SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5a22'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AFS_A_TESA325_1 (3-ALPHA-HYDROXYSTERO ID DEHYDROGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	LEU A 558 TYR A 557 THR A 504 ASN A1331	None	0.92A	1afsA-5a22A: undetectable	1afsA-5a22A: 9.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AFS_B_TESB325_1 (3-ALPHA-HYDROXYSTERO ID DEHYDROGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	LEU A 558 TYR A 557 THR A 504 ASN A1331	None	0.92A	1afsB-5a22A: undetectable	1afsB-5a22A: 9.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E06_B_IPBB600_0 (ODORANT-BINDING PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	ILE A 238 MET A 233 VAL A 275 GLY A 240	None	1.23A	1e06B-5a22A: undetectable	1e06B-5a22A: 6.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1EE2_B_CHDB1250_0 (ALCOHOL DEHYDROGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	MET A1198 LEU A1201 SER A1202	None	0.67A	1ee2A-5a22A: undetectable	1ee2A-5a22A: 10.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FDS_A_ESTA350_1 (17-BETA-HYDROXYSTERO ID-DEHYDROGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	SER A 206 VAL A 204 LEU A 167 GLY A 208 PRO A 209	None	1.23A	1fdsA-5a22A: 8.3	1fdsA-5a22A: 9.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1J96_A_TESA903_1 (3ALPHA-HYDROXYSTEROI D DEHYDROGENASE TYPE 3)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	VAL A 350 ILE A 351 TRP A 358 LEU A 534	None	1.10A	1j96A-5a22A: undetectable	1j96A-5a22A: 9.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KQW_A_RTLA135_0 (CELLULAR RETINOL-BINDING PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	MET A1836 THR A1741 ARG A1779 LEU A1667 ILE A1759	None	1.26A	1kqwA-5a22A: undetectable	1kqwA-5a22A: 5.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KT3_A_RTLA184_0 (PLASMA RETINOL-BINDING PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	LEU A 693 LEU A 691 TYR A 606 GLN A 716	None	1.11A	1kt3A-5a22A: undetectable	1kt3A-5a22A: 5.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PKV_A_RBFA100_1 (RIBOFLAVIN SYNTHASE ALPHA CHAIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	CYH A1413 LEU A1529 THR A1526 ILE A1417 VAL A1416	None	1.19A	1pkvA-5a22A: undetectable 1pkvB-5a22A: undetectable	1pkvA-5a22A: 3.92 1pkvB-5a22A: 3.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PKV_B_RBFB101_1 (RIBOFLAVIN SYNTHASE ALPHA CHAIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	ILE A1417 VAL A1416 CYH A1413 LEU A1529 THR A1526	None	1.19A	1pkvA-5a22A: undetectable 1pkvB-5a22A: undetectable	1pkvA-5a22A: 3.92 1pkvB-5a22A: 3.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_A_SAMA801_0 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 772 ALA A 301 GLY A 784 GLY A 589 LEU A 584	None	1.06A	1rjdA-5a22A: 8.4	1rjdA-5a22A: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_B_SAMB802_0 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 772 ALA A 301 GLY A 784 GLY A 589 LEU A 584	None	1.06A	1rjdB-5a22A: 8.4	1rjdB-5a22A: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_C_SAMC803_0 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 772 ALA A 301 GLY A 784 GLY A 589 LEU A 584	None	1.07A	1rjdC-5a22A: 8.4	1rjdC-5a22A: 9.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S2A_A_IMNA2001_1 (ALDO-KETO REDUCTASE FAMILY 1 MEMBER C3)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	TYR A1863 LEU A1636 GLU A1869 SER A1867 GLN A1866	None	1.45A	1s2aA-5a22A: undetectable	1s2aA-5a22A: 9.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TW4_A_CHDA130_0 (FATTY ACID-BINDING PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	LEU A 231 ILE A 212 THR A 210 ILE A  54 LEU A  53	None	1.12A	1tw4A-5a22A: undetectable	1tw4A-5a22A: 5.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UDU_A_CIAA1003_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	SER A 891 ILE A 122 VAL A 126 LEU A 892 MET A 833	None	1.26A	1uduA-5a22A: undetectable	1uduA-5a22A: 9.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Y7I_A_SALA502_1 (SALICYLIC ACID-BINDING PROTEIN 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	LEU A 162 HIS A 165 LYS A 166	None	1.08A	1y7iA-5a22A: 2.1	1y7iA-5a22A: 8.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YA3_A_STRA1001_2 (MINERALOCORTICOID RECEPTOR)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	LEU A2056 LEU A1932 SER A1931 LEU A1927	None	1.14A	1ya3A-5a22A: undetectable	1ya3A-5a22A: 8.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1YC5_A_NCAA2001_0 (NAD-DEPENDENT DEACETYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	SER A1771 ILE A1774 ASN A1807 ILE A1811	None	0.89A	1yc5A-5a22A: 2.6	1yc5A-5a22A: 8.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BR4_E_SAME301_1 (CEPHALOSPORIN HYDROXYLASE CMCI)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	SER A1515 ASP A1372 CYH A1414	None	0.97A	2br4E-5a22A: 9.0	2br4E-5a22A: 7.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2C8A_A_NCAA1252_0 (MONO-ADP-RIBOSYLTRAN SFERASE C3)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	ARG A1221 SER A1187 PHE A1219 GLN A1216	None	1.13A	2c8aA-5a22A: undetectable	2c8aA-5a22A: 6.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIM_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ARG A1215 MET A1198 THR A1199 LEU A1201	None	1.34A	2eimJ-5a22A: undetectable	2eimJ-5a22A: 2.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EJT_A_SAMA501_1 (N(2),N(2)-DIMETHYLGU ANOSINE TRNA METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ARG A 728 ASP A2023 ASP A2018	None	0.88A	2ejtA-5a22A: 8.0	2ejtA-5a22A: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F9W_A_PAUA6002_0 (PANTOTHENATE KINASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	ARG A 241 THR A 791 GLY A 240 ASP A 236	None	0.97A	2f9wA-5a22A: 2.8 2f9wB-5a22A: 2.5	2f9wA-5a22A: 8.60 2f9wB-5a22A: 8.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HJH_A_NCAA900_0 (NAD-DEPENDENT HISTONE DEACETYLASE SIR2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ILE A 811 PHE A 842 PHE A 839 ILE A 239	None	1.12A	2hjhA-5a22A: undetectable	2hjhA-5a22A: 10.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRE_D_CHDD702_0 (FERROCHELATASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ARG A1779 GLY A1813 PRO A1814	None	0.60A	2hreD-5a22A: undetectable	2hreD-5a22A: 11.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2JN3_A_JN3A130_1 (FATTY ACID-BINDING PROTEIN, LIVER)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	LEU A 231 ILE A 212 THR A 210 ILE A  54 LEU A  53	None	1.00A	2jn3A-5a22A: undetectable	2jn3A-5a22A: 5.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NNH_B_9CRB502_1 (CYTOCHROME P450 2C8)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	SER A2039 ILE A1899 LEU A1903 ASN A1898 ILE A1905	None	1.12A	2nnhB-5a22A: undetectable	2nnhB-5a22A: 12.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NYU_A_SAMA201_0 (PUTATIVE RIBOSOMAL RNA METHYLTRANSFERASE 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 LEU A1694 MET A1763 LYS A1795	None	1.03A	2nyuA-5a22A: 14.3	2nyuA-5a22A: 7.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NYU_B_SAMB201_0 (PUTATIVE RIBOSOMAL RNA METHYLTRANSFERASE 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 LEU A1694 MET A1763 LYS A1795	None	0.99A	2nyuB-5a22A: 14.3	2nyuB-5a22A: 7.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OAX_A_SNLA1001_2 (MINERALOCORTICOID RECEPTOR)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	LEU A1250 ALA A1252 TRP A2107 LEU A1273	None	1.24A	2oaxA-5a22A: undetectable	2oaxA-5a22A: 8.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OK6_H_BEZH2001_0 (AROMATIC AMINE DEHYDROGENASE, LARGE SUBUNIT AROMATIC AMINE DEHYDROGENASE, SMALL SUBUNIT)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	PHE A 842 GLN A 108 GLY A 109 LEU A 113 PHE A 161	None	1.29A	2ok6A-5a22A: undetectable 2ok6H-5a22A: undetectable	2ok6A-5a22A: 10.54 2ok6H-5a22A: 5.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OXT_C_SAMC300_0 (NUCLEOSIDE-2'-O-METH YLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1762 LYS A1795	None	0.80A	2oxtC-5a22A: 13.3	2oxtC-5a22A: 8.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PXC_A_SAMA500_0 (GENOME POLYPROTEIN [CONTAINS: CAPSID PROTEIN C (CORE PROTEIN) ENVELOPE PROTEIN M (MATRIX PROTEIN) MAJOR ENVELOPE PROTEIN E NON-STRUCTURAL PROTEIN 1 (NS1) NON-STRUCTURAL PROTEIN 2A (NS2A) FLAVIVIRIN PROTEASE NS2B REGULATORY SUBUNIT FLAVIVIRIN PROTEASE NS3 CATALYTIC SUBUNIT NON-STRUCTURAL PROTEIN 4A (NS4A) NON-STRUCTURAL PROTEIN 4B (NS4B) RNA-DIRECTED RNA POLYMERASE (EC 2.7.7.48) (NS5)])	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.89A	2pxcA-5a22A: 12.5	2pxcA-5a22A: 8.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QL8_B_BEZB143_0 (PUTATIVE REDOX PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ARG A1115 THR A1280 ALA A1283 ARG A1284	None	1.40A	2ql8A-5a22A: 2.4 2ql8B-5a22A: 2.1	2ql8A-5a22A: 5.31 2ql8B-5a22A: 5.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX4_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	ILE A 525 PHE A 552 GLY A 678 GLY A 679	None	0.82A	2qx4A-5a22A: 2.3 2qx4B-5a22A: 2.4	2qx4A-5a22A: 7.94 2qx4B-5a22A: 7.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QX6_A_ML1A233_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ILE A 525 PHE A 552 GLY A 678 GLY A 679	None	0.81A	2qx6A-5a22A: 2.3 2qx6B-5a22A: 2.4	2qx6A-5a22A: 7.94 2qx6B-5a22A: 7.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2UXO_B_TACB1211_1 (HTH-TYPE TRANSCRIPTIONAL REGULATOR TTGR)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	LEU A1175 VAL A1025 LEU A 495 VAL A 984 ILE A 985	None	1.13A	2uxoB-5a22A: undetectable	2uxoB-5a22A: 6.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0M_D_KLND1499_1 (CYTOCHROME P450 3A4)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	PHE A1449 SER A1711 PHE A1488 ILE A1469	None	0.93A	2v0mD-5a22A: undetectable	2v0mD-5a22A: 12.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VDB_A_NPSA1591_1 (SERUM ALBUMIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	ILE A1661 LEU A1758 TYR A1835 GLY A1790	None	0.93A	2vdbA-5a22A: undetectable	2vdbA-5a22A: 13.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XNR_A_ACTA1001_0 (NUCLEAR POLYADENYLATED RNA-BINDING PROTEIN 3)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	SER A1995 ARG A2025 GLN A1994	None	0.78A	2xnrA-5a22A: 1.9	2xnrA-5a22A: 4.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A50_B_VD3B2001_1 (VITAMIN D HYDROXYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	THR A1741 ILE A1774 LEU A1667 ASN A1725 ILE A1759	None	1.38A	3a50B-5a22A: undetectable	3a50B-5a22A: 11.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A50_E_VD3E2001_1 (VITAMIN D HYDROXYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A1741 ILE A1774 LEU A1667 ASN A1725 ILE A1759	None	1.28A	3a50E-5a22A: 2.7	3a50E-5a22A: 11.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG2_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ARG A1215 MET A1198 THR A1199 LEU A1201	None	1.34A	3ag2J-5a22A: undetectable	3ag2J-5a22A: 2.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BWM_A_SAMA301_1 (CATECHOL O-METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	SER A1323 GLU A 995 ASP A 987	None	0.67A	3bwmA-5a22A: 11.1	3bwmA-5a22A: 7.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BWY_A_SAMA301_1 (COMT PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	SER A1323 GLU A 995 ASP A 987	None	0.73A	3bwyA-5a22A: 11.1	3bwyA-5a22A: 8.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_F_SAMF300_0 (PUTATIVE RRNA METHYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A 767 ASN A 715 ASP A 605 ILE A 600 LEU A 774	None	1.17A	3eeyF-5a22A: 5.9	3eeyF-5a22A: 6.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_I_SAMI300_0 (PUTATIVE RRNA METHYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A 767 ASN A 715 ASP A 605 ILE A 600 LEU A 774	None	1.18A	3eeyI-5a22A: 10.5	3eeyI-5a22A: 6.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ELZ_C_CHDC150_0 (ILEAL BILE ACID-BINDING PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A 638 PHE A 552 LEU A 646 ILE A 525 GLN A 676	None	1.28A	3elzC-5a22A: undetectable	3elzC-5a22A: 5.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FRQ_B_ERYB195_1 (REPRESSOR PROTEIN MPHR(A))	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 7	ASN A1684 TYR A1663 ARG A1603 HIS A1649 ALA A1679	None	1.29A	3frqB-5a22A: undetectable	3frqB-5a22A: 6.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FRQ_B_ERYB195_1 (REPRESSOR PROTEIN MPHR(A))	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	TYR A1663 ARG A1606 HIS A1649 ALA A1679	None	1.10A	3frqB-5a22A: undetectable	3frqB-5a22A: 6.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G4L_D_ROFD904_1 (CAMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE 4D)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ASN A1725 MET A1761 PHE A1745	None	1.15A	3g4lD-5a22A: undetectable	3g4lD-5a22A: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3GCZ_A_SAMA4633_0 (POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.81A	3gczA-5a22A: 11.9	3gczA-5a22A: 8.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IJX_B_HCZB800_1 (GLUTAMATE RECEPTOR 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	SER A1093 ILE A 884 PRO A 933 SER A 952 GLY A 885	None	1.36A	3ijxB-5a22A: undetectable 3ijxD-5a22A: undetectable	3ijxB-5a22A: 8.17 3ijxD-5a22A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IK6_B_HCZB262_1 (GLUTAMATE RECEPTOR 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	ILE A 884 PRO A 933 SER A 952 GLY A 885 SER A1093	None	1.33A	3ik6B-5a22A: undetectable 3ik6E-5a22A: undetectable	3ik6B-5a22A: 8.17 3ik6E-5a22A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ILU_B_HFZB800_1 (GLUTAMATE RECEPTOR 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	SER A1093 ILE A 884 PRO A 933 SER A 952 GLY A 885	None	1.32A	3iluB-5a22A: undetectable 3iluE-5a22A: undetectable	3iluB-5a22A: 8.17 3iluE-5a22A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ILU_E_HFZE800_1 (GLUTAMATE RECEPTOR 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	ILE A 884 PRO A 933 SER A 952 GLY A 885 SER A1093	None	1.32A	3iluB-5a22A: undetectable 3iluE-5a22A: undetectable	3iluB-5a22A: 8.17 3iluE-5a22A: 8.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3M6V_B_SAMB465_0 (RRNA METHYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	6 / 12	ALA A 387 GLY A 754 LYS A 757 ASP A 393 ARG A 698 ASP A 383	None	1.40A	3m6vB-5a22A: 7.9	3m6vB-5a22A: 12.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P97_A_SAMA263_0 (NON-STRUCTURAL PROTEIN 5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.82A	3p97A-5a22A: 12.3	3p97A-5a22A: 9.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P97_C_SAMC263_0 (NON-STRUCTURAL PROTEIN 5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.72A	3p97C-5a22A: 12.2	3p97C-5a22A: 9.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3Q87_B_SAMB300_0 (N6 ADENINE SPECIFIC DNA METHYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A 197 ILE A 199 LEU A 169 ASN A 172 ASN A 198	None	1.09A	3q87B-5a22A: 9.3	3q87B-5a22A: 6.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RV5_A_DXCA91_0 (TROPONIN C, SLOW SKELETAL AND CARDIAC MUSCLES)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	PHE A 642 GLN A 674 PHE A 552	None	0.80A	3rv5A-5a22A: undetectable	3rv5A-5a22A: 3.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S43_A_478A401_1 (PROTEASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	ILE A 351 GLY A 271 ILE A 274 ILE A 292 ILE A 339	None	1.00A	3s43A-5a22A: undetectable	3s43A-5a22A: 4.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S45_B_478B201_1 (PROTEASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	ILE A 351 GLY A 271 ILE A 274 ILE A 292 ILE A 339	None	0.90A	3s45A-5a22A: undetectable	3s45A-5a22A: 4.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3THR_A_C2FA1100_0 (GLYCINE N-METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	LEU A 629 HIS A 562 THR A 555 ARG A 684	None	1.30A	3thrB-5a22A: undetectable	3thrB-5a22A: 9.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UA1_A_08YA600_1 (CYTOCHROME P450 3A4)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 902 ILE A1278 THR A 905 ALA A1252 THR A1254	None	1.30A	3ua1A-5a22A: 1.3	3ua1A-5a22A: 13.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UBO_B_ADNB353_2 (ADENOSINE KINASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ILE A1892 TYR A1650 GLY A1886 PRO A1888	None	1.03A	3uboB-5a22A: 3.4	3uboB-5a22A: 10.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VAS_B_ADNB401_2 (PUTATIVE ADENOSINE KINASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	LEU A1273 ALA A1276 MET A1257 THR A1254	None	1.40A	3vasB-5a22A: undetectable	3vasB-5a22A: 10.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VKX_A_T3A301_1 (PROLIFERATING CELL NUCLEAR ANTIGEN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	MET A1109 LEU A1110 GLN A1277 TYR A1295	None	1.47A	3vkxA-5a22A: undetectable	3vkxA-5a22A: 8.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W67_C_VIVC301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ILE A 463 LEU A1023 ILE A 985 LEU A 973 VAL A 969	None	1.13A	3w67C-5a22A: undetectable	3w67C-5a22A: 8.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W67_C_VIVC301_0 (ALPHA-TOCOPHEROL TRANSFER PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	VAL A1445 SER A1384 ALA A1374 ILE A1440 LEU A1408	None	1.15A	3w67C-5a22A: undetectable	3w67C-5a22A: 8.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_C_W9TC1005_1 (HEMOLYTIC LECTIN CEL-III)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ASP A 383 GLY A 756 TYR A 386	None	0.80A	3w9tC-5a22A: undetectable	3w9tC-5a22A: 10.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WRI_A_CAMA502_0 (CAMPHOR 5-MONOOXYGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	LEU A2073 GLY A2078 ILE A1938 VAL A1964	None	0.87A	3wriA-5a22A: undetectable	3wriA-5a22A: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WRI_B_CAMB502_0 (CAMPHOR 5-MONOOXYGENASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	LEU A2073 GLY A2078 ILE A1938 VAL A1964	None	0.87A	3wriB-5a22A: undetectable	3wriB-5a22A: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4B17_A_SAMA1358_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE M)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1674 GLY A1675 ASP A1762 MET A1763	None	0.79A	4b17A-5a22A: 10.9	4b17A-5a22A: 10.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BLV_B_SAMB1281_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1363 GLY A1399 LEU A1369 GLY A1371 ASP A1406	None	0.98A	4blvB-5a22A: undetectable	4blvB-5a22A: 8.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BVV_A_CPFA1081_1 (APOLIPOPROTEIN(A))	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	HIS A  92 SER A  89 THR A  88 ASP A  48 LEU A 536	None	1.03A	4bvvA-5a22A: undetectable	4bvvA-5a22A: 3.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CTJ_A_SAMA1263_0 (NON-STRUCTURAL PROTEIN 5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.81A	4ctjA-5a22A: 12.2	4ctjA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CTK_A_SAMA1263_0 (POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.82A	4ctkA-5a22A: 12.4	4ctkA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E0F_A_RBFA301_1 (RIBOFLAVIN SYNTHASE SUBUNIT ALPHA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	SER A1706 VAL A1133 ALA A1276 THR A1280 HIS A1294	None None None None ZN  A3001 (-3.1A)	1.14A	4e0fA-5a22A: undetectable	4e0fA-5a22A: 7.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E7G_A_ACTA514_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	ALA A 578 VAL A 579 ASP A 574 LEU A 710	None	1.34A	4e7gA-5a22A: undetectable	4e7gA-5a22A: 11.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FOX_A_D16A301_1 (THYMIDYLATE SYNTHASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	HIS A1227 SER A1224 ILE A1306 ASP A1087 GLY A1100	None	1.08A	4foxA-5a22A: undetectable	4foxA-5a22A: 8.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FOX_E_D16E301_1 (THYMIDYLATE SYNTHASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	HIS A1227 SER A1224 ILE A1306 ASP A1087 GLY A1100	None	1.09A	4foxE-5a22A: undetectable	4foxE-5a22A: 8.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FOX_G_D16G301_1 (THYMIDYLATE SYNTHASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	HIS A1227 SER A1224 ILE A1306 ASP A1087 GLY A1100	None	1.10A	4foxG-5a22A: undetectable	4foxG-5a22A: 8.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4I41_A_MIXA501_1 (SERINE/THREONINE-PRO TEIN KINASE PIM-1)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A 504 ASP A 522 ASP A 519 GLU A 512 GLU A 515	None	1.40A	4i41A-5a22A: undetectable	4i41A-5a22A: 8.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_0 (S-ADENOSYLMETHIONINE SYNTHASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	ASN A 744 ASP A 764 ASN A 602 ILE A 604	None	0.77A	4k0bA-5a22A: undetectable	4k0bA-5a22A: 11.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L7I_B_SAMB501_0 (S-ADENOSYLMETHIONINE SYNTHASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	ASN A 744 ASP A 764 ASN A 602 ILE A 604	None	0.80A	4l7iA-5a22A: undetectable	4l7iA-5a22A: 11.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L8W_G_MTXG301_1 (GAMMA-GLUTAMYL HYDROLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	PHE A 541 GLY A 368 LEU A 369 HIS A 373 GLN A 676	None	1.43A	4l8wG-5a22A: 2.3	4l8wG-5a22A: 8.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LAJ_B_ACAB512_1 (HIV-1 YU2 GP120 ENVELOPE GLYCOPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ARG A1258 GLY A1456 PRO A1388 ARG A1396	None	1.21A	4lajA-5a22A: undetectable 4lajB-5a22A: undetectable	4lajA-5a22A: 10.87 4lajB-5a22A: 10.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWX_A_ZMRA513_2 (NEURAMINIDASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ARG A2074 TRP A2070 ILE A2080	None	1.12A	4mwxA-5a22A: undetectable	4mwxA-5a22A: 10.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N49_A_SAMA601_1 (CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-M ETHYLTRANSFERASE 1)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	ASN A 136 GLY A 135 ASP A1137 ASP A1285	None	1.37A	4n49A-5a22A: 16.5	4n49A-5a22A: 12.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OR0_A_NPSA603_1 (SERUM ALBUMIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	LEU A 820 SER A1241 ARG A 793 SER A1162 LEU A 576	None	1.49A	4or0A-5a22A: undetectable	4or0A-5a22A: 14.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P65_G_IPHG101_0 (INSULIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	LEU A1069 LEU A1063 LEU A 880 CYH A 808 ALA A 876	None	1.13A	4p65B-5a22A: undetectable 4p65D-5a22A: undetectable 4p65G-5a22A: undetectable 4p65H-5a22A: undetectable	4p65B-5a22A: 1.68 4p65D-5a22A: 1.68 4p65G-5a22A: 1.07 4p65H-5a22A: 1.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QZT_A_RTLA201_1 (RETINOL-BINDING PROTEIN 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	PHE A 641 THR A 504 LEU A 634	None	0.79A	4qztA-5a22A: undetectable	4qztA-5a22A: 5.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R3A_A_RBFA402_1 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	CYH A 972 ALA A1026 ILE A1030 ILE A 980 LEU A 499	None	1.02A	4r3aA-5a22A: undetectable	4r3aA-5a22A: 10.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RTR_A_SAMA301_0 (DNA ADENINE METHYLASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	TRP A 506 GLY A1332 SER A1171 ASP A 457 PRO A 456	None	1.39A	4rtrA-5a22A: 7.9	4rtrA-5a22A: 9.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WNU_C_QDNC602_1 (CYTOCHROME P450 2D6)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	LEU A 616 PHE A 622 GLY A 759 LEU A 760 ALA A 387	None	1.23A	4wnuC-5a22A: undetectable	4wnuC-5a22A: 12.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XUD_A_SAMA303_1 (CATECHOL O-METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	SER A1323 GLU A 995 ASP A 987	None	0.76A	4xudA-5a22A: 11.1	4xudA-5a22A: 7.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z2D_F_LFXF102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B SYMMETRIZED E-SITE DNA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 4	ARG A 623 GLY A 626 GLU A 636	None	0.65A	4z2dB-5a22A: undetectable 4z2dC-5a22A: 2.4	4z2dB-5a22A: 13.38 4z2dC-5a22A: 7.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZC_A_ACTA401_0 (PROTON-GATED ION CHANNEL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ILE A 635 PHE A 622 ARG A 684 ILE A 559	None	1.38A	4zzcA-5a22A: undetectable 4zzcB-5a22A: 3.7	4zzcA-5a22A: 10.13 4zzcB-5a22A: 10.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZC_B_ACTB401_0 (PROTON-GATED ION CHANNEL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ILE A 635 PHE A 622 ARG A 684 ILE A 559	None	1.38A	4zzcB-5a22A: 3.7 4zzcC-5a22A: 3.7	4zzcB-5a22A: 10.13 4zzcC-5a22A: 10.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	SER A 466 GLY A 682 THR A 689 ARG A 549	None	1.04A	5btaA-5a22A: undetectable 5btaB-5a22A: undetectable 5btaC-5a22A: undetectable	5btaA-5a22A: 14.24 5btaB-5a22A: 8.15 5btaC-5a22A: 14.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ARG A 549 SER A 466 GLY A 682 THR A 689	None	1.08A	5btcA-5a22A: undetectable 5btcC-5a22A: undetectable 5btcD-5a22A: undetectable	5btcA-5a22A: 14.24 5btcC-5a22A: 14.24 5btcD-5a22A: 8.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	SER A 466 GLY A 682 THR A 689 ARG A 549	None	1.07A	5btcA-5a22A: undetectable 5btcB-5a22A: undetectable 5btcC-5a22A: 3.6	5btcA-5a22A: 14.24 5btcB-5a22A: 8.15 5btcC-5a22A: 14.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_F_SAMF301_0 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A1715 GLY A1718 GLY A1717 LEU A1716 GLU A1727	None	0.90A	5c0oF-5a22A: 8.8	5c0oF-5a22A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_H_SAMH301_0 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 SER A1673 GLY A1674 LEU A1736	None	0.85A	5c0oH-5a22A: 10.2	5c0oH-5a22A: 7.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DZK_2_BEZ2801_0 (ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT 1 BEZ-LEU-LEU)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	LEU A 946 ARG A1000 ILE A 943 ILE A 940	None	1.35A	5dzk2-5a22A: undetectable 5dzkM-5a22A: undetectable 5dzkN-5a22A: undetectable	5dzk2-5a22A: 1.11 5dzkM-5a22A: 6.59 5dzkN-5a22A: 6.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E26_A_PAUA602_0 (PANTOTHENATE KINASE 2, MITOCHONDRIAL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	GLU A1016 SER A1019 ARG A1178 GLY A1024	None	0.98A	5e26A-5a22A: undetectable 5e26B-5a22A: undetectable	5e26A-5a22A: 10.39 5e26B-5a22A: 10.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E9Q_A_SAMA301_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.83A	5e9qA-5a22A: 12.1	5e9qA-5a22A: 8.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E9Q_C_SAMC4000_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.72A	5e9qC-5a22A: 11.5	5e9qC-5a22A: 8.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EC8_C_SAMC4000_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.71A	5ec8C-5a22A: 12.4	5ec8C-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHG_A_SAMA301_0 (RNA-DIRECTED RNA POLYMERASE NS5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.83A	5ehgA-5a22A: 12.1	5ehgA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_A_SAMA4001_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1111 GLY A 133 ASP A 125 VAL A 126 ILE A 914	None	1.04A	5ehiA-5a22A: 12.3	5ehiA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_A_SAMA4001_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.82A	5ehiA-5a22A: 12.3	5ehiA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_C_SAMC4000_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.74A	5ehiC-5a22A: 12.5	5ehiC-5a22A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EIF_A_SAMA301_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.81A	5eifA-5a22A: 12.3	5eifA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EIF_C_SAMC4000_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.73A	5eifC-5a22A: 12.4	5eifC-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EIW_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1111 GLY A 133 ASP A 125 VAL A 126 ILE A 914	None	0.98A	5eiwA-5a22A: 12.1	5eiwA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EIW_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.80A	5eiwA-5a22A: 12.1	5eiwA-5a22A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EKX_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.81A	5ekxA-5a22A: 12.1	5ekxA-5a22A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GLM_A_ACTA613_0 (GLYCOSIDE HYDROLASE FAMILY 43)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ASP A 125 SER A 871 TYR A 875	None	0.81A	5glmA-5a22A: undetectable	5glmA-5a22A: 10.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HW8_A_FK5A201_1 (FK506-BINDING PROTEIN 1)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 11	VAL A 350 ILE A 351 ILE A 286 ILE A 239 ILE A 238	None	1.17A	5hw8A-5a22A: undetectable 5hw8D-5a22A: undetectable	5hw8A-5a22A: 5.87 5hw8D-5a22A: 5.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IEN_B_VDYB201_2 (CDL2.2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	LEU A 113 PHE A 112 LEU A 847 TYR A 838 LEU A 878	None	1.18A	5ienB-5a22A: undetectable	5ienB-5a22A: 4.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKM_A_SAMA311_0 (NS5 METHYL TRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.79A	5ikmA-5a22A: 11.3	5ikmA-5a22A: 8.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KOC_B_SAMB401_0 (PAVINE N-METHYLTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	SER A 770 GLY A 784 GLY A 589 SER A 304 GLN A 590	None	1.02A	5kocB-5a22A: 8.1	5kocB-5a22A: 10.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KPR_A_PAUA404_0 (PANTOTHENATE KINASE 3)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	GLU A1016 SER A1019 ARG A1178 GLY A1024	None	0.93A	5kprA-5a22A: undetectable	5kprA-5a22A: 10.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KQS_A_SAMA307_0 (GENOME POLYPROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.74A	5kqsA-5a22A: 12.3	5kqsA-5a22A: 8.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L1F_A_6ZPA902_1 (GLUTAMATE RECEPTOR 2)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	TYR A 991 PHE A1002 SER A1202 ASN A1203	None	1.07A	5l1fA-5a22A: undetectable 5l1fB-5a22A: undetectable	5l1fA-5a22A: 17.80 5l1fB-5a22A: 17.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M50_B_TA1B502_1 (TUBULIN BETA-2B CHAIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 575 GLU A1159 HIS A 824 GLY A1154 LEU A1274	None	1.41A	5m50B-5a22A: undetectable	5m50B-5a22A: 11.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M50_E_TA1E502_1 (TUBULIN BETA-2B CHAIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ASP A 575 GLU A1159 HIS A 824 GLY A1154 LEU A1274	None	1.37A	5m50E-5a22A: undetectable	5m50E-5a22A: 11.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N8J_E_DVAE7_0 (GLY-DTY-GLY-DLE-DAL- DSG-DVA-DAS-DGL-DSN- DSN-GLY STREPTAVIDIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	TYR A1934 SER A1913 TRP A2036	None	0.74A	5n8jB-5a22A: undetectable	5n8jB-5a22A: 7.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N8J_O_DVAO7_0 (GLY-DTY-GLY-DLE-DAL- DSG-DVA-DAS-DGL-DSN- DSN-GLY STREPTAVIDIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	TYR A1934 SER A1913 TRP A2036	None	0.76A	5n8jA-5a22A: undetectable	5n8jA-5a22A: 7.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N8J_P_DVAP5_0 (GLY-DTY-GLY-DLE-DAL- DSG-DVA-DAS-DGL-DSN- DSN-GLY STREPTAVIDIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	TYR A1934 SER A1913 TRP A2036	None	0.78A	5n8jD-5a22A: undetectable	5n8jD-5a22A: 7.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N9X_A_THRA601_0 (ADENYLATION DOMAIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	PHE A 563 PHE A 628 GLY A 626 GLY A 630	None	1.04A	5n9xA-5a22A: undetectable	5n9xA-5a22A: 12.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NFP_A_8W5A804_2 (GLUCOCORTICOID RECEPTOR)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 4	LEU A1273 MET A1257 ILE A1278 LEU A1110	None	1.36A	5nfpA-5a22A: undetectable	5nfpA-5a22A: 8.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NJV_A_SAMA301_0 (NS5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.82A	5njvA-5a22A: 12.2	5njvA-5a22A: 8.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NJV_B_SAMB301_0 (NS5)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.82A	5njvB-5a22A: 10.4	5njvB-5a22A: 8.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NUK_A_Z80A201_1 (BETA-LACTOGLOBULIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	ILE A 252 ILE A 139 VAL A 127 PHE A 124 ALA A 120	None	0.97A	5nukA-5a22A: 1.7	5nukA-5a22A: 3.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NWU_A_ACAA18_2 (WTFP-TAG,GP41)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	LEU A1694 LEU A1695 TRP A1730	None	0.93A	5nwuA-5a22A: undetectable	5nwuA-5a22A: 1.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5O96_E_SAME501_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE E)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	GLY A1647 SER A1832 VAL A1822 LEU A1821 GLN A1823	None	1.31A	5o96E-5a22A: undetectable 5o96F-5a22A: undetectable	5o96E-5a22A: 7.85 5o96F-5a22A: 7.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TIW_A_OAQA302_0 (SULFOTRANSFERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	ILE A 464 VAL A1025 ILE A 985 LEU A1032 LEU A 495	None	1.21A	5tiwA-5a22A: undetectable	5tiwA-5a22A: 8.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UC3_A_486A801_2 (GLUCOCORTICOID RECEPTOR)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	LEU A1975 LEU A1984 MET A2079 TYR A1934	None	1.37A	5uc3A-5a22A: undetectable	5uc3A-5a22A: 3.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VCE_A_RITA602_2 (CYTOCHROME P450 3A4)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 6	ARG A 623 PHE A 628 ILE A 559 THR A 555	None	1.07A	5vceA-5a22A: undetectable	5vceA-5a22A: 13.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5W97_J_CHDJ101_1 (CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ARG A1215 MET A1198 THR A1199 LEU A1201	None	1.32A	5w97J-5a22A: undetectable	5w97J-5a22A: 2.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WAU_J_CHDJ101_1 (CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ARG A1215 MET A1198 THR A1199 LEU A1201	None	1.34A	5wauJ-5a22A: undetectable	5wauJ-5a22A: 2.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WEO_A_CYZA1302_1 (GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT CHIMERA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	SER A1093 ILE A 884 PRO A 933 SER A 952 GLY A 885	None	1.23A	5weoA-5a22A: 2.5 5weoD-5a22A: 3.0	5weoA-5a22A: 19.58 5weoD-5a22A: 19.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WEO_B_CYZB1302_1 (GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT CHIMERA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	SER A1093 ILE A 884 PRO A 933 SER A 952 GLY A 885	None	1.24A	5weoB-5a22A: 0.6 5weoC-5a22A: 1.4	5weoB-5a22A: 19.58 5weoC-5a22A: 19.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WEO_D_CYZD1302_1 (GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT CHIMERA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 9	ILE A 884 PRO A 933 SER A 952 GLY A 885 SER A1093	None	1.23A	5weoA-5a22A: 2.5 5weoD-5a22A: 0.6	5weoA-5a22A: 19.58 5weoD-5a22A: 19.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WZ2_A_SAMA601_0 (NS5 MTASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.76A	5wz2A-5a22A: 11.0	5wz2A-5a22A: 8.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WZ2_B_SAMB601_0 (NS5 MTASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1672 GLY A1675 ASP A1735 ASP A1762	None	0.76A	5wz2B-5a22A: 12.4	5wz2B-5a22A: 8.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YN6_A_SAMA401_0 (NSP16 PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 ASN A1692 ASP A1735 ASP A1762	None	1.17A	5yn6A-5a22A: 12.6	5yn6A-5a22A: 9.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YNI_A_SAMA401_0 (NSP16 PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 ASN A1692 ASP A1735 ASP A1762	None	1.22A	5yniA-5a22A: 13.0	5yniA-5a22A: 9.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YNI_A_SAMA401_0 (NSP16 PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 ASN A1692 ASP A1762 MET A1763	None	1.11A	5yniA-5a22A: 13.0	5yniA-5a22A: 9.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YNM_A_SAMA401_0 (NSP16 PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 ASN A1692 ASP A1735 ASP A1762	None	1.17A	5ynmA-5a22A: 13.1	5ynmA-5a22A: 9.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YNM_A_SAMA401_0 (NSP16 PROTEIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	GLY A1670 GLY A1675 ASN A1692 ASP A1762 MET A1763	None	1.11A	5ynmA-5a22A: 13.1	5ynmA-5a22A: 9.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z86_J_CHDJ101_0 (CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 5	ARG A1215 MET A1198 THR A1199 LEU A1201	None	1.43A	5z86J-5a22A: undetectable	5z86J-5a22A: 2.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6A93_A_8NUA3001_0 (5-HYDROXYTRYPTAMINE RECEPTOR 2A,SOLUBLE CYTOCHROME B562)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	THR A1453 ILE A1458 PHE A1400 PHE A1488 TYR A1370	None	1.29A	6a93A-5a22A: 2.1	6a93A-5a22A: 10.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BEC_C_RBTC601_1 (SCAFFOLD PROTEIN D13)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	VAL A 969 PRO A1166 PHE A1033 PRO A 461 ILE A 463	None	1.33A	6becA-5a22A: undetectable 6becB-5a22A: undetectable 6becC-5a22A: undetectable	6becA-5a22A: 13.70 6becB-5a22A: 13.70 6becC-5a22A: 13.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DM0_B_CYZB1302_0 (GLUTAMATE RECEPTOR 2,VOLTAGE-DEPENDENT CALCIUM CHANNEL GAMMA-2 SUBUNIT)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 10	SER A1093 ILE A 884 PRO A 933 SER A 952 GLY A 885	None	1.24A	6dm0B-5a22A: 2.7 6dm0C-5a22A: undetectable	6dm0B-5a22A: 3.54 6dm0C-5a22A: 3.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EQP_A_BUWA601_1 (CHOLINESTERASE)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	GLY A1704 THR A1253 SER A1451 PHE A1387	None	1.14A	6eqpA-5a22A: undetectable	6eqpA-5a22A: 3.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6J21_A_GBQA1201_0 (SUBSTANCE-P RECEPTOR,ENDOLYSIN)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	5 / 12	PRO A 829 ILE A1278 VAL A1282 HIS A1105 PHE A 130	None	1.29A	6j21A-5a22A: 2.1	6j21A-5a22A: 11.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN4_C_AM2C301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 8	HIS A1105 ARG A 912 HIS A1085 GLU A1108	None None None ZN  A3000 (-2.8A)	1.25A	6mn4C-5a22A: undetectable	6mn4C-5a22A: 8.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN4_E_AM2E301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	4 / 7	HIS A1105 ARG A 912 HIS A1085 GLU A1108	None None None ZN  A3000 (-2.8A)	1.19A	6mn4E-5a22A: undetectable	6mn4E-5a22A: 8.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6NKN_J_CHDJ101_0 (CYTOCHROME C OXIDASE SUBUNIT 3 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5a22	VESICULAR STOMATITIS VIRUS L POLYMERASE (Vesicular stomatitis virus)	3 / 3	ARG A1874 PHE A1865 PHE A1826	None	0.76A	6nknC-5a22A: 2.8 6nknJ-5a22A: undetectable	6nknC-5a22A: 8.72 6nknJ-5a22A: 2.90