SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4fsf'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GHM_A_CEDA1_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	7 / 12	SER A 294 LYS A 297 SER A 349 ASN A 351 LYS A 484 SER A 485 GLY A 486	0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-2.9A) 0W0 A 601 (-3.4A)	0.50A	1ghmA-4fsfA: 16.3	1ghmA-4fsfA: 17.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I2W_A_CFXA1300_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	6 / 12	SER A 294 LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.48A	1i2wA-4fsfA: 16.6	1i2wA-4fsfA: 21.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MX1_F_THAF6_1 (LIVER CARBOXYLESTERASE I)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	GLY A 136 GLY A 134 VAL A 126 LEU A 82 LEU A 129	None	1.00A	1mx1F-4fsfA: undetectable	1mx1F-4fsfA: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YMX_A_CFXA1001_1 (BETA-LACTAMASE CTX-M-9)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	6 / 12	SER A 294 LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.39A	1ymxA-4fsfA: 17.5	1ymxA-4fsfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YMX_B_CFXB1002_1 (BETA-LACTAMASE CTX-M-9)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	6 / 12	SER A 294 LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.37A	1ymxB-4fsfA: 17.6	1ymxB-4fsfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CEO_A_T44A1395_1 (THYROXINE-BINDING GLOBULIN)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 11	LEU A 391 LEU A 375 SER A 294 LYS A 297 LEU A 411	None None 0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) None	1.00A	2ceoA-4fsfA: undetectable	2ceoA-4fsfA: 21.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DDW_B_PXLB1005_1 (PYRIDOXINE KINASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 7	SER A 538 LEU A 506 THR A 487 GLY A 531	None None 0W0 A 601 (-3.7A) None	0.90A	2ddwB-4fsfA: undetectable	2ddwB-4fsfA: 19.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F8D_A_BEZA1002_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 10	GLY A 548 LEU A 552 LEU A 550 LEU A 260 ILE A 251	None	0.88A	2f8dA-4fsfA: undetectable	2f8dA-4fsfA: 19.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F8D_B_BEZB1003_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 10	GLY A 548 LEU A 552 LEU A 550 LEU A 260 ILE A 251	None	0.88A	2f8dB-4fsfA: undetectable	2f8dB-4fsfA: 19.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2G70_A_SAMA2001_0 (PHENYLETHANOLAMINE N-METHYLTRANSFERASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LEU A 227 ASP A 253 VAL A 254 ALA A 508 PHE A 507	None	1.34A	2g70A-4fsfA: undetectable	2g70A-4fsfA: 19.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2G70_B_SAMB2002_0 (PHENYLETHANOLAMINE N-METHYLTRANSFERASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LEU A 227 ASP A 253 VAL A 254 ALA A 508 PHE A 507	None	1.40A	2g70B-4fsfA: undetectable	2g70B-4fsfA: 19.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q5K_A_AB1A201_1 (PROTEASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 9	ALA A 454 ASP A 428 VAL A 448 VAL A 369 ILE A 449	None	1.04A	2q5kA-4fsfA: undetectable	2q5kA-4fsfA: 12.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_B_KLNB1499_1 (CYTOCHROME P450 3A4)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 7	PHE A 507 SER A 302 ILE A 449 GLY A 509	None	0.69A	2v0mB-4fsfA: undetectable	2v0mB-4fsfA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_C_KLNC1499_1 (CYTOCHROME P450 3A4)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 7	PHE A 507 SER A 302 ILE A 449 GLY A 509	None	0.59A	2v0mC-4fsfA: undetectable	2v0mC-4fsfA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7K_A_SALA1303_1 (LYSR-TYPE REGULATORY PROTEIN)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 7	PRO A 298 SER A 300 ILE A 354 PRO A 292	None	0.78A	2y7kA-4fsfA: undetectable	2y7kA-4fsfA: 16.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HLW_A_CE3A301_1 (CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.49A	3hlwA-4fsfA: 17.4	3hlwA-4fsfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_B_SAMB6735_0 (16S RRNA METHYLASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	GLY A 247 ASN A 283 VAL A 522 ALA A 244 LEU A 239	None	1.16A	3p2kB-4fsfA: undetectable	3p2kB-4fsfA: 17.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PWW_A_ROCA1001_1 (ENDOTHIAPEPSIN)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	ASP A 428 GLY A 509 PHE A 299 ILE A 251 ILE A 518	None	1.08A	3pwwA-4fsfA: undetectable	3pwwA-4fsfA: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3Q07_A_WPPA300_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.51A	3q07A-4fsfA: 17.4	3q07A-4fsfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3Q07_B_WPPB400_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.39A	3q07B-4fsfA: 17.4	3q07B-4fsfA: 19.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S53_A_017A201_1 (PROTEASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 9	GLY A 382 ILE A 287 GLY A 177 ILE A 178 ILE A 416	None	0.99A	3s53A-4fsfA: undetectable	3s53A-4fsfA: 12.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SH8_B_CEDB1_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	6 / 12	SER A 294 LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486	0W0 A 601 (-1.4A) 0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A)	0.54A	3sh8B-4fsfA: 16.9	3sh8B-4fsfA: 19.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUF_C_SUEC1201_1 (NS3 PROTEASE, NS4A PROTEIN)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 11	TYR A 532 SER A 485 PHE A 507 ALA A 539 ALA A 474	None 0W0 A 601 (-2.9A) None None None	1.07A	3sufC-4fsfA: undetectable	3sufC-4fsfA: 16.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3C_A_017A201_2 (HIV-1 PROTEASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 10	VAL A 165 ILE A 65 PRO A 156 ALA A 157 VAL A 161	None	0.85A	3t3cB-4fsfA: undetectable	3t3cB-4fsfA: 11.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_A_SAMA401_0 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LEU A 405 GLY A 293 ALA A 508 PRO A 298 LEU A 461	None 0W0 A 601 ( 3.7A) None None None	1.07A	3tm4A-4fsfA: undetectable	3tm4A-4fsfA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_B_SAMB401_0 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	LEU A 405 GLY A 293 ALA A 508 PRO A 298 LEU A 461	None 0W0 A 601 ( 3.7A) None None None	1.04A	3tm4B-4fsfA: undetectable	3tm4B-4fsfA: 21.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WXO_A_NIZA804_1 (CATALASE-PEROXIDASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	3 / 3	ASN A 69 GLU A 71 ARG A 226	None	1.04A	3wxoA-4fsfA: undetectable	3wxoA-4fsfA: 22.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EUZ_A_MEMA401_1 (CARBAPENEM-HYDROLIZI NG BETA-LACTAMASE SFC-1)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	6 / 12	LYS A 297 SER A 349 ASN A 351 LYS A 484 GLY A 486 THR A 487	0W0 A 601 ( 4.2A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A) 0W0 A 601 (-3.7A)	0.59A	4euzA-4fsfA: 17.3	4euzA-4fsfA: 22.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G1B_D_ECND403_1 (FLAVOHEMOGLOBIN)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	ILE A 114 LEU A 89 VAL A 142 LEU A 125 ILE A 138	None	1.04A	4g1bD-4fsfA: undetectable	4g1bD-4fsfA: 21.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R3A_A_RBFA402_1 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	ALA A 306 ALA A 358 ILE A 361 ILE A 345 LEU A 342	None	1.05A	4r3aA-4fsfA: 3.1	4r3aA-4fsfA: 23.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R3A_B_RBFB402_2 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	ALA A 306 ALA A 358 ILE A 361 ILE A 345 LEU A 342	None	0.94A	4r3aB-4fsfA: 3.5	4r3aB-4fsfA: 23.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_A_AG2A506_1 (HOMOSPERMIDINE SYNTHASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 6	ARG A 62 ASP A 183 VAL A 170 ASP A 169	None	0.94A	4xqeA-4fsfA: undetectable	4xqeA-4fsfA: 24.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_B_AG2B505_1 (HOMOSPERMIDINE SYNTHASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 6	ARG A 62 ASP A 183 VAL A 170 ASP A 169	None	0.93A	4xqeB-4fsfA: undetectable	4xqeB-4fsfA: 24.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQG_A_AG2A505_1 (HOMOSPERMIDINE SYNTHASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 8	ARG A 62 ASP A 183 VAL A 170 ASP A 169	None	0.93A	4xqgA-4fsfA: undetectable	4xqgA-4fsfA: 23.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQG_B_AG2B505_1 (HOMOSPERMIDINE SYNTHASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 8	ARG A 62 ASP A 183 VAL A 170 ASP A 169	None	0.94A	4xqgB-4fsfA: undetectable	4xqgB-4fsfA: 23.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B8I_C_FK5C201_1 (SERINE/THREONINE-PRO TEIN PHOSPHATASE PEPTIDYL-PROLYL CIS-TRANS ISOMERASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 6	LEU A 235 SER A 538 PRO A 540 PHE A 542	None	1.17A	5b8iA-4fsfA: undetectable	5b8iA-4fsfA: 21.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	4 / 5	SER A 76 ARG A 175 GLY A 166 GLU A 176	None	1.10A	5btiA-4fsfA: undetectable 5btiB-4fsfA: undetectable	5btiA-4fsfA: 21.12 5btiB-4fsfA: 19.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HFJ_H_SAMH301_0 (ADENINE SPECIFIC DNA METHYLTRANSFERASE (DPNA))	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	ALA A 363 PRO A 392 GLY A 408 THR A 295 TYR A 409	None None None None 0W0 A 601 (-4.7A)	1.00A	5hfjH-4fsfA: undetectable	5hfjH-4fsfA: 16.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B68_D_9F2D400_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	SER A 294 SER A 349 LYS A 484 GLY A 486 THR A 487	0W0 A 601 (-1.4A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A) 0W0 A 601 (-3.7A)	0.38A	6b68D-4fsfA: 17.0	6b68D-4fsfA: 12.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B6A_D_9F2D301_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	SER A 294 SER A 349 LYS A 484 GLY A 486 THR A 487	0W0 A 601 (-1.4A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A) 0W0 A 601 (-3.7A)	0.36A	6b6aD-4fsfA: 16.3	6b6aD-4fsfA: 12.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B6F_A_9F2A301_1 (BETA-LACTAMASE)	4fsf	PENICILLIN-BINDING PROTEIN 3 (Pseudomonas aeruginosa)	5 / 12	SER A 294 SER A 349 LYS A 484 GLY A 486 THR A 487	0W0 A 601 (-1.4A) 0W0 A 601 (-3.1A) 0W0 A 601 (-3.0A) 0W0 A 601 (-3.4A) 0W0 A 601 (-3.7A)	0.58A	6b6fA-4fsfA: 17.1	6b6fA-4fsfA: 12.79

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1GHM_A_CEDA1_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",7,"SER A 294;LYS A 297;SER A 349;ASN A 351;LYS A 484;SER A 485;GLY A 486","0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-2.9A);0W0 A 601 (-3.4A)","0.50A","1ghmA-4fsfA:16.3","1ghmA-4fsfA:17.90"],["1I2W_A_CFXA1300_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",6,"SER A 294;LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.48A","1i2wA-4fsfA:16.6","1i2wA-4fsfA:21.00"],["1MX1_F_THAF6_1","LIVER CARBOXYLESTERASE I","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"GLY A 136;GLY A 134;VAL A 126;LEU A  82;LEU A 129","None","1.00A","1mx1F-4fsfA:undetectable","1mx1F-4fsfA:21.69"],["1YMX_A_CFXA1001_1","BETA-LACTAMASE CTX-M-9","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",6,"SER A 294;LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.39A","1ymxA-4fsfA:17.5","1ymxA-4fsfA:19.22"],["1YMX_B_CFXB1002_1","BETA-LACTAMASE CTX-M-9","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",6,"SER A 294;LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.37A","1ymxB-4fsfA:17.6","1ymxB-4fsfA:19.22"],["2CEO_A_T44A1395_1","THYROXINE-BINDING GLOBULIN","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LEU A 391;LEU A 375;SER A 294;LYS A 297;LEU A 411","None;None;0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);None","1.00A","2ceoA-4fsfA:undetectable","2ceoA-4fsfA:21.68"],["2DDW_B_PXLB1005_1","PYRIDOXINE KINASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"SER A 538;LEU A 506;THR A 487;GLY A 531","None;None;0W0 A 601 (-3.7A);None","0.90A","2ddwB-4fsfA:undetectable","2ddwB-4fsfA:19.40"],["2F8D_A_BEZA1002_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"GLY A 548;LEU A 552;LEU A 550;LEU A 260;ILE A 251","None","0.88A","2f8dA-4fsfA:undetectable","2f8dA-4fsfA:19.96"],["2F8D_B_BEZB1003_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"GLY A 548;LEU A 552;LEU A 550;LEU A 260;ILE A 251","None","0.88A","2f8dB-4fsfA:undetectable","2f8dB-4fsfA:19.96"],["2G70_A_SAMA2001_0","PHENYLETHANOLAMINE N-METHYLTRANSFERASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LEU A 227;ASP A 253;VAL A 254;ALA A 508;PHE A 507","None","1.34A","2g70A-4fsfA:undetectable","2g70A-4fsfA:19.20"],["2G70_B_SAMB2002_0","PHENYLETHANOLAMINE N-METHYLTRANSFERASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LEU A 227;ASP A 253;VAL A 254;ALA A 508;PHE A 507","None","1.40A","2g70B-4fsfA:undetectable","2g70B-4fsfA:19.20"],["2Q5K_A_AB1A201_1","PROTEASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ALA A 454;ASP A 428;VAL A 448;VAL A 369;ILE A 449","None","1.04A","2q5kA-4fsfA:undetectable","2q5kA-4fsfA:12.55"],["2V0M_B_KLNB1499_1","CYTOCHROME P450 3A4","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"PHE A 507;SER A 302;ILE A 449;GLY A 509","None","0.69A","2v0mB-4fsfA:undetectable","2v0mB-4fsfA:21.93"],["2V0M_C_KLNC1499_1","CYTOCHROME P450 3A4","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"PHE A 507;SER A 302;ILE A 449;GLY A 509","None","0.59A","2v0mC-4fsfA:undetectable","2v0mC-4fsfA:21.93"],["2Y7K_A_SALA1303_1","LYSR-TYPE REGULATORY PROTEIN","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"PRO A 298;SER A 300;ILE A 354;PRO A 292","None","0.78A","2y7kA-4fsfA:undetectable","2y7kA-4fsfA:16.01"],["3HLW_A_CE3A301_1","CTX-M-9 EXTENDED-SPECTRUM BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.49A","3hlwA-4fsfA:17.4","3hlwA-4fsfA:19.22"],["3P2K_B_SAMB6735_0","16S RRNA METHYLASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"GLY A 247;ASN A 283;VAL A 522;ALA A 244;LEU A 239","None","1.16A","3p2kB-4fsfA:undetectable","3p2kB-4fsfA:17.35"],["3PWW_A_ROCA1001_1","ENDOTHIAPEPSIN","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ASP A 428;GLY A 509;PHE A 299;ILE A 251;ILE A 518","None","1.08A","3pwwA-4fsfA:undetectable","3pwwA-4fsfA:20.63"],["3Q07_A_WPPA300_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.51A","3q07A-4fsfA:17.4","3q07A-4fsfA:19.22"],["3Q07_B_WPPB400_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.39A","3q07B-4fsfA:17.4","3q07B-4fsfA:19.22"],["3S53_A_017A201_1","PROTEASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"GLY A 382;ILE A 287;GLY A 177;ILE A 178;ILE A 416","None","0.99A","3s53A-4fsfA:undetectable","3s53A-4fsfA:12.85"],["3SH8_B_CEDB1_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",6,"SER A 294;LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486","0W0 A 601 (-1.4A);0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A)","0.54A","3sh8B-4fsfA:16.9","3sh8B-4fsfA:19.81"],["3SUF_C_SUEC1201_1","NS3 PROTEASE, NS4A PROTEIN","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"TYR A 532;SER A 485;PHE A 507;ALA A 539;ALA A 474","None;0W0 A 601 (-2.9A);None;None;None","1.07A","3sufC-4fsfA:undetectable","3sufC-4fsfA:16.79"],["3T3C_A_017A201_2","HIV-1 PROTEASE;HIV-1 PROTEASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"VAL A 165;ILE A  65;PRO A 156;ALA A 157;VAL A 161","None","0.85A","3t3cB-4fsfA:undetectable","3t3cB-4fsfA:11.54"],["3TM4_A_SAMA401_0","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LEU A 405;GLY A 293;ALA A 508;PRO A 298;LEU A 461","None;0W0 A 601 ( 3.7A);None;None;None","1.07A","3tm4A-4fsfA:undetectable","3tm4A-4fsfA:21.14"],["3TM4_B_SAMB401_0","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"LEU A 405;GLY A 293;ALA A 508;PRO A 298;LEU A 461","None;0W0 A 601 ( 3.7A);None;None;None","1.04A","3tm4B-4fsfA:undetectable","3tm4B-4fsfA:21.14"],["3WXO_A_NIZA804_1","CATALASE-PEROXIDASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",3,"ASN A  69;GLU A  71;ARG A 226","None","1.04A","3wxoA-4fsfA:undetectable","3wxoA-4fsfA:22.36"],["4EUZ_A_MEMA401_1","CARBAPENEM-HYDROLIZING BETA-LACTAMASE SFC-1","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",6,"LYS A 297;SER A 349;ASN A 351;LYS A 484;GLY A 486;THR A 487","0W0 A 601 ( 4.2A);0W0 A 601 (-3.1A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A);0W0 A 601 (-3.7A)","0.59A","4euzA-4fsfA:17.3","4euzA-4fsfA:22.06"],["4G1B_D_ECND403_1","FLAVOHEMOGLOBIN","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ILE A 114;LEU A  89;VAL A 142;LEU A 125;ILE A 138","None","1.04A","4g1bD-4fsfA:undetectable","4g1bD-4fsfA:21.47"],["4R3A_A_RBFA402_1","BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ALA A 306;ALA A 358;ILE A 361;ILE A 345;LEU A 342","None","1.05A","4r3aA-4fsfA:3.1","4r3aA-4fsfA:23.01"],["4R3A_B_RBFB402_2","BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ALA A 306;ALA A 358;ILE A 361;ILE A 345;LEU A 342","None","0.94A","4r3aB-4fsfA:3.5","4r3aB-4fsfA:23.01"],["4XQE_A_AG2A506_1","HOMOSPERMIDINE SYNTHASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"ARG A  62;ASP A 183;VAL A 170;ASP A 169","None","0.94A","4xqeA-4fsfA:undetectable","4xqeA-4fsfA:24.07"],["4XQE_B_AG2B505_1","HOMOSPERMIDINE SYNTHASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"ARG A  62;ASP A 183;VAL A 170;ASP A 169","None","0.93A","4xqeB-4fsfA:undetectable","4xqeB-4fsfA:24.07"],["4XQG_A_AG2A505_1","HOMOSPERMIDINE SYNTHASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"ARG A  62;ASP A 183;VAL A 170;ASP A 169","None","0.93A","4xqgA-4fsfA:undetectable","4xqgA-4fsfA:23.85"],["4XQG_B_AG2B505_1","HOMOSPERMIDINE SYNTHASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"ARG A  62;ASP A 183;VAL A 170;ASP A 169","None","0.94A","4xqgB-4fsfA:undetectable","4xqgB-4fsfA:23.85"],["5B8I_C_FK5C201_1","SERINE\/THREONINE-PROTEIN PHOSPHATASE;PEPTIDYL-PROLYL CIS-TRANS ISOMERASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"LEU A 235;SER A 538;PRO A 540;PHE A 542","None","1.17A","5b8iA-4fsfA:undetectable","5b8iA-4fsfA:21.42"],["5BTI_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",4,"SER A  76;ARG A 175;GLY A 166;GLU A 176","None","1.10A","5btiA-4fsfA:undetectable;5btiB-4fsfA:undetectable","5btiA-4fsfA:21.12;5btiB-4fsfA:19.39"],["5HFJ_H_SAMH301_0","ADENINE SPECIFIC DNA METHYLTRANSFERASE (DPNA)","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"ALA A 363;PRO A 392;GLY A 408;THR A 295;TYR A 409","None;None;None;None;0W0 A 601 (-4.7A)","1.00A","5hfjH-4fsfA:undetectable","5hfjH-4fsfA:16.92"],["6B68_D_9F2D400_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"SER A 294;SER A 349;LYS A 484;GLY A 486;THR A 487","0W0 A 601 (-1.4A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A);0W0 A 601 (-3.7A)","0.38A","6b68D-4fsfA:17.0","6b68D-4fsfA:12.79"],["6B6A_D_9F2D301_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"SER A 294;SER A 349;LYS A 484;GLY A 486;THR A 487","0W0 A 601 (-1.4A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A);0W0 A 601 (-3.7A)","0.36A","6b6aD-4fsfA:16.3","6b6aD-4fsfA:12.79"],["6B6F_A_9F2A301_1","BETA-LACTAMASE","4fsf","PENICILLIN-BINDING PROTEIN 3","Pseudomonas aeruginosa",5,"SER A 294;SER A 349;LYS A 484;GLY A 486;THR A 487","0W0 A 601 (-1.4A);0W0 A 601 (-3.1A);0W0 A 601 (-3.0A);0W0 A 601 (-3.4A);0W0 A 601 (-3.7A)","0.58A","6b6fA-4fsfA:17.1","6b6fA-4fsfA:12.79"]]