SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '4umv'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_T_TRPT81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	GLY A 289 ALA A 589 THR A 583 THR A 442	BEF A1732 (-3.0A) None BEF A1732 (-4.2A) None	0.77A	1c9sT-4umvA: undetectable 1c9sU-4umvA: undetectable	1c9sT-4umvA: 7.07 1c9sU-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7A_A_PFLA4001_1 (SERUM ALBUMIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 9	LEU A 531 ILE A 532 LEU A 462 VAL A 551 ALA A 525	None	1.21A	1e7aA-4umvA: undetectable	1e7aA-4umvA: 24.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EIZ_A_SAMA301_0 (FTSJ)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 224 GLY A 407 GLY A 421 GLY A 420 LEU A 729	None	0.90A	1eizA-4umvA: 3.1	1eizA-4umvA: 13.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EJ0_A_SAMA301_0 (FTSJ)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 224 GLY A 407 GLY A 421 GLY A 420 LEU A 729	None	0.89A	1ej0A-4umvA: 3.1	1ej0A-4umvA: 13.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1G50_C_ESTC2600_1 (ESTROGEN RECEPTOR)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	LEU A 207 LEU A 161 ILE A 192 GLY A 193 LEU A 389	None	1.28A	1g50C-4umvA: undetectable	1g50C-4umvA: 14.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GS4_A_ZK5A1918_1 (ANDROGEN RECEPTOR)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	LEU A 572 LEU A 575 GLY A 576 VAL A 430 LEU A 599	None	1.02A	1gs4A-4umvA: undetectable	1gs4A-4umvA: 16.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_L_TRPL81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	GLY A 289 ALA A 589 THR A 583 THR A 442	BEF A1732 (-3.0A) None BEF A1732 (-4.2A) None	0.77A	1gtfL-4umvA: undetectable 1gtfM-4umvA: undetectable	1gtfL-4umvA: 7.07 1gtfM-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_N_TRPN81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	GLY A 289 ALA A 589 THR A 583 THR A 442	BEF A1732 (-3.0A) None BEF A1732 (-4.2A) None	0.78A	1gtfN-4umvA: undetectable 1gtfO-4umvA: undetectable	1gtfN-4umvA: 7.07 1gtfO-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_I_TRPI81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	1gtnH-4umvA: undetectable 1gtnI-4umvA: undetectable	1gtnH-4umvA: 7.07 1gtnI-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_A_AG2A7005_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 6	LEU A 269 ASP A 272 LEU A 318 ARG A 328	None	0.86A	1mt1A-4umvA: undetectable 1mt1F-4umvA: undetectable	1mt1A-4umvA: 4.92 1mt1F-4umvA: 8.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_B_AG2B7001_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 6	ARG A 328 LEU A 269 ASP A 272 LEU A 318	None	0.91A	1mt1B-4umvA: undetectable 1mt1C-4umvA: undetectable	1mt1B-4umvA: 8.95 1mt1C-4umvA: 4.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_G_AG2G7003_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 6	LEU A 269 ASP A 272 LEU A 318 ARG A 328	None	0.90A	1mt1G-4umvA: undetectable 1mt1J-4umvA: undetectable	1mt1G-4umvA: 4.92 1mt1J-4umvA: 8.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_K_AG2K7002_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	ARG A 328 LEU A 269 ASP A 272 LEU A 318	None	0.89A	1mt1H-4umvA: undetectable 1mt1K-4umvA: undetectable	1mt1H-4umvA: 8.95 1mt1K-4umvA: 4.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_H_AG2H7012_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 6	ARG A 328 LEU A 269 ASP A 272 LEU A 318	None	0.85A	1n13H-4umvA: undetectable 1n13K-4umvA: undetectable	1n13H-4umvA: 8.95 1n13K-4umvA: 4.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_J_AG2J7013_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	LEU A 269 ASP A 272 LEU A 318 ARG A 328	None	0.89A	1n13G-4umvA: undetectable 1n13J-4umvA: undetectable	1n13G-4umvA: 4.92 1n13J-4umvA: 8.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_L_AG2L7014_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	LEU A 269 ASP A 272 LEU A 318 ARG A 328	None	0.86A	1n13I-4umvA: undetectable 1n13L-4umvA: undetectable	1n13I-4umvA: 4.92 1n13L-4umvA: 8.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PK7_C_ADNC1247_1 (PURINE NUCLEOSIDE PHOSPHORYLASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	SER A 319 GLY A 322 GLU A 320 SER A 324 ASP A 327	None	1.45A	1pk7C-4umvA: undetectable	1pk7C-4umvA: 16.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PK9_B_2FAB307_1 (PURINE NUCLEOSIDE PHOSPHORYLASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 9	SER A 319 GLY A 322 GLU A 320 SER A 324 ASP A 327	None	1.43A	1pk9B-4umvA: 2.2	1pk9B-4umvA: 16.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BYO_A_LNLA1217_1 (LIPOPROTEIN LPPX)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 4	VAL A 614 LEU A 427 ILE A 672 LEU A 668	None	0.76A	2byoA-4umvA: undetectable	2byoA-4umvA: 17.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J0D_A_ERYA1498_0 (CYTOCHROME P450 3A4)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 643 ILE A 641 ALA A 423 ALA A 221 ARG A 223	None	1.20A	2j0dA-4umvA: undetectable	2j0dA-4umvA: 21.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7H_B_SAMB530_0 (TYPE I RESTRICTION ENZYME ECOKI M PROTEIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	THR A 583 ILE A 581 GLY A 439 THR A 440 LEU A 477	BEF A1732 (-4.2A) None MG A1731 ( 4.6A) None None	0.97A	2y7hB-4umvA: undetectable	2y7hB-4umvA: 19.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Y7H_C_SAMC530_0 (TYPE I RESTRICTION ENZYME ECOKI M PROTEIN)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	THR A 583 ILE A 581 GLY A 439 THR A 440 LEU A 477	BEF A1732 (-4.2A) None MG A1731 ( 4.6A) None None	0.97A	2y7hC-4umvA: undetectable	2y7hC-4umvA: 19.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DOU_A_SAMA1_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 224 GLY A 407 GLY A 421 GLY A 420 ALA A 410	None	0.87A	3douA-4umvA: undetectable	3douA-4umvA: 14.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G88_A_SAMA303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.04A	3g88A-4umvA: undetectable	3g88A-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G88_B_SAMB303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.03A	3g88B-4umvA: 3.6	3g88B-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G89_A_SAMA303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.02A	3g89A-4umvA: undetectable	3g89A-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G89_B_SAMB303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.02A	3g89B-4umvA: undetectable	3g89B-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G8B_A_SAMA303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.02A	3g8bA-4umvA: undetectable	3g8bA-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G8B_B_SAMB303_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	GLY A 627 GLY A 629 ASP A 628 THR A 438 ALA A 635	None MG A1731 (-4.1A) MG A1731 ( 1.1A) BEF A1732 ( 3.7A) None	1.00A	3g8bB-4umvA: undetectable	3g8bB-4umvA: 20.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ILU_B_HFZB800_1 (GLUTAMATE RECEPTOR 2)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	PRO A 476 LEU A 557 ILE A 292 PRO A 293 SER A 285	None	1.33A	3iluB-4umvA: undetectable 3iluE-4umvA: undetectable	3iluB-4umvA: 16.67 3iluE-4umvA: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JUS_A_ECLA600_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	LEU A 660 THR A 661 GLY A 227 ALA A 224	None	0.77A	3jusA-4umvA: undetectable	3jusA-4umvA: 19.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JUS_A_ECNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	LEU A 660 THR A 661 GLY A 227 ALA A 224	None	0.77A	3jusA-4umvA: undetectable	3jusA-4umvA: 19.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N2O_C_AG2C1002_1 (BIOSYNTHETIC ARGININE DECARBOXYLASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	SER A 285 ASP A 559 ASP A 628 ASP A 436	None None MG A1731 ( 1.1A) BEF A1732 ( 2.0A)	0.91A	3n2oC-4umvA: undetectable 3n2oD-4umvA: undetectable	3n2oC-4umvA: 21.35 3n2oD-4umvA: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NBQ_A_URFA400_1 (URIDINE PHOSPHORYLASE 1)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 9	THR A 678 GLY A 428 LEU A 424 LEU A 427 ILE A 418	None	1.43A	3nbqA-4umvA: 2.7	3nbqA-4umvA: 18.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NBQ_D_URFD400_1 (URIDINE PHOSPHORYLASE 1)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 9	THR A 678 GLY A 428 LEU A 424 LEU A 427 ILE A 418	None	1.49A	3nbqD-4umvA: 2.8	3nbqD-4umvA: 18.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SPK_B_TPVB100_2 (HIV-1 PROTEASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 403 VAL A 721 ILE A 398 ILE A 347 THR A 687	None	1.00A	3spkB-4umvA: undetectable	3spkB-4umvA: 10.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UQ6_B_ADNB401_2 (ADENOSINE KINASE, PUTATIVE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 5	LEU A 597 GLY A 598 PHE A 435 ASN A 573	None	1.14A	3uq6B-4umvA: undetectable	3uq6B-4umvA: 20.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4H1N_A_CGEA505_1 (CYTOCHROME P450 2B4)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	ILE A 672 ILE A 641 LEU A 660 VAL A 430 VAL A 577	None	1.00A	4h1nA-4umvA: undetectable	4h1nA-4umvA: 20.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NKV_C_AERC601_2 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 6	LEU A 330 GLU A 335 VAL A 611 ALA A 635	None	1.12A	4nkvC-4umvA: undetectable	4nkvC-4umvA: 22.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	THR A 159 ALA A 201 THR A 200 ALA A 199	None	1.01A	4qw0K-4umvA: undetectable	4qw0K-4umvA: 16.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW0_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	THR A 159 ALA A 201 THR A 200 ALA A 199	None	1.00A	4qw0Y-4umvA: undetectable	4qw0Y-4umvA: 16.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4URN_A_NOVA2000_1 (DNA TOPOISOMERASE IV, B SUBUNIT)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	SER A 285 GLU A 284 ASP A 283 ARG A 296 ILE A 326	None	1.37A	4urnA-4umvA: undetectable	4urnA-4umvA: 15.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XE5_A_OBNA1104_1 (SODIUM/POTASSIUM-TRA NSPORTING ATPASE SUBUNIT ALPHA-1)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	GLU A 284 GLU A 290 ASP A 585 GLY A 444 ILE A 593	None	1.27A	4xe5A-4umvA: 24.9	4xe5A-4umvA: 24.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YB6_C_HISC302_0 (ATP PHOSPHORIBOSYLTRANSF ERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	GLY A 273 VAL A 317 GLU A 316 THR A 314 LEU A 276	None	1.32A	4yb6C-4umvA: undetectable 4yb6F-4umvA: undetectable	4yb6C-4umvA: 19.28 4yb6F-4umvA: 19.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YB6_D_HISD302_0 (ATP PHOSPHORIBOSYLTRANSF ERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	LEU A 276 GLY A 273 VAL A 317 GLU A 316 THR A 314	None	1.33A	4yb6A-4umvA: undetectable 4yb6D-4umvA: undetectable	4yb6A-4umvA: 19.28 4yb6D-4umvA: 19.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YB6_E_HISE302_0 (ATP PHOSPHORIBOSYLTRANSF ERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	LEU A 276 GLY A 273 VAL A 317 GLU A 316 THR A 314	None	1.31A	4yb6D-4umvA: undetectable 4yb6E-4umvA: undetectable	4yb6D-4umvA: 19.28 4yb6E-4umvA: 19.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 7	ASP A 283 GLY A 305 THR A 649 ARG A 296	None	0.97A	5btfA-4umvA: undetectable 5btfB-4umvA: undetectable 5btfC-4umvA: undetectable	5btfA-4umvA: 21.63 5btfB-4umvA: 17.40 5btfC-4umvA: 21.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEU_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eeuF-4umvA: undetectable 5eeuG-4umvA: undetectable	5eeuF-4umvA: 7.07 5eeuG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEU_I_TRPI101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eeuI-4umvA: undetectable 5eeuJ-4umvA: undetectable	5eeuI-4umvA: 7.07 5eeuJ-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eevF-4umvA: undetectable 5eevG-4umvA: undetectable	5eevF-4umvA: 7.07 5eevG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_I_TRPI101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eevI-4umvA: undetectable 5eevJ-4umvA: undetectable	5eevI-4umvA: 7.07 5eevJ-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5eewF-4umvA: undetectable 5eewG-4umvA: undetectable	5eewF-4umvA: 7.07 5eewG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_I_TRPI101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eewI-4umvA: undetectable 5eewJ-4umvA: undetectable	5eewI-4umvA: 7.07 5eewJ-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEX_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.03A	5eexF-4umvA: undetectable 5eexG-4umvA: undetectable	5eexF-4umvA: 7.07 5eexG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEY_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5eeyF-4umvA: undetectable 5eeyG-4umvA: undetectable	5eeyF-4umvA: 7.07 5eeyG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5eezF-4umvA: undetectable 5eezG-4umvA: undetectable	5eezF-4umvA: 7.07 5eezG-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	THR A 442 GLY A 289 ALA A 589 THR A 583	None BEF A1732 (-3.0A) None BEF A1732 (-4.2A)	0.81A	5eezL-4umvA: undetectable 5eezV-4umvA: undetectable	5eezL-4umvA: 7.07 5eezV-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF0_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5ef0F-4umvA: undetectable 5ef0G-4umvA: undetectable	5ef0F-4umvA: 7.07 5ef0G-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5ef1F-4umvA: undetectable 5ef1G-4umvA: undetectable	5ef1F-4umvA: 7.07 5ef1G-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	THR A 442 GLY A 289 ALA A 589 THR A 583	None BEF A1732 (-3.0A) None BEF A1732 (-4.2A)	0.80A	5ef1L-4umvA: undetectable 5ef1V-4umvA: undetectable	5ef1L-4umvA: 7.07 5ef1V-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5ef2F-4umvA: undetectable 5ef2G-4umvA: undetectable	5ef2F-4umvA: 7.07 5ef2G-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_L_TRPL101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	4 / 8	THR A 442 GLY A 289 ALA A 589 THR A 583	None BEF A1732 (-3.0A) None BEF A1732 (-4.2A)	0.80A	5ef2L-4umvA: undetectable 5ef2V-4umvA: undetectable	5ef2L-4umvA: 7.07 5ef2V-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF3_F_TRPF101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 10	ALA A 589 GLY A 289 ALA A 590 THR A 442 THR A 438	None BEF A1732 (-3.0A) None None BEF A1732 ( 3.7A)	1.04A	5ef3F-4umvA: undetectable 5ef3G-4umvA: undetectable	5ef3F-4umvA: 7.07 5ef3G-4umvA: 7.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKT_B_TLFB601_0 (PROSTAGLANDIN G/H SYNTHASE 2)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	VAL A 228 MET A 625 GLY A 627 ALA A 644 LEU A 653	None	1.34A	5iktB-4umvA: undetectable	5iktB-4umvA: 19.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JMN_C_FUAC1101_1 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	3 / 3	VAL A 542 HIS A 523 VAL A 551	None	0.68A	5jmnC-4umvA: undetectable	5jmnC-4umvA: 24.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0O_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357	None	0.95A	5n0oA-4umvA: 2.7	5n0oA-4umvA: 23.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0O_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357	None	0.96A	5n0oB-4umvA: undetectable	5n0oB-4umvA: 23.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0R_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 PHE A 350 ALA A 357 MET A 359	None	0.99A	5n0rA-4umvA: undetectable	5n0rA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0R_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 206 ALA A 357 MET A 359	None	1.22A	5n0rA-4umvA: undetectable	5n0rA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0R_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357	None	0.97A	5n0rA-4umvA: undetectable	5n0rA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357	None	0.99A	5n0sA-4umvA: 2.4	5n0sA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 MET A 359	None	1.04A	5n0sA-4umvA: 2.4	5n0sA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.10A	5n0tA-4umvA: 2.7	5n0tA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357	None	0.97A	5n0tB-4umvA: undetectable	5n0tB-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 MET A 359	None	1.01A	5n0tB-4umvA: undetectable	5n0tB-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0W_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 206 ALA A 357 MET A 359	None	1.18A	5n0wA-4umvA: 2.6	5n0wA-4umvA: 22.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0W_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.06A	5n0wA-4umvA: 2.6	5n0wA-4umvA: 22.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0W_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.03A	5n0wB-4umvA: 2.8	5n0wB-4umvA: 22.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0X_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.05A	5n0xA-4umvA: undetectable	5n0xA-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0X_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 12	ILE A 358 GLY A 391 VAL A 206 ALA A 357 MET A 359	None	1.24A	5n0xB-4umvA: undetectable	5n0xB-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0X_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.06A	5n0xB-4umvA: undetectable	5n0xB-4umvA: 22.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N4I_A_SAMA501_0 (PEPTIDE N-METHYLTRANSFERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	6 / 12	ILE A 358 GLY A 391 VAL A 397 PHE A 350 ALA A 357 MET A 359	None	1.07A	5n4iA-4umvA: 2.3	5n4iA-4umvA: 23.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6IEY_A_CLMA401_0 (ESTERASE)	4umv	ZINC-TRANSPORTING ATPASE (Shigella sonnei)	5 / 11	ILE A 481 HIS A 475 ALA A 519 GLY A 505 ALA A 473	None	1.17A	6ieyA-4umvA: 3.2 6ieyB-4umvA: 3.3	6ieyA-4umvA: 20.58 6ieyB-4umvA: 20.58

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_T_TRPT81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"GLY A 289;ALA A 589;THR A 583;THR A 442","BEF A1732 (-3.0A);None;BEF A1732 (-4.2A);None","0.77A","1c9sT-4umvA:undetectable;1c9sU-4umvA:undetectable","1c9sT-4umvA:7.07;1c9sU-4umvA:7.07"],["1E7A_A_PFLA4001_1","SERUM ALBUMIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"LEU A 531;ILE A 532;LEU A 462;VAL A 551;ALA A 525","None","1.21A","1e7aA-4umvA:undetectable","1e7aA-4umvA:24.48"],["1EIZ_A_SAMA301_0","FTSJ","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 224;GLY A 407;GLY A 421;GLY A 420;LEU A 729","None","0.90A","1eizA-4umvA:3.1","1eizA-4umvA:13.79"],["1EJ0_A_SAMA301_0","FTSJ","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 224;GLY A 407;GLY A 421;GLY A 420;LEU A 729","None","0.89A","1ej0A-4umvA:3.1","1ej0A-4umvA:13.79"],["1G50_C_ESTC2600_1","ESTROGEN RECEPTOR","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"LEU A 207;LEU A 161;ILE A 192;GLY A 193;LEU A 389","None","1.28A","1g50C-4umvA:undetectable","1g50C-4umvA:14.89"],["1GS4_A_ZK5A1918_1","ANDROGEN RECEPTOR","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"LEU A 572;LEU A 575;GLY A 576;VAL A 430;LEU A 599","None","1.02A","1gs4A-4umvA:undetectable","1gs4A-4umvA:16.35"],["1GTF_L_TRPL81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"GLY A 289;ALA A 589;THR A 583;THR A 442","BEF A1732 (-3.0A);None;BEF A1732 (-4.2A);None","0.77A","1gtfL-4umvA:undetectable;1gtfM-4umvA:undetectable","1gtfL-4umvA:7.07;1gtfM-4umvA:7.07"],["1GTF_N_TRPN81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"GLY A 289;ALA A 589;THR A 583;THR A 442","BEF A1732 (-3.0A);None;BEF A1732 (-4.2A);None","0.78A","1gtfN-4umvA:undetectable;1gtfO-4umvA:undetectable","1gtfN-4umvA:7.07;1gtfO-4umvA:7.07"],["1GTN_I_TRPI81_0","TRP RNA-BINDING ATTENUATION PROTEIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","1gtnH-4umvA:undetectable;1gtnI-4umvA:undetectable","1gtnH-4umvA:7.07;1gtnI-4umvA:7.07"],["1MT1_A_AG2A7005_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 269;ASP A 272;LEU A 318;ARG A 328","None","0.86A","1mt1A-4umvA:undetectable;1mt1F-4umvA:undetectable","1mt1A-4umvA:4.92;1mt1F-4umvA:8.95"],["1MT1_B_AG2B7001_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"ARG A 328;LEU A 269;ASP A 272;LEU A 318","None","0.91A","1mt1B-4umvA:undetectable;1mt1C-4umvA:undetectable","1mt1B-4umvA:8.95;1mt1C-4umvA:4.92"],["1MT1_G_AG2G7003_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 269;ASP A 272;LEU A 318;ARG A 328","None","0.90A","1mt1G-4umvA:undetectable;1mt1J-4umvA:undetectable","1mt1G-4umvA:4.92;1mt1J-4umvA:8.95"],["1MT1_K_AG2K7002_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"ARG A 328;LEU A 269;ASP A 272;LEU A 318","None","0.89A","1mt1H-4umvA:undetectable;1mt1K-4umvA:undetectable","1mt1H-4umvA:8.95;1mt1K-4umvA:4.92"],["1N13_H_AG2H7012_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"ARG A 328;LEU A 269;ASP A 272;LEU A 318","None","0.85A","1n13H-4umvA:undetectable;1n13K-4umvA:undetectable","1n13H-4umvA:8.95;1n13K-4umvA:4.92"],["1N13_J_AG2J7013_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 269;ASP A 272;LEU A 318;ARG A 328","None","0.89A","1n13G-4umvA:undetectable;1n13J-4umvA:undetectable","1n13G-4umvA:4.92;1n13J-4umvA:8.95"],["1N13_L_AG2L7014_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 269;ASP A 272;LEU A 318;ARG A 328","None","0.86A","1n13I-4umvA:undetectable;1n13L-4umvA:undetectable","1n13I-4umvA:4.92;1n13L-4umvA:8.95"],["1PK7_C_ADNC1247_1","PURINE NUCLEOSIDE PHOSPHORYLASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"SER A 319;GLY A 322;GLU A 320;SER A 324;ASP A 327","None","1.45A","1pk7C-4umvA:undetectable","1pk7C-4umvA:16.25"],["1PK9_B_2FAB307_1","PURINE NUCLEOSIDE PHOSPHORYLASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"SER A 319;GLY A 322;GLU A 320;SER A 324;ASP A 327","None","1.43A","1pk9B-4umvA:2.2","1pk9B-4umvA:16.25"],["2BYO_A_LNLA1217_1","LIPOPROTEIN LPPX","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"VAL A 614;LEU A 427;ILE A 672;LEU A 668","None","0.76A","2byoA-4umvA:undetectable","2byoA-4umvA:17.17"],["2J0D_A_ERYA1498_0","CYTOCHROME P450 3A4","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 643;ILE A 641;ALA A 423;ALA A 221;ARG A 223","None","1.20A","2j0dA-4umvA:undetectable","2j0dA-4umvA:21.49"],["2Y7H_B_SAMB530_0","TYPE I RESTRICTION ENZYME ECOKI M PROTEIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"THR A 583;ILE A 581;GLY A 439;THR A 440;LEU A 477","BEF A1732 (-4.2A);None; MG A1731 ( 4.6A);None;None","0.97A","2y7hB-4umvA:undetectable","2y7hB-4umvA:19.81"],["2Y7H_C_SAMC530_0","TYPE I RESTRICTION ENZYME ECOKI M PROTEIN","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"THR A 583;ILE A 581;GLY A 439;THR A 440;LEU A 477","BEF A1732 (-4.2A);None; MG A1731 ( 4.6A);None;None","0.97A","2y7hC-4umvA:undetectable","2y7hC-4umvA:19.81"],["3DOU_A_SAMA1_0","RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 224;GLY A 407;GLY A 421;GLY A 420;ALA A 410","None","0.87A","3douA-4umvA:undetectable","3douA-4umvA:14.73"],["3G88_A_SAMA303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.04A","3g88A-4umvA:undetectable","3g88A-4umvA:20.96"],["3G88_B_SAMB303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.03A","3g88B-4umvA:3.6","3g88B-4umvA:20.96"],["3G89_A_SAMA303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.02A","3g89A-4umvA:undetectable","3g89A-4umvA:20.96"],["3G89_B_SAMB303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.02A","3g89B-4umvA:undetectable","3g89B-4umvA:20.96"],["3G8B_A_SAMA303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.02A","3g8bA-4umvA:undetectable","3g8bA-4umvA:20.96"],["3G8B_B_SAMB303_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE G","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 627;GLY A 629;ASP A 628;THR A 438;ALA A 635","None; MG A1731 (-4.1A); MG A1731 ( 1.1A);BEF A1732 ( 3.7A);None","1.00A","3g8bB-4umvA:undetectable","3g8bB-4umvA:20.96"],["3ILU_B_HFZB800_1","GLUTAMATE RECEPTOR 2;GLUTAMATE RECEPTOR 2","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"PRO A 476;LEU A 557;ILE A 292;PRO A 293;SER A 285","None","1.33A","3iluB-4umvA:undetectable;3iluE-4umvA:undetectable","3iluB-4umvA:16.67;3iluE-4umvA:16.67"],["3JUS_A_ECLA600_1","LANOSTEROL 14-ALPHA DEMETHYLASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 660;THR A 661;GLY A 227;ALA A 224","None","0.77A","3jusA-4umvA:undetectable","3jusA-4umvA:19.87"],["3JUS_A_ECNA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 660;THR A 661;GLY A 227;ALA A 224","None","0.77A","3jusA-4umvA:undetectable","3jusA-4umvA:19.87"],["3N2O_C_AG2C1002_1","BIOSYNTHETIC ARGININE DECARBOXYLASE;BIOSYNTHETIC ARGININE DECARBOXYLASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"SER A 285;ASP A 559;ASP A 628;ASP A 436","None;None; MG A1731 ( 1.1A);BEF A1732 ( 2.0A)","0.91A","3n2oC-4umvA:undetectable;3n2oD-4umvA:undetectable","3n2oC-4umvA:21.35;3n2oD-4umvA:21.35"],["3NBQ_A_URFA400_1","URIDINE PHOSPHORYLASE 1","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"THR A 678;GLY A 428;LEU A 424;LEU A 427;ILE A 418","None","1.43A","3nbqA-4umvA:2.7","3nbqA-4umvA:18.39"],["3NBQ_D_URFD400_1","URIDINE PHOSPHORYLASE 1","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"THR A 678;GLY A 428;LEU A 424;LEU A 427;ILE A 418","None","1.49A","3nbqD-4umvA:2.8","3nbqD-4umvA:18.39"],["3SPK_B_TPVB100_2","HIV-1 PROTEASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 403;VAL A 721;ILE A 398;ILE A 347;THR A 687","None","1.00A","3spkB-4umvA:undetectable","3spkB-4umvA:10.22"],["3UQ6_B_ADNB401_2","ADENOSINE KINASE, PUTATIVE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 597;GLY A 598;PHE A 435;ASN A 573","None","1.14A","3uq6B-4umvA:undetectable","3uq6B-4umvA:20.40"],["4H1N_A_CGEA505_1","CYTOCHROME P450 2B4","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 672;ILE A 641;LEU A 660;VAL A 430;VAL A 577","None","1.00A","4h1nA-4umvA:undetectable","4h1nA-4umvA:20.29"],["4NKV_C_AERC601_2","STEROID 17-ALPHA-HYDROXYLASE\/17,20 LYASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"LEU A 330;GLU A 335;VAL A 611;ALA A 635","None","1.12A","4nkvC-4umvA:undetectable","4nkvC-4umvA:22.73"],["4QW0_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"THR A 159;ALA A 201;THR A 200;ALA A 199","None","1.01A","4qw0K-4umvA:undetectable","4qw0K-4umvA:16.01"],["4QW0_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"THR A 159;ALA A 201;THR A 200;ALA A 199","None","1.00A","4qw0Y-4umvA:undetectable","4qw0Y-4umvA:16.01"],["4URN_A_NOVA2000_1","DNA TOPOISOMERASE IV, B SUBUNIT","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"SER A 285;GLU A 284;ASP A 283;ARG A 296;ILE A 326","None","1.37A","4urnA-4umvA:undetectable","4urnA-4umvA:15.14"],["4XE5_A_OBNA1104_1","SODIUM\/POTASSIUM-TRANSPORTING ATPASE SUBUNIT ALPHA-1","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLU A 284;GLU A 290;ASP A 585;GLY A 444;ILE A 593","None","1.27A","4xe5A-4umvA:24.9","4xe5A-4umvA:24.09"],["4YB6_C_HISC302_0","ATP PHOSPHORIBOSYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"GLY A 273;VAL A 317;GLU A 316;THR A 314;LEU A 276","None","1.32A","4yb6C-4umvA:undetectable;4yb6F-4umvA:undetectable","4yb6C-4umvA:19.28;4yb6F-4umvA:19.28"],["4YB6_D_HISD302_0","ATP PHOSPHORIBOSYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"LEU A 276;GLY A 273;VAL A 317;GLU A 316;THR A 314","None","1.33A","4yb6A-4umvA:undetectable;4yb6D-4umvA:undetectable","4yb6A-4umvA:19.28;4yb6D-4umvA:19.28"],["4YB6_E_HISE302_0","ATP PHOSPHORIBOSYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"LEU A 276;GLY A 273;VAL A 317;GLU A 316;THR A 314","None","1.31A","4yb6D-4umvA:undetectable;4yb6E-4umvA:undetectable","4yb6D-4umvA:19.28;4yb6E-4umvA:19.28"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"ASP A 283;GLY A 305;THR A 649;ARG A 296","None","0.97A","5btfA-4umvA:undetectable;5btfB-4umvA:undetectable;5btfC-4umvA:undetectable","5btfA-4umvA:21.63;5btfB-4umvA:17.40;5btfC-4umvA:21.63"],["5EEU_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eeuF-4umvA:undetectable;5eeuG-4umvA:undetectable","5eeuF-4umvA:7.07;5eeuG-4umvA:7.07"],["5EEU_I_TRPI101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eeuI-4umvA:undetectable;5eeuJ-4umvA:undetectable","5eeuI-4umvA:7.07;5eeuJ-4umvA:7.07"],["5EEV_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eevF-4umvA:undetectable;5eevG-4umvA:undetectable","5eevF-4umvA:7.07;5eevG-4umvA:7.07"],["5EEV_I_TRPI101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eevI-4umvA:undetectable;5eevJ-4umvA:undetectable","5eevI-4umvA:7.07;5eevJ-4umvA:7.07"],["5EEW_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5eewF-4umvA:undetectable;5eewG-4umvA:undetectable","5eewF-4umvA:7.07;5eewG-4umvA:7.07"],["5EEW_I_TRPI101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eewI-4umvA:undetectable;5eewJ-4umvA:undetectable","5eewI-4umvA:7.07;5eewJ-4umvA:7.07"],["5EEX_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.03A","5eexF-4umvA:undetectable;5eexG-4umvA:undetectable","5eexF-4umvA:7.07;5eexG-4umvA:7.07"],["5EEY_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5eeyF-4umvA:undetectable;5eeyG-4umvA:undetectable","5eeyF-4umvA:7.07;5eeyG-4umvA:7.07"],["5EEZ_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5eezF-4umvA:undetectable;5eezG-4umvA:undetectable","5eezF-4umvA:7.07;5eezG-4umvA:7.07"],["5EEZ_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"THR A 442;GLY A 289;ALA A 589;THR A 583","None;BEF A1732 (-3.0A);None;BEF A1732 (-4.2A)","0.81A","5eezL-4umvA:undetectable;5eezV-4umvA:undetectable","5eezL-4umvA:7.07;5eezV-4umvA:7.07"],["5EF0_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5ef0F-4umvA:undetectable;5ef0G-4umvA:undetectable","5ef0F-4umvA:7.07;5ef0G-4umvA:7.07"],["5EF1_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5ef1F-4umvA:undetectable;5ef1G-4umvA:undetectable","5ef1F-4umvA:7.07;5ef1G-4umvA:7.07"],["5EF1_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"THR A 442;GLY A 289;ALA A 589;THR A 583","None;BEF A1732 (-3.0A);None;BEF A1732 (-4.2A)","0.80A","5ef1L-4umvA:undetectable;5ef1V-4umvA:undetectable","5ef1L-4umvA:7.07;5ef1V-4umvA:7.07"],["5EF2_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5ef2F-4umvA:undetectable;5ef2G-4umvA:undetectable","5ef2F-4umvA:7.07;5ef2G-4umvA:7.07"],["5EF2_L_TRPL101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",4,"THR A 442;GLY A 289;ALA A 589;THR A 583","None;BEF A1732 (-3.0A);None;BEF A1732 (-4.2A)","0.80A","5ef2L-4umvA:undetectable;5ef2V-4umvA:undetectable","5ef2L-4umvA:7.07;5ef2V-4umvA:7.07"],["5EF3_F_TRPF101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ALA A 589;GLY A 289;ALA A 590;THR A 442;THR A 438","None;BEF A1732 (-3.0A);None;None;BEF A1732 ( 3.7A)","1.04A","5ef3F-4umvA:undetectable;5ef3G-4umvA:undetectable","5ef3F-4umvA:7.07;5ef3G-4umvA:7.07"],["5IKT_B_TLFB601_0","PROSTAGLANDIN G\/H SYNTHASE 2","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"VAL A 228;MET A 625;GLY A 627;ALA A 644;LEU A 653","None","1.34A","5iktB-4umvA:undetectable","5iktB-4umvA:19.15"],["5JMN_C_FUAC1101_1","MULTIDRUG EFFLUX PUMP SUBUNIT ACRB","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",3,"VAL A 542;HIS A 523;VAL A 551","None","0.68A","5jmnC-4umvA:undetectable","5jmnC-4umvA:24.51"],["5N0O_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357","None","0.95A","5n0oA-4umvA:2.7","5n0oA-4umvA:23.32"],["5N0O_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357","None","0.96A","5n0oB-4umvA:undetectable","5n0oB-4umvA:23.32"],["5N0R_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;PHE A 350;ALA A 357;MET A 359","None","0.99A","5n0rA-4umvA:undetectable","5n0rA-4umvA:22.94"],["5N0R_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 206;ALA A 357;MET A 359","None","1.22A","5n0rA-4umvA:undetectable","5n0rA-4umvA:22.94"],["5N0R_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357","None","0.97A","5n0rA-4umvA:undetectable","5n0rA-4umvA:22.94"],["5N0S_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357","None","0.99A","5n0sA-4umvA:2.4","5n0sA-4umvA:22.94"],["5N0S_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;MET A 359","None","1.04A","5n0sA-4umvA:2.4","5n0sA-4umvA:22.94"],["5N0T_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.10A","5n0tA-4umvA:2.7","5n0tA-4umvA:22.94"],["5N0T_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357","None","0.97A","5n0tB-4umvA:undetectable","5n0tB-4umvA:22.94"],["5N0T_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;MET A 359","None","1.01A","5n0tB-4umvA:undetectable","5n0tB-4umvA:22.94"],["5N0W_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 206;ALA A 357;MET A 359","None","1.18A","5n0wA-4umvA:2.6","5n0wA-4umvA:22.77"],["5N0W_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.06A","5n0wA-4umvA:2.6","5n0wA-4umvA:22.77"],["5N0W_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.03A","5n0wB-4umvA:2.8","5n0wB-4umvA:22.77"],["5N0X_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.05A","5n0xA-4umvA:undetectable","5n0xA-4umvA:22.94"],["5N0X_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 358;GLY A 391;VAL A 206;ALA A 357;MET A 359","None","1.24A","5n0xB-4umvA:undetectable","5n0xB-4umvA:22.94"],["5N0X_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.06A","5n0xB-4umvA:undetectable","5n0xB-4umvA:22.94"],["5N4I_A_SAMA501_0","PEPTIDE N-METHYLTRANSFERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",6,"ILE A 358;GLY A 391;VAL A 397;PHE A 350;ALA A 357;MET A 359","None","1.07A","5n4iA-4umvA:2.3","5n4iA-4umvA:23.45"],["6IEY_A_CLMA401_0","ESTERASE","4umv","ZINC-TRANSPORTING ATPASE","Shigella sonnei",5,"ILE A 481;HIS A 475;ALA A 519;GLY A 505;ALA A 473","None","1.17A","6ieyA-4umvA:3.2;6ieyB-4umvA:3.3","6ieyA-4umvA:20.58;6ieyB-4umvA:20.58"]]