502_1 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 7	ILE B 586 CYH B 588 LEU B 631 ILE B 596	None	0.87A	4xumA-4f92B: undetectable	4xumA-4f92B: 10.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YO9_B_ACTB401_0 (3C-LIKE PROTEINASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	ARG B1538 ASP B1665 TYR B1676	None	0.73A	4yo9B-4f92B: undetectable	4yo9B-4f92B: 10.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4C_A_IPHA905_0 (PROTEIN ARGONAUTE-2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	PHE B1514 PRO B1516 VAL B1518 ALA B1350	None	1.13A	4z4cA-4f92B: 2.4	4z4cA-4f92B: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4D_A_IPHA904_0 (PROTEIN ARGONAUTE-2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	PHE B1514 PRO B1516 VAL B1518 ALA B1350	None	1.14A	4z4dA-4f92B: undetectable	4z4dA-4f92B: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4E_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	PHE B1514 PRO B1516 VAL B1518 ALA B1350	None	1.13A	4z4eA-4f92B: 2.2	4z4eA-4f92B: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	ALA B1079 ARG B 624 THR B 589 GLU B 591	None	0.96A	5btgA-4f92B: 2.3 5btgB-4f92B: 2.7 5btgC-4f92B: 2.8	5btgA-4f92B: 15.04 5btgB-4f92B: 10.15 5btgC-4f92B: 15.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CXV_A_0HKA501_2 (MUSCARINIC ACETYLCHOLINE RECEPTOR M1,ENDOLYSIN,MUSCARI NIC ACETYLCHOLINE RECEPTOR M1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	3 / 3	THR B 583 THR B 565 PHE B 555	None	0.68A	5cxvA-4f92B: undetectable	5cxvA-4f92B: 14.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E26_D_PAUD601_0 (PANTOTHENATE KINASE 2, MITOCHONDRIAL)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	VAL B 917 ALA B 916 ARG B 406 GLY B 977	None	0.89A	5e26C-4f92B: undetectable 5e26D-4f92B: undetectable	5e26C-4f92B: 12.66 5e26D-4f92B: 12.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HBS_A_RTLA201_1 (RETINOL-BINDING PROTEIN 1)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	LEU B 897 LEU B 409 TYR B 936 GLN B 418	None	1.14A	5hbsA-4f92B: undetectable	5hbsA-4f92B: 6.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGZ_A_SPRA404_2 (MACROLIDE 2'-PHOSPHOTRANSFERAS E II)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 9	LEU B 876 HIS B 421 ILE B 870 GLU B 444 VAL B 445	None	1.45A	5igzA-4f92B: undetectable	5igzA-4f92B: 10.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LRB_A_ACRA1003_1 (ALPHA-1,4 GLUCAN PHOSPHORYLASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	GLU B 837 THR B1085 TYR B1083 TYR B 834	None	1.10A	5lrbA-4f92B: undetectable	5lrbA-4f92B: 20.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SYO_C_C5EC301_0 (SOLUBLE ACETYLCHOLINE RECEPTOR, NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT ALPHA-3 CHIMERA)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	TRP B1393 MET B1367 ILE B1364 TYR B1378 CYH B1376	None	1.11A	5syoB-4f92B: 4.0 5syoC-4f92B: 4.1	5syoB-4f92B: 8.40 5syoC-4f92B: 8.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5SYO_E_C5EE301_0 (SOLUBLE ACETYLCHOLINE RECEPTOR, NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT ALPHA-3 CHIMERA)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	TRP B1393 MET B1367 ILE B1364 TYR B1378 CYH B1376	None	1.08A	5syoD-4f92B: 4.0 5syoE-4f92B: 4.1	5syoD-4f92B: 8.40 5syoE-4f92B: 8.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5T7B_A_IPHA901_0 (PROTEIN ARGONAUTE-2)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	PHE B1514 PRO B1516 VAL B1518 ALA B1350	None	1.11A	5t7bA-4f92B: undetectable	5t7bA-4f92B: 19.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_A_PCFA1804_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	THR B 606 ASN B 638 TRP B 593 LEU B 569	None	1.37A	5vkqA-4f92B: 1.8 5vkqB-4f92B: 1.7	5vkqA-4f92B: 23.49 5vkqB-4f92B: 23.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_B_PCFB1801_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	THR B 606 ASN B 638 TRP B 593 LEU B 569	None	1.41A	5vkqB-4f92B: 1.7 5vkqC-4f92B: 1.8	5vkqB-4f92B: 23.49 5vkqC-4f92B: 23.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VKQ_C_PCFC1802_0 (NO MECHANORECEPTOR POTENTIAL C ISOFORM L)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	THR B 606 ASN B 638 TRP B 593 LEU B 569	None	1.39A	5vkqC-4f92B: 2.0 5vkqD-4f92B: 1.0	5vkqC-4f92B: 23.49 5vkqD-4f92B: 23.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VUN_A_MTLA805_0 (NITRIC OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.09A	5vunA-4f92B: undetectable	5vunA-4f92B: 13.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VUN_B_MTLB805_0 (NITRIC OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1375 ASN B1444 GLN B1446 ASN B1449	None	1.36A	5vunB-4f92B: undetectable	5vunB-4f92B: 13.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VUO_B_MTLB805_0 (NITRIC OXIDE SYNTHASE, BRAIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ASN B 912 GLN B 980 PHE B 979 ASP B 973	None	1.15A	5vuoB-4f92B: undetectable	5vuoB-4f92B: 13.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B52_A_OAQA302_0 (SULFOTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	PRO B1182 ILE B1204 LEU B1202 PHE B1239 LEU B1282	None	1.18A	6b52A-4f92B: undetectable	6b52A-4f92B: 10.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BSG_A_EFZA601_1 (REVERSE TRANSCRIPTASE P66 SUBUNIT)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	LEU B1597 VAL B1617 VAL B1632 GLY B1618 LEU B1590	None	1.42A	6bsgA-4f92B: undetectable	6bsgA-4f92B: 4.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BSI_A_EFZA601_1 (REVERSE TRANSCRIPTASE P66 SUBUNIT)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	LEU B1597 VAL B1617 VAL B1632 GLY B1618 LEU B1590	None	1.33A	6bsiA-4f92B: 1.2	6bsiA-4f92B: 4.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BSJ_A_EFZA601_1 (REVERSE TRANSCRIPTASE P66 SUBUNIT)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 10	LEU B1597 VAL B1617 VAL B1632 GLY B1618 LEU B1590	None	1.41A	6bsjA-4f92B: undetectable	6bsjA-4f92B: 4.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FBV_D_FI8D1904_1 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA')	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 8	ARG B1648 VAL B1617 ARG B 603 GLN B 607	None	1.23A	6fbvD-4f92B: undetectable	6fbvD-4f92B: 22.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GTQ_A_ACTA204_0 (N-ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 5	LEU B 876 THR B 871 THR B 693 GLY B 691	None	1.17A	6gtqA-4f92B: undetectable	6gtqA-4f92B: 7.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GTQ_B_ACTB207_0 (DUF1778 DOMAIN-CONTAINING PROTEIN N-ACETYLTRANSFERASE)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	LEU B 743 THR B 747 CYH B 742 GLY B 749	None	1.07A	6gtqB-4f92B: undetectable 6gtqD-4f92B: undetectable	6gtqB-4f92B: 7.63 6gtqD-4f92B: 3.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6J21_A_GBQA1201_0 (SUBSTANCE-P RECEPTOR,ENDOLYSIN)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	5 / 12	ASN B1692 PRO B1520 ILE B1331 VAL B1518 ILE B1358	None	1.41A	6j21A-4f92B: undetectable	6j21A-4f92B: 12.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6NMF_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	4f92	U5 SMALL NUCLEAR RIBONUCLEOPROTEIN 200 KDA HELICASE (Homo sapiens)	4 / 6	ILE B 828 LEU B 869 ARG B 855 THR B 505	None	1.05A	6nmfN-4f92B: undetectable 6nmfW-4f92B: undetectable	6nmfN-4f92B: 14.26 6nmfW-4f92B: 3.00