SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4kzk'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MX1_F_THAF6_1 (LIVER CARBOXYLESTERASE I)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	GLY A 103 GLY A 101 VAL A 133 LEU A 130 LEU A 122	None	1.09A	1mx1F-4kzkA: 3.1	1mx1F-4kzkA: 20.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QKN_A_RALA600_1 (ESTROGEN RECEPTOR BETA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	THR A 209 ALA A 212 LEU A 170 ILE A 261 GLY A 260	None	0.93A	1qknA-4kzkA: undetectable	1qknA-4kzkA: 20.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XL6_B_SPMB3001_1 (INWARD RECTIFIER POTASSIUM CHANNEL)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 5	ALA A 171 TYR A 172 ALA A 215 GLN A 41	None	1.14A	1xl6A-4kzkA: undetectable 1xl6B-4kzkA: undetectable	1xl6A-4kzkA: 21.93 1xl6B-4kzkA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F78_B_BEZB1004_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 7	VAL A 199 ARG A 169 LEU A 189 THR A 182	None	1.17A	2f78B-4kzkA: 2.0	2f78B-4kzkA: 21.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VCV_B_ASDB1224_1 (GLUTATHIONE S-TRANSFERASE A3)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	PHE A 220 ALA A 231 LEU A 170 ALA A 216	None	0.89A	2vcvB-4kzkA: undetectable	2vcvB-4kzkA: 21.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YJA_B_ESTB1550_1 (ESTROGEN RECEPTOR)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	ALA A 54 GLU A 55 LEU A 65 ILE A 302 GLY A 90	None	1.19A	2yjaB-4kzkA: undetectable	2yjaB-4kzkA: 18.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3E00_A_9CRA7223_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	ALA A 202 ALA A 171 ALA A 215 VAL A 147 ILE A 261	None	1.00A	3e00A-4kzkA: undetectable	3e00A-4kzkA: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EIG_A_MTXA200_2 (DIHYDROFOLATE REDUCTASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 5	ASP A 132 ILE A 104 VAL A 91 THR A 294	None	1.20A	3eigA-4kzkA: 1.6	3eigA-4kzkA: 18.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MBG_C_ACTC800_0 (FAD-LINKED SULFHYDRYL OXIDASE ALR)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	3 / 3	ASP A 124 ARG A 126 ALA A 128	None	0.78A	3mbgC-4kzkA: undetectable	3mbgC-4kzkA: 17.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MTE_B_SAMB220_0 (16S RRNA METHYLASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	GLY A 148 GLY A 144 ALA A 191 ALA A 192 LEU A 189	None	1.05A	3mteB-4kzkA: 2.5	3mteB-4kzkA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_A_SAMA6735_0 (16S RRNA METHYLASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	GLY A 148 GLY A 144 ALA A 191 ALA A 192 LEU A 189	None	1.01A	3p2kA-4kzkA: 2.5	3p2kA-4kzkA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_D_SAMD6735_0 (16S RRNA METHYLASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	GLY A 148 GLY A 144 ALA A 191 ALA A 192 LEU A 189	None	1.01A	3p2kD-4kzkA: undetectable	3p2kD-4kzkA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TQ8_A_TOPA2001_1 (DIHYDROFOLATE REDUCTASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 9	ILE A 143 LEU A 331 ILE A 319 ILE A 283 THR A 314	None	1.24A	3tq8A-4kzkA: undetectable	3tq8A-4kzkA: 18.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D39_B_ACTB860_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	GLY A 144 ILE A 143 GLN A 146 VAL A 259	None	1.13A	4d39B-4kzkA: undetectable	4d39B-4kzkA: 22.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LG1_A_SAMA301_0 (PROTEIN-LYSINE METHYLTRANSFERASE METTL21D)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	TRP A 51 ALA A 54 GLY A 36 LEU A 80 LEU A 83	None	0.95A	4lg1A-4kzkA: undetectable	4lg1A-4kzkA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LG1_B_SAMB301_0 (PROTEIN-LYSINE METHYLTRANSFERASE METTL21D)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	TRP A 51 ALA A 54 GLY A 36 LEU A 80 LEU A 83	None	0.96A	4lg1B-4kzkA: undetectable	4lg1B-4kzkA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LG1_C_SAMC301_0 (PROTEIN-LYSINE METHYLTRANSFERASE METTL21D)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	TRP A 51 ALA A 54 GLY A 36 LEU A 80 LEU A 83	None	0.94A	4lg1C-4kzkA: undetectable	4lg1C-4kzkA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PXM_B_ESTB2000_1 (ESTROGEN RECEPTOR)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 11	ALA A 54 GLU A 55 LEU A 65 ILE A 302 GLY A 90	None	1.22A	4pxmB-4kzkA: undetectable	4pxmB-4kzkA: 18.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XI3_B_29SB601_1 (ESTROGEN RECEPTOR)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	THR A 209 ALA A 212 LEU A 170 ILE A 261 GLY A 260	None	0.93A	4xi3B-4kzkA: undetectable	4xi3B-4kzkA: 18.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 7	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.88A	5bs8A-4kzkA: undetectable 5bs8B-4kzkA: 4.1 5bs8C-4kzkA: undetectable	5bs8A-4kzkA: 20.23 5bs8B-4kzkA: 22.65 5bs8C-4kzkA: 20.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 7	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.92A	5btaA-4kzkA: undetectable 5btaC-4kzkA: undetectable 5btaD-4kzkA: 3.1	5btaA-4kzkA: 19.85 5btaC-4kzkA: 19.85 5btaD-4kzkA: 22.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.89A	5btaA-4kzkA: undetectable 5btaB-4kzkA: 3.6 5btaC-4kzkA: undetectable	5btaA-4kzkA: 19.85 5btaB-4kzkA: 22.65 5btaC-4kzkA: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.95A	5btcA-4kzkA: undetectable 5btcC-4kzkA: undetectable 5btcD-4kzkA: 3.5	5btcA-4kzkA: 19.85 5btcC-4kzkA: 19.85 5btcD-4kzkA: 22.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.90A	5btcA-4kzkA: undetectable 5btcB-4kzkA: 3.5 5btcC-4kzkA: undetectable	5btcA-4kzkA: 19.85 5btcB-4kzkA: 22.65 5btcC-4kzkA: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 7	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.89A	5btdA-4kzkA: undetectable 5btdB-4kzkA: 4.0 5btdC-4kzkA: undetectable	5btdA-4kzkA: 20.23 5btdB-4kzkA: 22.65 5btdC-4kzkA: 20.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 7	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.92A	5btfA-4kzkA: undetectable 5btfB-4kzkA: 4.1 5btfC-4kzkA: undetectable	5btfA-4kzkA: 19.85 5btfB-4kzkA: 22.65 5btfC-4kzkA: 19.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	ALA A 202 ARG A 244 GLY A 246 GLU A 247	None	0.85A	5btgA-4kzkA: undetectable 5btgB-4kzkA: 4.0 5btgC-4kzkA: undetectable	5btgA-4kzkA: 20.23 5btgB-4kzkA: 22.65 5btgC-4kzkA: 20.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	4 / 6	ARG A 244 GLY A 246 THR A 277 GLU A 247	None	0.88A	5btgA-4kzkA: undetectable 5btgB-4kzkA: 4.0 5btgC-4kzkA: undetectable	5btgA-4kzkA: 20.23 5btgB-4kzkA: 22.65 5btgC-4kzkA: 20.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DQF_A_LCRA612_1 (SERUM ALBUMIN)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 9	LEU A 130 LEU A 100 GLY A 101 LEU A 122 ALA A 95	None	0.98A	5dqfA-4kzkA: undetectable	5dqfA-4kzkA: 19.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DXB_B_ESTB601_1 (ESTROGEN RECEPTOR)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 11	ALA A 54 GLU A 55 LEU A 65 ILE A 302 GLY A 90	None	1.21A	5dxbB-4kzkA: undetectable	5dxbB-4kzkA: 18.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E8Q_A_FOLA201_1 (DIHYDROFOLATE REDUCTASE)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	3 / 3	ASP A 44 LEU A 333 ARG A 328	GAL A 600 (-3.2A) None None	0.89A	5e8qA-4kzkA: undetectable	5e8qA-4kzkA: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TZO_A_7V7A202_1 (ENDO-1,4-BETA-XYLANA SE A)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	PHE A 279 VAL A 243 ALA A 216 ALA A 242 GLY A 241	None	1.27A	5tzoA-4kzkA: undetectable	5tzoA-4kzkA: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TZO_C_7V7C201_1 (ENDO-1,4-BETA-XYLANA SE A)	4kzk	L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN (Burkholderia thailandensis)	5 / 12	PHE A 279 VAL A 243 ALA A 216 ALA A 242 GLY A 241	None	1.25A	5tzoC-4kzkA: undetectable	5tzoC-4kzkA: 21.05

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1MX1_F_THAF6_1","LIVER CARBOXYLESTERASE I","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"GLY A 103;GLY A 101;VAL A 133;LEU A 130;LEU A 122","None","1.09A","1mx1F-4kzkA:3.1","1mx1F-4kzkA:20.72"],["1QKN_A_RALA600_1","ESTROGEN RECEPTOR BETA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"THR A 209;ALA A 212;LEU A 170;ILE A 261;GLY A 260","None","0.93A","1qknA-4kzkA:undetectable","1qknA-4kzkA:20.52"],["1XL6_B_SPMB3001_1","INWARD RECTIFIER POTASSIUM CHANNEL;INWARD RECTIFIER POTASSIUM CHANNEL","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ALA A 171;TYR A 172;ALA A 215;GLN A  41","None","1.14A","1xl6A-4kzkA:undetectable;1xl6B-4kzkA:undetectable","1xl6A-4kzkA:21.93;1xl6B-4kzkA:21.93"],["2F78_B_BEZB1004_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"VAL A 199;ARG A 169;LEU A 189;THR A 182","None","1.17A","2f78B-4kzkA:2.0","2f78B-4kzkA:21.08"],["2VCV_B_ASDB1224_1","GLUTATHIONE S-TRANSFERASE A3","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"PHE A 220;ALA A 231;LEU A 170;ALA A 216","None","0.89A","2vcvB-4kzkA:undetectable","2vcvB-4kzkA:21.28"],["2YJA_B_ESTB1550_1","ESTROGEN RECEPTOR","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"ALA A  54;GLU A  55;LEU A  65;ILE A 302;GLY A  90","None","1.19A","2yjaB-4kzkA:undetectable","2yjaB-4kzkA:18.79"],["3E00_A_9CRA7223_1","RETINOIC ACID RECEPTOR RXR-ALPHA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"ALA A 202;ALA A 171;ALA A 215;VAL A 147;ILE A 261","None","1.00A","3e00A-4kzkA:undetectable","3e00A-4kzkA:21.69"],["3EIG_A_MTXA200_2","DIHYDROFOLATE REDUCTASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ASP A 132;ILE A 104;VAL A  91;THR A 294","None","1.20A","3eigA-4kzkA:1.6","3eigA-4kzkA:18.37"],["3MBG_C_ACTC800_0","FAD-LINKED SULFHYDRYL OXIDASE ALR","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",3,"ASP A 124;ARG A 126;ALA A 128","None","0.78A","3mbgC-4kzkA:undetectable","3mbgC-4kzkA:17.43"],["3MTE_B_SAMB220_0","16S RRNA METHYLASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"GLY A 148;GLY A 144;ALA A 191;ALA A 192;LEU A 189","None","1.05A","3mteB-4kzkA:2.5","3mteB-4kzkA:20.96"],["3P2K_A_SAMA6735_0","16S RRNA METHYLASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"GLY A 148;GLY A 144;ALA A 191;ALA A 192;LEU A 189","None","1.01A","3p2kA-4kzkA:2.5","3p2kA-4kzkA:20.28"],["3P2K_D_SAMD6735_0","16S RRNA METHYLASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"GLY A 148;GLY A 144;ALA A 191;ALA A 192;LEU A 189","None","1.01A","3p2kD-4kzkA:undetectable","3p2kD-4kzkA:20.28"],["3TQ8_A_TOPA2001_1","DIHYDROFOLATE REDUCTASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"ILE A 143;LEU A 331;ILE A 319;ILE A 283;THR A 314","None","1.24A","3tq8A-4kzkA:undetectable","3tq8A-4kzkA:18.62"],["4D39_B_ACTB860_0","NITRIC OXIDE SYNTHASE, ENDOTHELIAL","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"GLY A 144;ILE A 143;GLN A 146;VAL A 259","None","1.13A","4d39B-4kzkA:undetectable","4d39B-4kzkA:22.20"],["4LG1_A_SAMA301_0","PROTEIN-LYSINE METHYLTRANSFERASE METTL21D","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"TRP A  51;ALA A  54;GLY A  36;LEU A  80;LEU A  83","None","0.95A","4lg1A-4kzkA:undetectable","4lg1A-4kzkA:20.28"],["4LG1_B_SAMB301_0","PROTEIN-LYSINE METHYLTRANSFERASE METTL21D","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"TRP A  51;ALA A  54;GLY A  36;LEU A  80;LEU A  83","None","0.96A","4lg1B-4kzkA:undetectable","4lg1B-4kzkA:20.28"],["4LG1_C_SAMC301_0","PROTEIN-LYSINE METHYLTRANSFERASE METTL21D","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"TRP A  51;ALA A  54;GLY A  36;LEU A  80;LEU A  83","None","0.94A","4lg1C-4kzkA:undetectable","4lg1C-4kzkA:20.28"],["4PXM_B_ESTB2000_1","ESTROGEN RECEPTOR","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"ALA A  54;GLU A  55;LEU A  65;ILE A 302;GLY A  90","None","1.22A","4pxmB-4kzkA:undetectable","4pxmB-4kzkA:18.60"],["4XI3_B_29SB601_1","ESTROGEN RECEPTOR","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"THR A 209;ALA A 212;LEU A 170;ILE A 261;GLY A 260","None","0.93A","4xi3B-4kzkA:undetectable","4xi3B-4kzkA:18.71"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.88A","5bs8A-4kzkA:undetectable;5bs8B-4kzkA:4.1;5bs8C-4kzkA:undetectable","5bs8A-4kzkA:20.23;5bs8B-4kzkA:22.65;5bs8C-4kzkA:20.23"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.92A","5btaA-4kzkA:undetectable;5btaC-4kzkA:undetectable;5btaD-4kzkA:3.1","5btaA-4kzkA:19.85;5btaC-4kzkA:19.85;5btaD-4kzkA:22.65"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.89A","5btaA-4kzkA:undetectable;5btaB-4kzkA:3.6;5btaC-4kzkA:undetectable","5btaA-4kzkA:19.85;5btaB-4kzkA:22.65;5btaC-4kzkA:19.85"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.95A","5btcA-4kzkA:undetectable;5btcC-4kzkA:undetectable;5btcD-4kzkA:3.5","5btcA-4kzkA:19.85;5btcC-4kzkA:19.85;5btcD-4kzkA:22.65"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.90A","5btcA-4kzkA:undetectable;5btcB-4kzkA:3.5;5btcC-4kzkA:undetectable","5btcA-4kzkA:19.85;5btcB-4kzkA:22.65;5btcC-4kzkA:19.85"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.89A","5btdA-4kzkA:undetectable;5btdB-4kzkA:4.0;5btdC-4kzkA:undetectable","5btdA-4kzkA:20.23;5btdB-4kzkA:22.65;5btdC-4kzkA:20.23"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.92A","5btfA-4kzkA:undetectable;5btfB-4kzkA:4.1;5btfC-4kzkA:undetectable","5btfA-4kzkA:19.85;5btfB-4kzkA:22.65;5btfC-4kzkA:19.85"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ALA A 202;ARG A 244;GLY A 246;GLU A 247","None","0.85A","5btgA-4kzkA:undetectable;5btgB-4kzkA:4.0;5btgC-4kzkA:undetectable","5btgA-4kzkA:20.23;5btgB-4kzkA:22.65;5btgC-4kzkA:20.23"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",4,"ARG A 244;GLY A 246;THR A 277;GLU A 247","None","0.88A","5btgA-4kzkA:undetectable;5btgB-4kzkA:4.0;5btgC-4kzkA:undetectable","5btgA-4kzkA:20.23;5btgB-4kzkA:22.65;5btgC-4kzkA:20.23"],["5DQF_A_LCRA612_1","SERUM ALBUMIN","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"LEU A 130;LEU A 100;GLY A 101;LEU A 122;ALA A  95","None","0.98A","5dqfA-4kzkA:undetectable","5dqfA-4kzkA:19.12"],["5DXB_B_ESTB601_1","ESTROGEN RECEPTOR","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"ALA A  54;GLU A  55;LEU A  65;ILE A 302;GLY A  90","None","1.21A","5dxbB-4kzkA:undetectable","5dxbB-4kzkA:18.53"],["5E8Q_A_FOLA201_1","DIHYDROFOLATE REDUCTASE","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",3,"ASP A  44;LEU A 333;ARG A 328","GAL A 600 (-3.2A);None;None","0.89A","5e8qA-4kzkA:undetectable","5e8qA-4kzkA:20.00"],["5TZO_A_7V7A202_1","ENDO-1,4-BETA-XYLANASE A","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"PHE A 279;VAL A 243;ALA A 216;ALA A 242;GLY A 241","None","1.27A","5tzoA-4kzkA:undetectable","5tzoA-4kzkA:21.05"],["5TZO_C_7V7C201_1","ENDO-1,4-BETA-XYLANASE A","4kzk","L-ARABINOSE ABC TRANSPORTER, PERIPLASMIC L-ARABINOSE-BINDING PROTEIN","Burkholderia thailandensis",5,"PHE A 279;VAL A 243;ALA A 216;ALA A 242;GLY A 241","None","1.25A","5tzoC-4kzkA:undetectable","5tzoC-4kzkA:21.05"]]