SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4ubt'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N2X_B_SAMB402_1 (S-ADENOSYL-METHYLTRA NSFERASE MRAW)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	VAL A 60 SER A 93 ASP A 250 GLN A 66	None 3G6 A 402 (-2.7A) None None	1.37A	1n2xB-4ubtA: undetectable	1n2xB-4ubtA: 22.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PNL_B_PACB559_0 (PENICILLIN AMIDOHYDROLASE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 8	SER A 354 SER A 95 ALA A 99 ASN A 100	None	0.92A	1pnlA-4ubtA: undetectable 1pnlB-4ubtA: undetectable	1pnlA-4ubtA: 18.02 1pnlB-4ubtA: 22.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RI4_A_SAMA299_0 (MRNA CAPPING ENZYME)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	6 / 12	GLY A 57 GLY A 119 ILE A 116 ALA A 254 GLN A 62 SER A 71	None	0.98A	1ri4A-4ubtA: undetectable	1ri4A-4ubtA: 22.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_D_NCTD1208_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 8	THR A 88 CYH A 118 TRP A 75 LEU A 30	None	1.49A	1uw6D-4ubtA: undetectable 1uw6E-4ubtA: undetectable	1uw6D-4ubtA: 18.13 1uw6E-4ubtA: 18.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_P_NCTP1206_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 8	THR A 88 CYH A 118 TRP A 75 LEU A 30	None	1.47A	1uw6P-4ubtA: undetectable 1uw6Q-4ubtA: undetectable	1uw6P-4ubtA: 18.13 1uw6Q-4ubtA: 18.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A8T_B_ADNB252_1 (U8 SNORNA-BINDING PROTEIN X29)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 8	GLY A 251 THR A 358 ILE A 14 SER A 12	None	0.89A	2a8tB-4ubtA: undetectable	2a8tB-4ubtA: 22.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DPM_A_SAMA300_0 (PROTEIN (ADENINE-SPECIFIC METHYLTRANSFERASE DPNII 1))	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	GLY A 119 GLY A 353 GLY A 96 ALA A 99 ASN A 315	None	1.09A	2dpmA-4ubtA: undetectable	2dpmA-4ubtA: 22.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QMZ_A_LDPA501_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	TRP A 257 GLY A 96 GLN A 97 ILE A 374	None	0.90A	2qmzA-4ubtA: undetectable 2qmzB-4ubtA: undetectable	2qmzA-4ubtA: 20.96 2qmzB-4ubtA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VMY_A_FFOA505_1 (SERINE HYDROXYMETHYLTRANSFE RASE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	GLY A 346 SER A 246 ALA A 342 ASN A 315 GLY A 96	None COA A 401 (-3.7A) None None None	1.12A	2vmyB-4ubtA: undetectable	2vmyB-4ubtA: 23.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VMY_A_FFOA505_1 (SERINE HYDROXYMETHYLTRANSFE RASE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	GLY A 346 SER A 246 ASN A 315 SER A 354 GLY A 96	None COA A 401 (-3.7A) None None None	1.28A	2vmyB-4ubtA: undetectable	2vmyB-4ubtA: 23.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3B0W_B_DGXB1_1 (NUCLEAR RECEPTOR ROR-GAMMA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	LEU A 268 CYH A 118 ALA A 41 VAL A 38 LEU A 30	None	1.34A	3b0wB-4ubtA: undetectable	3b0wB-4ubtA: 20.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3C6G_A_VD3A701_1 (CYTOCHROME P450 2R1)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	LEU A 128 PHE A 318 ALA A 378 ALA A 154 THR A 352	3G6 A 402 ( 4.3A) None 3G6 A 402 (-4.1A) None None	1.05A	3c6gA-4ubtA: undetectable	3c6gA-4ubtA: 22.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3C6G_B_VD3B700_1 (CYTOCHROME P450 2R1)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	LEU A 128 PHE A 318 ALA A 378 ALA A 154 THR A 352	3G6 A 402 ( 4.3A) None 3G6 A 402 (-4.1A) None None	1.04A	3c6gB-4ubtA: undetectable	3c6gB-4ubtA: 22.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CZH_B_D2VB602_1 (CYTOCHROME P450 2R1)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	LEU A 128 PHE A 318 ALA A 378 ALA A 154 THR A 352	3G6 A 402 ( 4.3A) None 3G6 A 402 (-4.1A) None None	1.02A	3czhB-4ubtA: undetectable	3czhB-4ubtA: 22.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K9F_F_LFXF0_1 (DNA TOPOISOMERASE 4 SUBUNIT A DNA TOPOISOMERASE 4 SUBUNIT B)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	1.33A	3k9fA-4ubtA: undetectable 3k9fB-4ubtA: undetectable 3k9fC-4ubtA: undetectable	3k9fA-4ubtA: 21.62 3k9fB-4ubtA: 21.62 3k9fC-4ubtA: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KW4_A_TICA600_1 (CYTOCHROME P450 2B4)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 11	ILE A 196 SER A 354 ALA A 32 ILE A 120 GLY A 119	None	0.83A	3kw4A-4ubtA: undetectable	3kw4A-4ubtA: 22.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A7A_B_RGZB601_1 (AMINE OXIDASE [FLAVIN-CONTAINING] B)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	PRO A 13 LEU A 21 LEU A 24 GLN A 34 ILE A 196	None	1.06A	4a7aB-4ubtA: undetectable	4a7aB-4ubtA: 21.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4COX_A_IMNA701_1 (CYCLOOXYGENASE-2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.99A	4coxA-4ubtA: undetectable	4coxA-4ubtA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4COX_B_IMNB701_1 (CYCLOOXYGENASE-2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	1.00A	4coxB-4ubtA: undetectable	4coxB-4ubtA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4COX_D_IMND701_1 (CYCLOOXYGENASE-2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.99A	4coxD-4ubtA: undetectable	4coxD-4ubtA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EVY_B_TOYB201_1 (AMINOGLYCOSIDE N(6')-ACETYLTRANSFER ASE TYPE 1)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 10	ASN A 337 GLU A 316 ASP A 217 GLU A 192 GLY A 353	None	1.45A	4evyA-4ubtA: undetectable 4evyB-4ubtA: undetectable	4evyA-4ubtA: 18.18 4evyB-4ubtA: 18.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G0U_B_ASWB1301_1 (DNA TOPOISOMERASE 2-BETA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ILE A 164 GLY A 237 ALA A 155 GLU A 156	None	0.97A	4g0uB-4ubtA: undetectable	4g0uB-4ubtA: 18.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IOM_A_FOLA608_0 (FORMATE--TETRAHYDROF OLATE LIGASE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ALA A 272 PRO A 270 GLU A 8 LEU A 361	None	1.01A	4iomA-4ubtA: undetectable	4iomA-4ubtA: 21.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OTY_A_LURA705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.93A	4otyA-4ubtA: undetectable	4otyA-4ubtA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OTY_B_LURB705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.96A	4otyB-4ubtA: undetectable	4otyB-4ubtA: 19.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QOG_B_ML1B302_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 6	TRP A 257 GLY A 96 GLN A 97 ILE A 374	None	0.95A	4qogA-4ubtA: undetectable 4qogB-4ubtA: undetectable	4qogA-4ubtA: 20.96 4qogB-4ubtA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RRW_C_LURC705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.94A	4rrwC-4ubtA: undetectable	4rrwC-4ubtA: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RRW_D_LURD705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.97A	4rrwD-4ubtA: undetectable	4rrwD-4ubtA: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RRZ_C_LURC705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.94A	4rrzC-4ubtA: undetectable	4rrzC-4ubtA: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RRZ_D_LURD705_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.97A	4rrzD-4ubtA: undetectable	4rrzD-4ubtA: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z3O_F_MFXF101_1 (DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE E-SITE DNA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	1.24A	4z3oA-4ubtA: undetectable 4z3oB-4ubtA: undetectable	4z3oA-4ubtA: 19.35 4z3oB-4ubtA: 19.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	1.02A	5bs8A-4ubtA: undetectable 5bs8B-4ubtA: undetectable 5bs8C-4ubtA: undetectable	5bs8A-4ubtA: 23.46 5bs8B-4ubtA: 21.17 5bs8C-4ubtA: 23.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	0.97A	5btaA-4ubtA: undetectable 5btaC-4ubtA: undetectable 5btaD-4ubtA: undetectable	5btaA-4ubtA: 23.46 5btaC-4ubtA: 23.46 5btaD-4ubtA: 21.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 6	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	1.00A	5btaA-4ubtA: undetectable 5btaB-4ubtA: undetectable 5btaC-4ubtA: undetectable	5btaA-4ubtA: 23.46 5btaB-4ubtA: 21.17 5btaC-4ubtA: 23.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 6	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	1.00A	5btcA-4ubtA: undetectable 5btcC-4ubtA: undetectable 5btcD-4ubtA: undetectable	5btcA-4ubtA: 23.46 5btcC-4ubtA: 23.46 5btcD-4ubtA: 21.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 6	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	1.02A	5btcA-4ubtA: undetectable 5btcB-4ubtA: undetectable 5btcC-4ubtA: undetectable	5btcA-4ubtA: 23.46 5btcB-4ubtA: 21.17 5btcC-4ubtA: 23.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	0.99A	5btdA-4ubtA: undetectable 5btdB-4ubtA: undetectable 5btdC-4ubtA: undetectable	5btdA-4ubtA: 23.46 5btdB-4ubtA: 21.17 5btdC-4ubtA: 23.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	0.95A	5btdA-4ubtA: undetectable 5btdC-4ubtA: undetectable 5btdD-4ubtA: undetectable	5btdA-4ubtA: 23.46 5btdC-4ubtA: 23.46 5btdD-4ubtA: 21.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	0.97A	5btfA-4ubtA: undetectable 5btfB-4ubtA: undetectable 5btfC-4ubtA: undetectable	5btfA-4ubtA: 23.46 5btfB-4ubtA: 21.17 5btfC-4ubtA: 23.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ARG A 11 ARG A 188 GLY A 187 GLU A 186	None None GOL A 404 ( 3.7A) None	0.96A	5btfA-4ubtA: undetectable 5btfC-4ubtA: undetectable 5btfD-4ubtA: undetectable	5btfA-4ubtA: 23.46 5btfC-4ubtA: 23.46 5btfD-4ubtA: 21.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDQ_E_MFXE2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	0.83A	5cdqA-4ubtA: undetectable 5cdqB-4ubtA: undetectable 5cdqC-4ubtA: undetectable	5cdqA-4ubtA: 24.25 5cdqB-4ubtA: 20.87 5cdqC-4ubtA: 24.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDQ_V_MFXV2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	ARG A 188 GLY A 187 GLU A 186 ARG A 11	None GOL A 404 ( 3.7A) None None	0.96A	5cdqR-4ubtA: undetectable 5cdqS-4ubtA: undetectable 5cdqT-4ubtA: undetectable	5cdqR-4ubtA: 24.25 5cdqS-4ubtA: 20.87 5cdqT-4ubtA: 24.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_A_SAMA4001_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	GLY A 119 GLY A 94 GLY A 58 THR A 384 ILE A 374	None	1.04A	5ehiA-4ubtA: undetectable	5ehiA-4ubtA: 19.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_C_SAMC4000_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	GLY A 119 GLY A 94 GLY A 58 THR A 384 ILE A 374	None	1.05A	5ehiC-4ubtA: undetectable	5ehiC-4ubtA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5F1A_A_SALA601_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 8	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	0.99A	5f1aA-4ubtA: undetectable	5f1aA-4ubtA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKQ_A_JMSA602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	1.05A	5ikqA-4ubtA: undetectable	5ikqA-4ubtA: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKQ_B_JMSB602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 234 LEU A 228 GLY A 243 ALA A 242 SER A 245	None None COA A 401 ( 4.3A) COA A 401 (-3.5A) COA A 401 ( 4.0A)	1.05A	5ikqB-4ubtA: undetectable	5ikqB-4ubtA: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JGL_A_SAMA301_0 (UBIE/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	ALA A 254 ALA A 252 LEU A 29 ALA A 9 SER A 194	None	1.36A	5jglA-4ubtA: undetectable	5jglA-4ubtA: 23.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M0I_B_ACTB303_0 (SWI5-DEPENDENT HO EXPRESSION PROTEIN 2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 5	VAL A 349 THR A 61 ASN A 131 LEU A 128	3G6 A 402 ( 4.7A) None None 3G6 A 402 ( 4.3A)	1.11A	5m0iB-4ubtA: undetectable	5m0iB-4ubtA: 20.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5O4Y_F_CCSF14_0 (PHE-MAA-ASN-PRO-HIS- LEU-SER-TRP-SER-TRP- 9KK-9KK-ARG-CCS-GLY- NH2)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 6	LEU A 30 SER A 12 ARG A 11 GLY A 251	None	1.07A	5o4yF-4ubtA: undetectable	5o4yF-4ubtA: 5.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OGC_B_TA1B601_1 (TUBULIN BETA CHAIN)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	5 / 12	VAL A 37 THR A 88 ARG A 72 GLY A 31 LEU A 30	None	1.02A	5ogcB-4ubtA: undetectable	5ogcB-4ubtA: 20.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN5_E_LLLE301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	4ubt	ACETYL-COA ACETYLTRANSFERASE FADA5 (Mycobacterium tuberculosis)	4 / 7	ASP A 217 ARG A 355 GLU A 192 GLU A 313	None	1.09A	6mn5E-4ubtA: undetectable	6mn5E-4ubtA: 11.51

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1N2X_B_SAMB402_1","S-ADENOSYL-METHYLTRANSFERASE MRAW","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"VAL A  60;SER A  93;ASP A 250;GLN A  66","None;3G6 A 402 (-2.7A);None;None","1.37A","1n2xB-4ubtA:undetectable","1n2xB-4ubtA:22.17"],["1PNL_B_PACB559_0","PENICILLIN AMIDOHYDROLASE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"SER A 354;SER A  95;ALA A  99;ASN A 100","None","0.92A","1pnlA-4ubtA:undetectable;1pnlB-4ubtA:undetectable","1pnlA-4ubtA:18.02;1pnlB-4ubtA:22.32"],["1RI4_A_SAMA299_0","MRNA CAPPING ENZYME","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",6,"GLY A  57;GLY A 119;ILE A 116;ALA A 254;GLN A  62;SER A  71","None","0.98A","1ri4A-4ubtA:undetectable","1ri4A-4ubtA:22.17"],["1UW6_D_NCTD1208_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"THR A  88;CYH A 118;TRP A  75;LEU A  30","None","1.49A","1uw6D-4ubtA:undetectable;1uw6E-4ubtA:undetectable","1uw6D-4ubtA:18.13;1uw6E-4ubtA:18.13"],["1UW6_P_NCTP1206_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"THR A  88;CYH A 118;TRP A  75;LEU A  30","None","1.47A","1uw6P-4ubtA:undetectable;1uw6Q-4ubtA:undetectable","1uw6P-4ubtA:18.13;1uw6Q-4ubtA:18.13"],["2A8T_B_ADNB252_1","U8 SNORNA-BINDING PROTEIN X29","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"GLY A 251;THR A 358;ILE A  14;SER A  12","None","0.89A","2a8tB-4ubtA:undetectable","2a8tB-4ubtA:22.25"],["2DPM_A_SAMA300_0","PROTEIN (ADENINE-SPECIFIC METHYLTRANSFERASE DPNII 1)","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"GLY A 119;GLY A 353;GLY A  96;ALA A  99;ASN A 315","None","1.09A","2dpmA-4ubtA:undetectable","2dpmA-4ubtA:22.33"],["2QMZ_A_LDPA501_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE;RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"TRP A 257;GLY A  96;GLN A  97;ILE A 374","None","0.90A","2qmzA-4ubtA:undetectable;2qmzB-4ubtA:undetectable","2qmzA-4ubtA:20.96;2qmzB-4ubtA:20.96"],["2VMY_A_FFOA505_1","SERINE HYDROXYMETHYLTRANSFERASE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"GLY A 346;SER A 246;ALA A 342;ASN A 315;GLY A  96","None;COA A 401 (-3.7A);None;None;None","1.12A","2vmyB-4ubtA:undetectable","2vmyB-4ubtA:23.58"],["2VMY_A_FFOA505_1","SERINE HYDROXYMETHYLTRANSFERASE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"GLY A 346;SER A 246;ASN A 315;SER A 354;GLY A  96","None;COA A 401 (-3.7A);None;None;None","1.28A","2vmyB-4ubtA:undetectable","2vmyB-4ubtA:23.58"],["3B0W_B_DGXB1_1","NUCLEAR RECEPTOR ROR-GAMMA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"LEU A 268;CYH A 118;ALA A  41;VAL A  38;LEU A  30","None","1.34A","3b0wB-4ubtA:undetectable","3b0wB-4ubtA:20.57"],["3C6G_A_VD3A701_1","CYTOCHROME P450 2R1","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"LEU A 128;PHE A 318;ALA A 378;ALA A 154;THR A 352","3G6 A 402 ( 4.3A);None;3G6 A 402 (-4.1A);None;None","1.05A","3c6gA-4ubtA:undetectable","3c6gA-4ubtA:22.29"],["3C6G_B_VD3B700_1","CYTOCHROME P450 2R1","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"LEU A 128;PHE A 318;ALA A 378;ALA A 154;THR A 352","3G6 A 402 ( 4.3A);None;3G6 A 402 (-4.1A);None;None","1.04A","3c6gB-4ubtA:undetectable","3c6gB-4ubtA:22.29"],["3CZH_B_D2VB602_1","CYTOCHROME P450 2R1","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"LEU A 128;PHE A 318;ALA A 378;ALA A 154;THR A 352","3G6 A 402 ( 4.3A);None;3G6 A 402 (-4.1A);None;None","1.02A","3czhB-4ubtA:undetectable","3czhB-4ubtA:22.29"],["3K9F_F_LFXF0_1","DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT A;DNA TOPOISOMERASE 4 SUBUNIT B","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","1.33A","3k9fA-4ubtA:undetectable;3k9fB-4ubtA:undetectable;3k9fC-4ubtA:undetectable","3k9fA-4ubtA:21.62;3k9fB-4ubtA:21.62;3k9fC-4ubtA:21.72"],["3KW4_A_TICA600_1","CYTOCHROME P450 2B4","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"ILE A 196;SER A 354;ALA A  32;ILE A 120;GLY A 119","None","0.83A","3kw4A-4ubtA:undetectable","3kw4A-4ubtA:22.51"],["4A7A_B_RGZB601_1","AMINE OXIDASE [FLAVIN-CONTAINING] B","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"PRO A  13;LEU A  21;LEU A  24;GLN A  34;ILE A 196","None","1.06A","4a7aB-4ubtA:undetectable","4a7aB-4ubtA:21.16"],["4COX_A_IMNA701_1","CYCLOOXYGENASE-2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.99A","4coxA-4ubtA:undetectable","4coxA-4ubtA:19.33"],["4COX_B_IMNB701_1","CYCLOOXYGENASE-2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","1.00A","4coxB-4ubtA:undetectable","4coxB-4ubtA:19.33"],["4COX_D_IMND701_1","CYCLOOXYGENASE-2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.99A","4coxD-4ubtA:undetectable","4coxD-4ubtA:19.33"],["4EVY_B_TOYB201_1","AMINOGLYCOSIDE N(6')-ACETYLTRANSFERASE TYPE 1;AMINOGLYCOSIDE N(6')-ACETYLTRANSFERASE TYPE 1","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"ASN A 337;GLU A 316;ASP A 217;GLU A 192;GLY A 353","None","1.45A","4evyA-4ubtA:undetectable;4evyB-4ubtA:undetectable","4evyA-4ubtA:18.18;4evyB-4ubtA:18.18"],["4G0U_B_ASWB1301_1","DNA TOPOISOMERASE 2-BETA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ILE A 164;GLY A 237;ALA A 155;GLU A 156","None","0.97A","4g0uB-4ubtA:undetectable","4g0uB-4ubtA:18.79"],["4IOM_A_FOLA608_0","FORMATE--TETRAHYDROFOLATE LIGASE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ALA A 272;PRO A 270;GLU A   8;LEU A 361","None","1.01A","4iomA-4ubtA:undetectable","4iomA-4ubtA:21.93"],["4OTY_A_LURA705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.93A","4otyA-4ubtA:undetectable","4otyA-4ubtA:19.33"],["4OTY_B_LURB705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.96A","4otyB-4ubtA:undetectable","4otyB-4ubtA:19.33"],["4QOG_B_ML1B302_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"TRP A 257;GLY A  96;GLN A  97;ILE A 374","None","0.95A","4qogA-4ubtA:undetectable;4qogB-4ubtA:undetectable","4qogA-4ubtA:20.96;4qogB-4ubtA:20.96"],["4RRW_C_LURC705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.94A","4rrwC-4ubtA:undetectable","4rrwC-4ubtA:20.00"],["4RRW_D_LURD705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.97A","4rrwD-4ubtA:undetectable","4rrwD-4ubtA:20.00"],["4RRZ_C_LURC705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.94A","4rrzC-4ubtA:undetectable","4rrzC-4ubtA:20.00"],["4RRZ_D_LURD705_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.97A","4rrzD-4ubtA:undetectable","4rrzD-4ubtA:20.00"],["4Z3O_F_MFXF101_1","DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;DNA TOPOISOMERASE 4 SUBUNIT B,PARE30-PARC55 FUSED TOPO IV FROM S. PNEUMONIAE;E-SITE DNA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","1.24A","4z3oA-4ubtA:undetectable;4z3oB-4ubtA:undetectable","4z3oA-4ubtA:19.35;4z3oB-4ubtA:19.35"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","1.02A","5bs8A-4ubtA:undetectable;5bs8B-4ubtA:undetectable;5bs8C-4ubtA:undetectable","5bs8A-4ubtA:23.46;5bs8B-4ubtA:21.17;5bs8C-4ubtA:23.46"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","0.97A","5btaA-4ubtA:undetectable;5btaC-4ubtA:undetectable;5btaD-4ubtA:undetectable","5btaA-4ubtA:23.46;5btaC-4ubtA:23.46;5btaD-4ubtA:21.17"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","1.00A","5btaA-4ubtA:undetectable;5btaB-4ubtA:undetectable;5btaC-4ubtA:undetectable","5btaA-4ubtA:23.46;5btaB-4ubtA:21.17;5btaC-4ubtA:23.46"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","1.00A","5btcA-4ubtA:undetectable;5btcC-4ubtA:undetectable;5btcD-4ubtA:undetectable","5btcA-4ubtA:23.46;5btcC-4ubtA:23.46;5btcD-4ubtA:21.17"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","1.02A","5btcA-4ubtA:undetectable;5btcB-4ubtA:undetectable;5btcC-4ubtA:undetectable","5btcA-4ubtA:23.46;5btcB-4ubtA:21.17;5btcC-4ubtA:23.46"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","0.99A","5btdA-4ubtA:undetectable;5btdB-4ubtA:undetectable;5btdC-4ubtA:undetectable","5btdA-4ubtA:23.46;5btdB-4ubtA:21.17;5btdC-4ubtA:23.46"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","0.95A","5btdA-4ubtA:undetectable;5btdC-4ubtA:undetectable;5btdD-4ubtA:undetectable","5btdA-4ubtA:23.46;5btdC-4ubtA:23.46;5btdD-4ubtA:21.17"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","0.97A","5btfA-4ubtA:undetectable;5btfB-4ubtA:undetectable;5btfC-4ubtA:undetectable","5btfA-4ubtA:23.46;5btfB-4ubtA:21.17;5btfC-4ubtA:23.46"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A  11;ARG A 188;GLY A 187;GLU A 186","None;None;GOL A 404 ( 3.7A);None","0.96A","5btfA-4ubtA:undetectable;5btfC-4ubtA:undetectable;5btfD-4ubtA:undetectable","5btfA-4ubtA:23.46;5btfC-4ubtA:23.46;5btfD-4ubtA:21.17"],["5CDQ_E_MFXE2101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","0.83A","5cdqA-4ubtA:undetectable;5cdqB-4ubtA:undetectable;5cdqC-4ubtA:undetectable","5cdqA-4ubtA:24.25;5cdqB-4ubtA:20.87;5cdqC-4ubtA:24.25"],["5CDQ_V_MFXV2101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ARG A 188;GLY A 187;GLU A 186;ARG A  11","None;GOL A 404 ( 3.7A);None;None","0.96A","5cdqR-4ubtA:undetectable;5cdqS-4ubtA:undetectable;5cdqT-4ubtA:undetectable","5cdqR-4ubtA:24.25;5cdqS-4ubtA:20.87;5cdqT-4ubtA:24.25"],["5EHI_A_SAMA4001_0","NS5 METHYLTRANSFERASE DENGUE VIRUS","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"GLY A 119;GLY A  94;GLY A  58;THR A 384;ILE A 374","None","1.04A","5ehiA-4ubtA:undetectable","5ehiA-4ubtA:19.15"],["5EHI_C_SAMC4000_0","NS5 METHYLTRANSFERASE DENGUE VIRUS","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"GLY A 119;GLY A  94;GLY A  58;THR A 384;ILE A 374","None","1.05A","5ehiC-4ubtA:undetectable","5ehiC-4ubtA:undetectable"],["5F1A_A_SALA601_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","0.99A","5f1aA-4ubtA:undetectable","5f1aA-4ubtA:20.28"],["5IKQ_A_JMSA602_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","1.05A","5ikqA-4ubtA:undetectable","5ikqA-4ubtA:20.14"],["5IKQ_B_JMSB602_1","PROSTAGLANDIN G\/H SYNTHASE 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A 234;LEU A 228;GLY A 243;ALA A 242;SER A 245","None;None;COA A 401 ( 4.3A);COA A 401 (-3.5A);COA A 401 ( 4.0A)","1.05A","5ikqB-4ubtA:undetectable","5ikqB-4ubtA:20.14"],["5JGL_A_SAMA301_0","UBIE\/COQ5 FAMILY METHYLTRANSFERASE, PUTATIVE","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"ALA A 254;ALA A 252;LEU A  29;ALA A   9;SER A 194","None","1.36A","5jglA-4ubtA:undetectable","5jglA-4ubtA:23.75"],["5M0I_B_ACTB303_0","SWI5-DEPENDENT HO EXPRESSION PROTEIN 2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"VAL A 349;THR A  61;ASN A 131;LEU A 128","3G6 A 402 ( 4.7A);None;None;3G6 A 402 ( 4.3A)","1.11A","5m0iB-4ubtA:undetectable","5m0iB-4ubtA:20.45"],["5O4Y_F_CCSF14_0","PHE-MAA-ASN-PRO-HIS-LEU-SER-TRP-SER-TRP-9KK-9KK-ARG-CCS-GLY-NH2","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"LEU A  30;SER A  12;ARG A  11;GLY A 251","None","1.07A","5o4yF-4ubtA:undetectable","5o4yF-4ubtA:5.23"],["5OGC_B_TA1B601_1","TUBULIN BETA CHAIN","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",5,"VAL A  37;THR A  88;ARG A  72;GLY A  31;LEU A  30","None","1.02A","5ogcB-4ubtA:undetectable","5ogcB-4ubtA:20.84"],["6MN5_E_LLLE301_0","AMINOGLYCOSIDE N(3)-ACETYLTRANSFERASE, AAC(3)-IVA","4ubt","ACETYL-COA ACETYLTRANSFERASE FADA5","Mycobacterium tuberculosis",4,"ASP A 217;ARG A 355;GLU A 192;GLU A 313","None","1.09A","6mn5E-4ubtA:undetectable","6mn5E-4ubtA:11.51"]]