SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4p98'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JLF_A_NVPA999_1 (HIV-1 RT A-CHAIN HIV-1 RT B-CHAIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 8	LEU A 263 TYR A 138 GLY A 135 TYR A 267	None	0.96A	1jlfA-4p98A: undetectable 1jlfB-4p98A: undetectable	1jlfA-4p98A: 20.49 1jlfB-4p98A: 19.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LWE_A_NVPA999_1 (HIV-1 REVERSE TRANSCRIPTASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	LEU A 263 TYR A 138 GLY A 135 TYR A 267	None	1.00A	1lweA-4p98A: undetectable	1lweA-4p98A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QAB_F_RTLF2_0 (PROTEIN (RETINOL BINDING PROTEIN))	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	ALA A 185 LEU A 261 GLY A 181 LEU A 143 GLN A 142	None MLY A 260 ( 4.1A) None None BR A 405 (-3.5A)	1.06A	1qabF-4p98A: undetectable	1qabF-4p98A: 20.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UDU_B_CIAB2003_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	ALA A 79 ILE A 39 VAL A 108 ALA A 109 PHE A 112	None	1.07A	1uduB-4p98A: undetectable	1uduB-4p98A: 22.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F78_A_BEZA1003_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	VAL A 95 SER A 118 LEU A 60 THR A 266	None	1.05A	2f78A-4p98A: 2.9	2f78A-4p98A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F78_B_BEZB1004_0 (HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	VAL A 95 SER A 118 LEU A 60 THR A 266	None	1.05A	2f78B-4p98A: undetectable	2f78B-4p98A: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJ8_C_SPMC500_1 (DIAMINE ACETYLTRANSFERASE 1)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 6	ASP A 66 LEU A 60 ASP A 92 HIS A 116	None None MLZ A 35 ( 3.8A) BR A 411 (-4.3A)	1.15A	3bj8C-4p98A: undetectable 3bj8D-4p98A: undetectable	3bj8C-4p98A: 19.63 3bj8D-4p98A: 19.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_C_SAMC300_1 (PUTATIVE RRNA METHYLASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	3 / 3	ASN A 290 ASP A 314 GLN A 310	None	0.83A	3eeyC-4p98A: undetectable	3eeyC-4p98A: 21.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_E_SAME300_1 (PUTATIVE RRNA METHYLASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	3 / 3	ASN A 290 ASP A 314 GLN A 310	None	0.82A	3eeyE-4p98A: undetectable	3eeyE-4p98A: 21.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKT_B_017B200_2 (PROTEASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	ALA A 189 VAL A 157 GLY A 148 ILE A 178 ALA A 217	None	1.07A	3ektB-4p98A: undetectable	3ektB-4p98A: 13.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ELZ_B_CHDB200_0 (ILEAL BILE ACID-BINDING PROTEIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 5	PRO A 166 VAL A 171 THR A 240 GLY A 242	None	1.02A	3elzB-4p98A: undetectable	3elzB-4p98A: 20.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G8I_A_RO7A1_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR ALPHA)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	LEU A 229 LEU A 309 LEU A 219 LEU A 288	None	0.96A	3g8iA-4p98A: undetectable	3g8iA-4p98A: 23.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KK6_B_CELB1701_1 (PROSTAGLANDIN G/H SYNTHASE 1)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	GLN A 273 VAL A 133 LEU A 129 SER A 269 GLY A 96	None	1.18A	3kk6B-4p98A: undetectable	3kk6B-4p98A: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N3I_A_ROCA201_1 (PROTEASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	GLY A 228 ASP A 225 ASP A 224 ARG A 227 ALA A 233	None	1.20A	3n3iA-4p98A: undetectable	3n3iA-4p98A: 23.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OGP_A_017A200_1 (FIV PROTEASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	GLY A 64 ALA A 65 ASP A 66 ILE A 274 LEU A 60	None	0.97A	3ogpA-4p98A: undetectable	3ogpA-4p98A: 15.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUD_A_SUEA1201_1 (NS3 PROTEASE, NS4A PROTEIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	GLY A 161 GLY A 211 ALA A 209 ALA A 233 ALA A 235	None None None None BR A 419 ( 4.5A)	1.06A	3sudA-4p98A: undetectable	3sudA-4p98A: 21.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9L_A_CAMA1419_0 (CYTOCHROME P450)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	6 / 12	ILE A 178 THR A 240 LEU A 229 GLY A 226 ASP A 147 ILE A 241	None	0.88A	4c9lA-4p98A: undetectable	4c9lA-4p98A: 22.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9L_B_CAMB1419_0 (CYTOCHROME P450)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	6 / 12	ILE A 178 THR A 240 LEU A 229 GLY A 226 ASP A 147 ILE A 241	None	0.93A	4c9lB-4p98A: undetectable	4c9lB-4p98A: 22.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9O_A_CAMA423_0 (CYTOCHROME P450)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	6 / 12	ILE A 178 THR A 240 LEU A 229 GLY A 226 ASP A 147 ILE A 241	None	0.84A	4c9oA-4p98A: undetectable	4c9oA-4p98A: 22.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9O_B_CAMB423_0 (CYTOCHROME P450)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	6 / 12	ILE A 178 THR A 240 LEU A 229 GLY A 226 ASP A 147 ILE A 241	None	0.84A	4c9oB-4p98A: undetectable	4c9oB-4p98A: 22.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4F8Y_B_VK3B202_1 (NADPH QUINONE OXIDOREDUCTASE)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 6	TRP A 136 ASN A 50 TYR A 138 LEU A 261	None BR A 418 (-3.6A) None MLY A 260 ( 4.1A)	1.46A	4f8yA-4p98A: 5.8 4f8yB-4p98A: 5.5	4f8yA-4p98A: 18.24 4f8yB-4p98A: 18.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L9Q_B_9TPB601_1 (SERUM ALBUMIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 12	ALA A 51 ILE A 241 LEU A 143 LEU A 146 GLY A 148	BR A 412 ( 4.0A) None None None None	1.00A	4l9qB-4p98A: undetectable	4l9qB-4p98A: 19.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LRH_F_FOLF301_1 (FOLATE RECEPTOR ALPHA)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	3 / 3	ASP A 46 TRP A 136 SER A 41	None None BR A 418 ( 2.9A)	1.07A	4lrhF-4p98A: undetectable	4lrhF-4p98A: 21.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVL_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 11	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qvlK-4p98A: undetectable 4qvlL-4p98A: undetectable	4qvlK-4p98A: 21.86 4qvlL-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVL_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 11	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qvlY-4p98A: undetectable 4qvlZ-4p98A: undetectable	4qvlY-4p98A: 21.86 4qvlZ-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qvmK-4p98A: undetectable 4qvmL-4p98A: undetectable	4qvmK-4p98A: 21.86 4qvmL-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qvmY-4p98A: undetectable 4qvmZ-4p98A: undetectable	4qvmY-4p98A: 21.86 4qvmZ-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVP_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.99A	4qvpK-4p98A: undetectable 4qvpL-4p98A: undetectable	4qvpK-4p98A: 21.86 4qvpL-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVP_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.99A	4qvpY-4p98A: undetectable 4qvpZ-4p98A: undetectable	4qvpY-4p98A: 21.86 4qvpZ-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW1_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 11	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.99A	4qw1K-4p98A: undetectable 4qw1L-4p98A: undetectable	4qw1K-4p98A: 20.91 4qw1L-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW1_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	1.00A	4qw1Y-4p98A: undetectable 4qw1Z-4p98A: undetectable	4qw1Y-4p98A: 20.91 4qw1Z-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qw3K-4p98A: undetectable 4qw3L-4p98A: undetectable	4qw3K-4p98A: 21.86 4qw3L-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	4qw3Y-4p98A: undetectable 4qw3Z-4p98A: undetectable	4qw3Y-4p98A: 21.86 4qw3Z-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RN6_A_15UA301_1 (THROMBIN HEAVY CHAIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	LEU A 295 LEU A 219 ALA A 162 ALA A 151 GLY A 242	None	1.38A	4rn6A-4p98A: undetectable	4rn6A-4p98A: 21.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	ALA A 56 ASP A 284 ARG A 282 THR A 278	None	0.99A	5bs8A-4p98A: undetectable 5bs8B-4p98A: undetectable 5bs8C-4p98A: undetectable	5bs8A-4p98A: 22.29 5bs8B-4p98A: 24.09 5bs8C-4p98A: 22.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	ALA A 56 ASP A 284 ARG A 282 THR A 278	None	0.98A	5btdA-4p98A: undetectable 5btdB-4p98A: undetectable 5btdC-4p98A: undetectable	5btdA-4p98A: 22.29 5btdB-4p98A: 24.09 5btdC-4p98A: 22.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 7	ALA A 56 ASP A 284 ARG A 282 THR A 278	None	0.98A	5btdA-4p98A: undetectable 5btdC-4p98A: undetectable 5btdD-4p98A: undetectable	5btdA-4p98A: 22.29 5btdC-4p98A: 22.29 5btdD-4p98A: 24.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BXN_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 11	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	5bxnK-4p98A: undetectable 5bxnL-4p98A: undetectable	5bxnK-4p98A: 21.86 5bxnL-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BXN_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 11	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.98A	5bxnY-4p98A: undetectable 5bxnZ-4p98A: undetectable	5bxnY-4p98A: 21.86 5bxnZ-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.99A	5d0xK-4p98A: undetectable 5d0xL-4p98A: undetectable	5d0xK-4p98A: 20.65 5d0xL-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	THR A 174 ALA A 173 GLY A 148 GLY A 181 ALA A 180	None BR A 406 ( 4.7A) None None BR A 421 (-4.1A)	0.99A	5d0xY-4p98A: undetectable 5d0xZ-4p98A: undetectable	5d0xY-4p98A: 20.65 5d0xZ-4p98A: 22.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_B_REAB602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	ILE A 38 THR A 266 TRP A 136 ASN A 50 LEU A 286	None None None BR A 418 (-3.6A) None	1.06A	5fhzB-4p98A: 3.8	5fhzB-4p98A: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_B_REAB602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 9	THR A 266 TRP A 136 GLN A 43 ASN A 50 LEU A 286	None None None BR A 418 (-3.6A) None	1.16A	5fhzB-4p98A: 3.8	5fhzB-4p98A: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_C_REAC602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	ILE A 38 THR A 266 TRP A 136 ASN A 50 LEU A 286	None None None BR A 418 (-3.6A) None	1.09A	5fhzC-4p98A: 3.0	5fhzC-4p98A: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_C_REAC602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	5 / 10	THR A 266 TRP A 136 GLN A 43 ASN A 50 LEU A 286	None None None BR A 418 (-3.6A) None	1.33A	5fhzC-4p98A: 3.0	5fhzC-4p98A: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_A_ACTA803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 4	GLU A 103 PRO A 104 ILE A 105 LEU A 106	None	1.23A	5m45A-4p98A: undetectable	5m45A-4p98A: 17.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_D_ACTD803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 4	GLU A 103 PRO A 104 ILE A 105 LEU A 106	None	1.27A	5m45D-4p98A: undetectable	5m45D-4p98A: 17.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_G_ACTG803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 4	GLU A 103 PRO A 104 ILE A 105 LEU A 106	None	1.26A	5m45G-4p98A: undetectable	5m45G-4p98A: 17.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_J_ACTJ803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	4 / 4	GLU A 103 PRO A 104 ILE A 105 LEU A 106	None	1.29A	5m45J-4p98A: undetectable	5m45J-4p98A: 17.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MUG_A_VIVA301_1 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	4p98	EXTRACELLULAR SOLUTE-BINDING PROTEIN (Conexibacter woesei)	3 / 3	SER A 120 SER A 118 PHE A 49	BR A 402 (-3.3A) None None	0.72A	5mugA-4p98A: undetectable	5mugA-4p98A: 20.38

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1JLF_A_NVPA999_1","HIV-1 RT A-CHAIN;HIV-1 RT B-CHAIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"LEU A 263;TYR A 138;GLY A 135;TYR A 267","None","0.96A","1jlfA-4p98A:undetectable;1jlfB-4p98A:undetectable","1jlfA-4p98A:20.49;1jlfB-4p98A:19.08"],["1LWE_A_NVPA999_1","HIV-1 REVERSE TRANSCRIPTASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"LEU A 263;TYR A 138;GLY A 135;TYR A 267","None","1.00A","1lweA-4p98A:undetectable","1lweA-4p98A:20.49"],["1QAB_F_RTLF2_0","PROTEIN (RETINOL BINDING PROTEIN)","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ALA A 185;LEU A 261;GLY A 181;LEU A 143;GLN A 142","None;MLY A 260 ( 4.1A);None;None; BR A 405 (-3.5A)","1.06A","1qabF-4p98A:undetectable","1qabF-4p98A:20.75"],["1UDU_B_CIAB2003_1","CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ALA A  79;ILE A  39;VAL A 108;ALA A 109;PHE A 112","None","1.07A","1uduB-4p98A:undetectable","1uduB-4p98A:22.93"],["2F78_A_BEZA1003_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"VAL A  95;SER A 118;LEU A  60;THR A 266","None","1.05A","2f78A-4p98A:2.9","2f78A-4p98A:20.49"],["2F78_B_BEZB1004_0","HTH-TYPE TRANSCRIPTIONAL REGULATOR BENM","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"VAL A  95;SER A 118;LEU A  60;THR A 266","None","1.05A","2f78B-4p98A:undetectable","2f78B-4p98A:20.49"],["3BJ8_C_SPMC500_1","DIAMINE ACETYLTRANSFERASE 1;DIAMINE ACETYLTRANSFERASE 1","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"ASP A  66;LEU A  60;ASP A  92;HIS A 116","None;None;MLZ A  35 ( 3.8A); BR A 411 (-4.3A)","1.15A","3bj8C-4p98A:undetectable;3bj8D-4p98A:undetectable","3bj8C-4p98A:19.63;3bj8D-4p98A:19.63"],["3EEY_C_SAMC300_1","PUTATIVE RRNA METHYLASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",3,"ASN A 290;ASP A 314;GLN A 310","None","0.83A","3eeyC-4p98A:undetectable","3eeyC-4p98A:21.00"],["3EEY_E_SAME300_1","PUTATIVE RRNA METHYLASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",3,"ASN A 290;ASP A 314;GLN A 310","None","0.82A","3eeyE-4p98A:undetectable","3eeyE-4p98A:21.00"],["3EKT_B_017B200_2","PROTEASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ALA A 189;VAL A 157;GLY A 148;ILE A 178;ALA A 217","None","1.07A","3ektB-4p98A:undetectable","3ektB-4p98A:13.33"],["3ELZ_B_CHDB200_0","ILEAL BILE ACID-BINDING PROTEIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"PRO A 166;VAL A 171;THR A 240;GLY A 242","None","1.02A","3elzB-4p98A:undetectable","3elzB-4p98A:20.47"],["3G8I_A_RO7A1_2","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR ALPHA","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"LEU A 229;LEU A 309;LEU A 219;LEU A 288","None","0.96A","3g8iA-4p98A:undetectable","3g8iA-4p98A:23.69"],["3KK6_B_CELB1701_1","PROSTAGLANDIN G\/H SYNTHASE 1","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"GLN A 273;VAL A 133;LEU A 129;SER A 269;GLY A  96","None","1.18A","3kk6B-4p98A:undetectable","3kk6B-4p98A:20.14"],["3N3I_A_ROCA201_1","PROTEASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"GLY A 228;ASP A 225;ASP A 224;ARG A 227;ALA A 233","None","1.20A","3n3iA-4p98A:undetectable","3n3iA-4p98A:23.20"],["3OGP_A_017A200_1","FIV PROTEASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"GLY A  64;ALA A  65;ASP A  66;ILE A 274;LEU A  60","None","0.97A","3ogpA-4p98A:undetectable","3ogpA-4p98A:15.76"],["3SUD_A_SUEA1201_1","NS3 PROTEASE, NS4A PROTEIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"GLY A 161;GLY A 211;ALA A 209;ALA A 233;ALA A 235","None;None;None;None; BR A 419 ( 4.5A)","1.06A","3sudA-4p98A:undetectable","3sudA-4p98A:21.34"],["4C9L_A_CAMA1419_0","CYTOCHROME P450","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",6,"ILE A 178;THR A 240;LEU A 229;GLY A 226;ASP A 147;ILE A 241","None","0.88A","4c9lA-4p98A:undetectable","4c9lA-4p98A:22.55"],["4C9L_B_CAMB1419_0","CYTOCHROME P450","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",6,"ILE A 178;THR A 240;LEU A 229;GLY A 226;ASP A 147;ILE A 241","None","0.93A","4c9lB-4p98A:undetectable","4c9lB-4p98A:22.55"],["4C9O_A_CAMA423_0","CYTOCHROME P450","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",6,"ILE A 178;THR A 240;LEU A 229;GLY A 226;ASP A 147;ILE A 241","None","0.84A","4c9oA-4p98A:undetectable","4c9oA-4p98A:22.55"],["4C9O_B_CAMB423_0","CYTOCHROME P450","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",6,"ILE A 178;THR A 240;LEU A 229;GLY A 226;ASP A 147;ILE A 241","None","0.84A","4c9oB-4p98A:undetectable","4c9oB-4p98A:22.55"],["4F8Y_B_VK3B202_1","NADPH QUINONE OXIDOREDUCTASE;NADPH QUINONE OXIDOREDUCTASE","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"TRP A 136;ASN A  50;TYR A 138;LEU A 261","None; BR A 418 (-3.6A);None;MLY A 260 ( 4.1A)","1.46A","4f8yA-4p98A:5.8;4f8yB-4p98A:5.5","4f8yA-4p98A:18.24;4f8yB-4p98A:18.24"],["4L9Q_B_9TPB601_1","SERUM ALBUMIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ALA A  51;ILE A 241;LEU A 143;LEU A 146;GLY A 148"," BR A 412 ( 4.0A);None;None;None;None","1.00A","4l9qB-4p98A:undetectable","4l9qB-4p98A:19.79"],["4LRH_F_FOLF301_1","FOLATE RECEPTOR ALPHA","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",3,"ASP A  46;TRP A 136;SER A  41","None;None; BR A 418 ( 2.9A)","1.07A","4lrhF-4p98A:undetectable","4lrhF-4p98A:21.63"],["4QVL_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qvlK-4p98A:undetectable;4qvlL-4p98A:undetectable","4qvlK-4p98A:21.86;4qvlL-4p98A:22.08"],["4QVL_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qvlY-4p98A:undetectable;4qvlZ-4p98A:undetectable","4qvlY-4p98A:21.86;4qvlZ-4p98A:22.08"],["4QVM_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qvmK-4p98A:undetectable;4qvmL-4p98A:undetectable","4qvmK-4p98A:21.86;4qvmL-4p98A:22.08"],["4QVM_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qvmY-4p98A:undetectable;4qvmZ-4p98A:undetectable","4qvmY-4p98A:21.86;4qvmZ-4p98A:22.08"],["4QVP_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.99A","4qvpK-4p98A:undetectable;4qvpL-4p98A:undetectable","4qvpK-4p98A:21.86;4qvpL-4p98A:22.08"],["4QVP_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.99A","4qvpY-4p98A:undetectable;4qvpZ-4p98A:undetectable","4qvpY-4p98A:21.86;4qvpZ-4p98A:22.08"],["4QW1_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.99A","4qw1K-4p98A:undetectable;4qw1L-4p98A:undetectable","4qw1K-4p98A:20.91;4qw1L-4p98A:22.08"],["4QW1_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","1.00A","4qw1Y-4p98A:undetectable;4qw1Z-4p98A:undetectable","4qw1Y-4p98A:20.91;4qw1Z-4p98A:22.08"],["4QW3_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qw3K-4p98A:undetectable;4qw3L-4p98A:undetectable","4qw3K-4p98A:21.86;4qw3L-4p98A:22.08"],["4QW3_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","4qw3Y-4p98A:undetectable;4qw3Z-4p98A:undetectable","4qw3Y-4p98A:21.86;4qw3Z-4p98A:22.08"],["4RN6_A_15UA301_1","THROMBIN HEAVY CHAIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"LEU A 295;LEU A 219;ALA A 162;ALA A 151;GLY A 242","None","1.38A","4rn6A-4p98A:undetectable","4rn6A-4p98A:21.04"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"ALA A  56;ASP A 284;ARG A 282;THR A 278","None","0.99A","5bs8A-4p98A:undetectable;5bs8B-4p98A:undetectable;5bs8C-4p98A:undetectable","5bs8A-4p98A:22.29;5bs8B-4p98A:24.09;5bs8C-4p98A:22.29"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"ALA A  56;ASP A 284;ARG A 282;THR A 278","None","0.98A","5btdA-4p98A:undetectable;5btdB-4p98A:undetectable;5btdC-4p98A:undetectable","5btdA-4p98A:22.29;5btdB-4p98A:24.09;5btdC-4p98A:22.29"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"ALA A  56;ASP A 284;ARG A 282;THR A 278","None","0.98A","5btdA-4p98A:undetectable;5btdC-4p98A:undetectable;5btdD-4p98A:undetectable","5btdA-4p98A:22.29;5btdC-4p98A:22.29;5btdD-4p98A:24.09"],["5BXN_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","5bxnK-4p98A:undetectable;5bxnL-4p98A:undetectable","5bxnK-4p98A:21.86;5bxnL-4p98A:22.08"],["5BXN_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.98A","5bxnY-4p98A:undetectable;5bxnZ-4p98A:undetectable","5bxnY-4p98A:21.86;5bxnZ-4p98A:22.08"],["5D0X_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.99A","5d0xK-4p98A:undetectable;5d0xL-4p98A:undetectable","5d0xK-4p98A:20.65;5d0xL-4p98A:22.08"],["5D0X_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 174;ALA A 173;GLY A 148;GLY A 181;ALA A 180","None; BR A 406 ( 4.7A);None;None; BR A 421 (-4.1A)","0.99A","5d0xY-4p98A:undetectable;5d0xZ-4p98A:undetectable","5d0xY-4p98A:20.65;5d0xZ-4p98A:22.08"],["5FHZ_B_REAB602_1","ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ILE A  38;THR A 266;TRP A 136;ASN A  50;LEU A 286","None;None;None; BR A 418 (-3.6A);None","1.06A","5fhzB-4p98A:3.8","5fhzB-4p98A:22.22"],["5FHZ_B_REAB602_1","ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 266;TRP A 136;GLN A  43;ASN A  50;LEU A 286","None;None;None; BR A 418 (-3.6A);None","1.16A","5fhzB-4p98A:3.8","5fhzB-4p98A:22.22"],["5FHZ_C_REAC602_1","ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"ILE A  38;THR A 266;TRP A 136;ASN A  50;LEU A 286","None;None;None; BR A 418 (-3.6A);None","1.09A","5fhzC-4p98A:3.0","5fhzC-4p98A:22.22"],["5FHZ_C_REAC602_1","ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",5,"THR A 266;TRP A 136;GLN A  43;ASN A  50;LEU A 286","None;None;None; BR A 418 (-3.6A);None","1.33A","5fhzC-4p98A:3.0","5fhzC-4p98A:22.22"],["5M45_A_ACTA803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"GLU A 103;PRO A 104;ILE A 105;LEU A 106","None","1.23A","5m45A-4p98A:undetectable","5m45A-4p98A:17.52"],["5M45_D_ACTD803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"GLU A 103;PRO A 104;ILE A 105;LEU A 106","None","1.27A","5m45D-4p98A:undetectable","5m45D-4p98A:17.52"],["5M45_G_ACTG803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"GLU A 103;PRO A 104;ILE A 105;LEU A 106","None","1.26A","5m45G-4p98A:undetectable","5m45G-4p98A:17.52"],["5M45_J_ACTJ803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",4,"GLU A 103;PRO A 104;ILE A 105;LEU A 106","None","1.29A","5m45J-4p98A:undetectable","5m45J-4p98A:17.52"],["5MUG_A_VIVA301_1","ALPHA-TOCOPHEROL TRANSFER PROTEIN","4p98","EXTRACELLULAR SOLUTE-BINDING PROTEIN","Conexibacter woesei",3,"SER A 120;SER A 118;PHE A  49"," BR A 402 (-3.3A);None;None","0.72A","5mugA-4p98A:undetectable","5mugA-4p98A:20.38"]]