SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5m59'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AJ6_A_NOVA1_1 (GYRASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 9	GLU A1798 ASP A1802 ILE A1792 ALA A1869 ILE A1854	None	1.26A	1aj6A-5m59A: undetectable	1aj6A-5m59A: 8.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GM7_B_PNNB1577_0 (PENICILLIN G ACYLASE ALPHA SUBUNIT PENICILLIN G ACYLASE BETA SUBUNIT)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	SER A1245 SER A1545 ALA A1547 PHE A1347	None	1.05A	1gm7A-5m59A: undetectable 1gm7B-5m59A: 1.4	1gm7A-5m59A: 9.21 1gm7B-5m59A: 16.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HZ4_A_BEZA784_0 (MALT REGULATORY PROTEIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	HIS A 666 LEU A 932 LEU A 937 PRO A 938	None	1.15A	1hz4A-5m59A: 2.3	1hz4A-5m59A: 12.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I7Z_A_COCA301_2 (CHIMERA OF IG KAPPA CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION CHIMERA OF IG GAMMA-1 CHAIN: HUMAN CONSTANT REGION AND MOUSE VARIABLE REGION)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	TYR A 723 TYR A 706 PRO A 704 ASP A 708	None	1.13A	1i7zB-5m59A: 4.0	1i7zB-5m59A: 8.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IBG_H_OBNH1_1 (IGG2B-KAPPA 40-50 FAB (HEAVY CHAIN))	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 6	LEU B2136 TRP B2180 PHE B2100 VAL B2121	None	1.28A	1ibgH-5m59B: undetectable	1ibgH-5m59B: 22.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_A_NIOA221_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	SER A2136 PHE A2171 GLU A2134 GLY A2133	None	1.07A	1icuA-5m59A: undetectable 1icuB-5m59A: undetectable	1icuA-5m59A: 8.86 1icuB-5m59A: 8.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_B_NIOB219_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	PHE A2171 GLU A2134 GLY A2133 SER A2136	None	1.04A	1icuA-5m59A: undetectable 1icuB-5m59A: undetectable	1icuA-5m59A: 8.86 1icuB-5m59A: 8.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ICU_C_NIOC225_1 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	SER A2136 PHE A2171 GLU A2134 GLY A2133	None	1.06A	1icuC-5m59A: undetectable 1icuD-5m59A: undetectable	1icuC-5m59A: 8.86 1icuD-5m59A: 8.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1J96_A_TESA903_1 (3ALPHA-HYDROXYSTEROI D DEHYDROGENASE TYPE 3)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	VAL A1458 ILE A1457 TRP A1419 LEU A1502	None	1.32A	1j96A-5m59A: undetectable	1j96A-5m59A: 11.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KGL_A_RTLA175_1 (CELLULAR RETINOL-BINDING PROTEIN TYPE I)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	LEU A1947 ILE A1901 THR A1903 MET A1997	None	1.12A	1kglA-5m59A: undetectable	1kglA-5m59A: 5.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KQB_A_BEZA524_0 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	SER A2136 PHE A2171 GLU A2134 GLY A2133	None	1.07A	1kqbA-5m59A: undetectable 1kqbB-5m59A: undetectable	1kqbA-5m59A: 8.77 1kqbB-5m59A: 8.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KQB_C_BEZC522_0 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	SER A2136 PHE A2171 GLU A2134 GLY A2133	None	1.07A	1kqbC-5m59A: undetectable 1kqbD-5m59A: undetectable	1kqbC-5m59A: 8.77 1kqbD-5m59A: 8.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KQB_D_BEZD523_0 (OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	PHE A2171 GLU A2134 GLY A2133 SER A2136	None	1.06A	1kqbC-5m59A: undetectable 1kqbD-5m59A: undetectable	1kqbC-5m59A: 8.77 1kqbD-5m59A: 8.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LHU_A_ESTA301_1 (SEX HORMONE-BINDING GLOBULIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	SER A1543 GLY A1553 ASN A1395 ILE A1552 LEU A1508	None	1.24A	1lhuA-5m59A: undetectable	1lhuA-5m59A: 7.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_C_AG2C7004_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	ALA A1411 LEU A1478 GLU A1412 LEU A1448	None	0.86A	1mt1D-5m59A: undetectable 1mt1E-5m59A: undetectable	1mt1D-5m59A: 5.22 1mt1E-5m59A: 2.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NT5_A_DVAA6_0 (GRAMICIDIN A)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	ALA B2176 VAL B2174 TRP B2180	None	0.85A	1nt5A-5m59B: undetectable	1nt5A-5m59B: 4.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NT5_B_DVAB6_0 (GRAMICIDIN A)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	ALA B2176 VAL B2174 TRP B2180	None	0.85A	1nt5B-5m59B: undetectable	1nt5B-5m59B: 4.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6K_A_MTLA870_0 (NITRIC-OXIDE SYNTHASE, BRAIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	ARG A1232 ASN A1256 GLN A1258 PHE A1257	None	1.36A	1p6kA-5m59A: undetectable	1p6kA-5m59A: 11.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P93_A_DEXA1999_1 (GLUCOCORTICOID RECEPTOR)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	LEU A 930 GLN A 936 MET A 472 THR A 921 ILE A 919	None	1.47A	1p93A-5m59A: undetectable	1p93A-5m59A: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RG1_A_SPMA999_1 (TYROSYL-DNA PHOSPHODIESTERASE 1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	TRP A1937 VAL A1936 PRO A1935	None	0.94A	1rg1A-5m59A: undetectable	1rg1A-5m59A: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RH0_A_SPMA999_1 (TYROSYL-DNA PHOSPHODIESTERASE 1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	TRP A1937 VAL A1936 PRO A1935	None	0.95A	1rh0A-5m59A: undetectable	1rh0A-5m59A: 14.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S8F_A_BEZA1501_0 (RAS-RELATED PROTEIN RAB-9A)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	ILE A 569 TRP A 518 LEU A 607 PRO A 522	None	1.42A	1s8fA-5m59A: undetectable 1s8fB-5m59A: undetectable	1s8fA-5m59A: 6.89 1s8fB-5m59A: 6.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S9P_D_DESD600_1 (ESTROGEN-RELATED RECEPTOR GAMMA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ALA A1427 LEU A1415 TYR A1429 LEU A1542 ILE A1556	None	1.14A	1s9pD-5m59A: undetectable	1s9pD-5m59A: 9.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1T88_A_CAMA1422_0 (CYTOCHROME P450-CAM)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	PHE A 832 LEU A 761 VAL A 764 GLY A 765	None	0.96A	1t88A-5m59A: undetectable	1t88A-5m59A: 13.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UPF_A_URFA999_1 (URACIL PHOSPHORIBOSYLTRANSF ERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	ALA A 792 TYR A 787 ILE A 788 ASP A 754	None	1.21A	1upfA-5m59A: 3.3	1upfA-5m59A: 8.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UPF_C_URFC999_1 (URACIL PHOSPHORIBOSYLTRANSF ERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	ALA A 792 TYR A 787 ILE A 788 ASP A 754	None	1.13A	1upfC-5m59A: 2.2	1upfC-5m59A: 8.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1X70_A_715A801_1 (DIPEPTIDYL PEPTIDASE IV)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 SER A 681 TYR A1041 VAL A 956	None	1.01A	1x70A-5m59A: undetectable	1x70A-5m59A: 17.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1X70_B_715B801_1 (DIPEPTIDYL PEPTIDASE IV)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 SER A 681 SER A1038 VAL A 956	None	0.95A	1x70B-5m59A: undetectable	1x70B-5m59A: 17.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AZX_A_TRPA601_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLY A 739 GLY A 490 GLN A 923 THR A 741 ILE A 494	None	1.19A	2azxA-5m59A: 2.4	2azxA-5m59A: 14.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AZX_B_TRPB603_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLY A 739 GLY A 490 GLN A 923 THR A 741 ILE A 494	None	1.17A	2azxB-5m59A: undetectable	2azxB-5m59A: 14.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E1Q_A_SALA2006_1 (XANTHINE DEHYDROGENASE/OXIDAS E)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	ARG A1640 PHE A1641 THR A1603 LEU A1712	None	1.08A	2e1qA-5m59A: 2.7	2e1qA-5m59A: 22.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E1Q_C_SALC4006_1 (XANTHINE DEHYDROGENASE/OXIDAS E)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	ARG A1640 PHE A1641 THR A1603 LEU A1712	None	1.06A	2e1qC-5m59A: undetectable	2e1qC-5m59A: 22.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E1Q_D_SALD5006_1 (XANTHINE DEHYDROGENASE/OXIDAS E)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	ARG A1640 PHE A1641 THR A1603 LEU A1712	None	1.07A	2e1qD-5m59A: undetectable	2e1qD-5m59A: 22.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E7F_A_C2FA3000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLU A 940 PHE A 465 ILE A 665 LEU A 713 ILE A 939	None	1.15A	2e7fA-5m59A: undetectable	2e7fA-5m59A: 10.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2E7F_B_C2FB4000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLU A 940 PHE A 465 ILE A 665 LEU A 713 ILE A 939	None	1.10A	2e7fB-5m59A: 2.1	2e7fB-5m59A: 10.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F8L_A_SAMA400_0 (HYPOTHETICAL PROTEIN LMO1582)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	HIS A 855 ALA A 806 ASN A 799 LEU A 802 VAL A 811	None	1.01A	2f8lA-5m59A: 2.9	2f8lA-5m59A: 11.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HA4_A_ACHA546_0 (ACETYLCHOLINESTERASE)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 8	TRP B2180 TYR B2271 TYR B2102 GLY B2149	None	1.02A	2ha4A-5m59B: undetectable	2ha4A-5m59B: 20.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HA4_B_ACHB603_0 (ACETYLCHOLINESTERASE)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 7	TRP B2180 TYR B2271 TYR B2102 GLY B2149	None	1.05A	2ha4B-5m59B: undetectable	2ha4B-5m59B: 20.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OGY_A_C2FA3000_0 (5-METHYLTETRAHYDROFO LATE CORRINOID/IRON SULFUR PROTEIN METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLU A 940 PHE A 465 ILE A 665 LEU A 713 ILE A 939	None	1.12A	2ogyA-5m59A: undetectable	2ogyA-5m59A: 9.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q7I_A_TESA205_1 (ANDROGEN RECEPTOR)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	5 / 12	LEU B2101 LEU B2150 VAL B2190 MET B2079 MET B2120	None	1.21A	2q7iA-5m59B: undetectable	2q7iA-5m59B: 18.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q7K_A_TESA304_1 (ANDROGEN RECEPTOR)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	5 / 12	LEU B2101 LEU B2150 VAL B2190 LEU B2084 MET B2120	None	1.19A	2q7kA-5m59B: undetectable	2q7kA-5m59B: 18.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QBL_A_CAMA517_0 (CYTOCHROME P450-CAM)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	LEU A1899 VAL A1902 THR A1903 VAL A1967	None	0.89A	2qblA-5m59A: undetectable	2qblA-5m59A: 12.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2RLF_B_RIMB299_1 (MATRIX PROTEIN 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	LEU A 566 LEU A 563 ILE A 521 ARG A 606	None	1.02A	2rlfB-5m59A: undetectable 2rlfC-5m59A: undetectable	2rlfB-5m59A: 2.52 2rlfC-5m59A: 2.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V32_D_BEZD1221_0 (PEROXIREDOXIN 6)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 8	VAL B2121 PRO B2122 PRO B2249 VAL B2273	None	0.86A	2v32C-5m59B: undetectable 2v32D-5m59B: undetectable	2v32C-5m59B: 20.68 2v32D-5m59B: 20.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2W98_B_P1ZB1359_1 (PROSTAGLANDIN REDUCTASE 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	THR A1794 GLU A1791 PHE A1528 ILE A1529	None	1.16A	2w98B-5m59A: 2.8	2w98B-5m59A: 11.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WEK_A_DIFA1376_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	TYR A1202 LEU A1205 LEU A1213 MET A1195	None	1.08A	2wekA-5m59A: undetectable	2wekA-5m59A: 11.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X7H_A_PFNA1375_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	SER A 941 TYR A 986 PHE A 465 TYR A 974	None	1.38A	2x7hA-5m59A: 2.1	2x7hA-5m59A: 12.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X7H_B_PFNB1372_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	SER A 941 TYR A 986 PHE A 465 TYR A 974	None	1.34A	2x7hB-5m59A: 1.9	2x7hB-5m59A: 12.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3B9L_A_AZZA1009_1 (SERUM ALBUMIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	GLU A1072 SER A1046 VAL A 643 ARG A1139	None	1.21A	3b9lA-5m59A: 3.1	3b9lA-5m59A: 16.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BEX_C_PAUC248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	VAL A 587 THR A 645 ILE A 644 THR A 636 LEU A 617	None	0.94A	3bexC-5m59A: undetectable 3bexD-5m59A: undetectable	3bexC-5m59A: 9.26 3bexD-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BEX_F_PAUF248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	THR A 636 LEU A 617 VAL A 587 THR A 645 ILE A 644	None	0.94A	3bexE-5m59A: undetectable 3bexF-5m59A: undetectable	3bexE-5m59A: 9.26 3bexF-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_A_PAUA248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	VAL A 587 THR A 645 ILE A 644 THR A 636 LEU A 617	None	1.01A	3bf1A-5m59A: undetectable 3bf1B-5m59A: undetectable	3bf1A-5m59A: 9.26 3bf1B-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_B_PAUB248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	THR A 636 LEU A 617 VAL A 587 THR A 645 ILE A 644	None	1.04A	3bf1A-5m59A: undetectable 3bf1B-5m59A: undetectable	3bf1A-5m59A: 9.26 3bf1B-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_C_PAUC248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	VAL A 587 THR A 645 ILE A 644 THR A 636 LEU A 617	None	0.91A	3bf1C-5m59A: undetectable 3bf1D-5m59A: undetectable	3bf1C-5m59A: 9.26 3bf1D-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_D_PAUD248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	THR A 636 LEU A 617 VAL A 587 THR A 645 ILE A 644	None	0.99A	3bf1C-5m59A: undetectable 3bf1D-5m59A: undetectable	3bf1C-5m59A: 9.26 3bf1D-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_E_PAUE248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	VAL A 587 THR A 645 ILE A 644 THR A 636 LEU A 617	None	0.93A	3bf1E-5m59A: undetectable 3bf1F-5m59A: undetectable	3bf1E-5m59A: 9.26 3bf1F-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_F_PAUF248_0 (TYPE III PANTOTHENATE KINASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	THR A 636 LEU A 617 VAL A 587 THR A 645 ILE A 644	None	0.93A	3bf1E-5m59A: undetectable 3bf1F-5m59A: undetectable	3bf1E-5m59A: 9.26 3bf1F-5m59A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DZY_D_BRLD478_2 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 4	ILE A 586 GLN A 599 ILE A 612 LEU A 595	None	1.27A	3dzyD-5m59A: 1.4	3dzyD-5m59A: 12.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ETE_A_H3PA552_1 (GLUTAMATE DEHYDROGENASE)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 6	ILE B2088 MET B2079 LYS B2081 ILE B2083	None	1.21A	3eteA-5m59B: undetectable 3eteE-5m59B: undetectable	3eteA-5m59B: 20.56 3eteE-5m59B: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FRQ_A_ERYA195_1 (REPRESSOR PROTEIN MPHR(A))	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum; Chaetomium thermophilum)	4 / 5	ASN B2055 ARG B2057 ASN A1059 ALA B2050	None	1.18A	3frqA-5m59B: 0.1	3frqA-5m59B: 20.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FRQ_B_ERYB195_1 (REPRESSOR PROTEIN MPHR(A))	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum; Chaetomium thermophilum)	4 / 7	ASN B2055 ARG B2057 ASN A1059 ALA B2050	None	1.20A	3frqB-5m59B: undetectable	3frqB-5m59B: 20.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G0B_A_T22A800_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.18A	3g0bA-5m59A: undetectable	3g0bA-5m59A: 17.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G0B_B_T22B800_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.18A	3g0bB-5m59A: undetectable	3g0bB-5m59A: 17.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G0B_C_T22C800_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.24A	3g0bC-5m59A: undetectable	3g0bC-5m59A: 17.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3G0B_D_T22D800_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.19A	3g0bD-5m59A: undetectable	3g0bD-5m59A: 17.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HCR_B_CHDB924_0 (FERROCHELATASE, MITOCHONDRIAL)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	ARG A1248 SER A1543 GLY A1512 MET A1510	None	0.88A	3hcrB-5m59A: 3.6	3hcrB-5m59A: 11.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IA4_C_MTXC164_2 (DIHYDROFOLATE REDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 4	ILE A 661 ARG A 672 ILE A 662 THR A 558	None None None ACT  A2201 (-3.3A)	0.97A	3ia4C-5m59A: undetectable	3ia4C-5m59A: 6.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IA4_D_MTXD164_2 (DIHYDROFOLATE REDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	ARG A 672 ILE A 662 THR A 558	None None ACT  A2201 (-3.3A)	0.66A	3ia4D-5m59A: undetectable	3ia4D-5m59A: 6.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IW1_A_ASDA1223_1 (CYTOCHROME P450 CYP125)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	VAL A1902 VAL A1948 SER A1998 ILE A1972 VAL A2001	None	1.16A	3iw1A-5m59A: undetectable	3iw1A-5m59A: 13.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWQ_B_VIAB901_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE CATALYTIC DOMAIN, CONE CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE SUBUNIT ALPHA CHIMERA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	LEU A1899 ALA A2004 LEU A1957 GLN A1965 THR A1903	None	1.49A	3jwqB-5m59A: 2.1 3jwqC-5m59A: undetectable	3jwqB-5m59A: 11.05 3jwqC-5m59A: 11.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KO0_O_TFPO201_1 (PROTEIN S100-A4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 8	GLY B2103 PHE A1319 PHE B2245 GLY B2244	None	0.91A	3ko0O-5m59B: undetectable 3ko0Q-5m59B: undetectable	3ko0O-5m59B: 16.30 3ko0Q-5m59B: 16.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LB3_B_4CHB192_0 (DEHALOPEROXIDASE A)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 6	PHE B2087 HIS B2152 THR B2153 VAL B2190	None	1.25A	3lb3B-5m59B: undetectable	3lb3B-5m59B: 22.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MBG_A_ACTA207_0 (FAD-LINKED SULFHYDRYL OXIDASE ALR)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	ASP A 843 ARG A 844 THR A 845 ALA A 842	None	1.31A	3mbgA-5m59A: undetectable 3mbgB-5m59A: undetectable	3mbgA-5m59A: 6.34 3mbgB-5m59A: 6.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N23_A_OBNA1_1 (SODIUM/POTASSIUM-TRA NSPORTING ATPASE SUBUNIT ALPHA-1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	GLN A1620 VAL A1695 ALA A1611 THR A1598 ILE A1602	None	1.42A	3n23A-5m59A: undetectable	3n23A-5m59A: 20.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N66_B_MTLB870_0 (NITRIC OXIDE SYNTHASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	ARG A1232 ASN A1256 GLN A1258 PHE A1257	None	1.32A	3n66B-5m59A: undetectable	3n66B-5m59A: 12.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NU9_A_478A401_1 (PROTEASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 8	ALA A 863 ASP B2303 GLY A 868 PRO A 591	None	0.73A	3nu9A-5m59A: undetectable	3nu9A-5m59A: 5.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OHT_B_1N1B2000_1 (P38A)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 10	ARG A1170 ILE A1116 ILE A1140 TYR A1050 ILE A1042	None	1.46A	3ohtA-5m59A: undetectable 3ohtB-5m59A: undetectable	3ohtA-5m59A: 12.66 3ohtB-5m59A: 12.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3QEL_D_QELD2_1 (NMDA GLUTAMATE RECEPTOR SUBUNIT GLUTAMATE [NMDA] RECEPTOR SUBUNIT EPSILON-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	TYR A 974 THR A 973 PHE A 976 ARG A 714	None	1.49A	3qelC-5m59A: 3.7	3qelC-5m59A: 12.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3QL3_A_FOLA161_0 (DIHYDROFOLATE REDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ILE A 661 LEU A 595 ARG A 672 ILE A 662 THR A 558	None None None None ACT  A2201 (-3.3A)	1.17A	3ql3A-5m59A: undetectable	3ql3A-5m59A: 7.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUD_D_SUED1201_1 (NS3 PROTEASE, NS4A PROTEIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLN A1738 GLY A1741 VAL A1573 ALA A1401 ALA A1400	None	1.04A	3sudD-5m59A: undetectable	3sudD-5m59A: 8.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SUE_C_SUEC1201_1 (NS3 PROTEASE, NS4A PROTEIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLN A1738 GLY A1741 VAL A1573 ALA A1401 ALA A1400	None	1.09A	3sueC-5m59A: undetectable	3sueC-5m59A: 7.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_C_ACTC502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	PRO A2086 ASP A2084 GLU A2082	None	0.82A	3v4tC-5m59A: undetectable	3v4tC-5m59A: 14.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_H_ACTH502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	SER B2129 GLY B2126 GLN B2096	None	0.63A	3v4tH-5m59B: undetectable	3v4tH-5m59B: 21.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W2T_A_LF7A801_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.04A	3w2tA-5m59A: undetectable	3w2tA-5m59A: 17.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ARC_A_LEUA1001_0 (LEUCINE--TRNA LIGASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	LEU A 548 TYR A 723 SER A 700 TYR A 974	None	1.35A	4arcA-5m59A: undetectable	4arcA-5m59A: 19.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DF3_B_SAMB301_0 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLY A1670 ALA A1662 VAL A1656 ALA A1625 VAL A1669	None	1.15A	4df3B-5m59A: 2.2	4df3B-5m59A: 9.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E7C_A_ACTA504_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	ARG A1002 TRP A 969 GLY A 966	None	0.92A	4e7cA-5m59A: undetectable	4e7cA-5m59A: 14.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FGZ_B_CQAB301_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	GLY A1861 GLU A1801 VAL A1841 GLU A1842	None	0.91A	4fgzB-5m59A: 4.1	4fgzB-5m59A: 9.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G2Z_A_ID8A711_1 (LACTOTRANSFERRIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	PRO A1610 TYR A1688 GLY A1691	None	0.66A	4g2zA-5m59A: undetectable	4g2zA-5m59A: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HTF_B_SAMB301_0 (S-ADENOSYLMETHIONINE -DEPENDENT METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLY A1516 GLY A1513 GLY A1512 LEU A1780 VAL A1522	None	1.00A	4htfB-5m59A: undetectable	4htfB-5m59A: 9.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNW_A_T3A501_1 (THYROID HORMONE RECEPTOR ALPHA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ILE A1871 ARG A2145 ALA A1994 LEU A1889 ILE A1898	None	1.17A	4lnwA-5m59A: undetectable	4lnwA-5m59A: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LNX_A_T3A502_1 (THYROID HORMONE RECEPTOR ALPHA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ILE A1871 ARG A2145 ALA A1994 LEU A1889 ILE A1898	None	1.17A	4lnxA-5m59A: undetectable	4lnxA-5m59A: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MK4_B_CHDB504_0 (FERROCHELATASE, MITOCHONDRIAL)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	LEU A1921 ILE A1924 ARG A1923	None	0.71A	4mk4B-5m59A: 2.9	4mk4B-5m59A: 11.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R7I_A_STIA1001_2 (MACROPHAGE COLONY-STIMULATING FACTOR 1 RECEPTOR)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	LEU A1770 VAL A1544 VAL A1570 ARG A1550	None	0.96A	4r7iA-5m59A: undetectable	4r7iA-5m59A: 11.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UAC_A_ACRA501_2 (CARBOHYDRATE ABC TRANSPORTER SUBSTRATE-BINDING PROTEIN, CUT1 FAMILY (TC 3.A.1.1.-))	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	4 / 7	SER B2198 GLU B2158 TRP B2202 ASP B2166	None	1.23A	4uacA-5m59B: undetectable	4uacA-5m59B: 20.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4W5N_A_IPHA902_0 (PROTEIN ARGONAUTE-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	LEU A 667 ILE A 665 LEU A 676 GLU A 677	None	0.88A	4w5nA-5m59A: undetectable	4w5nA-5m59A: 19.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4W5O_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	PHE A1566 PRO A1568 VAL A1570 ALA A1401	None	1.21A	4w5oA-5m59A: undetectable	4w5oA-5m59A: 19.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WG0_K_CHDK103_0 (NUCLEAR RECEPTOR COACTIVATOR 2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	GLU A1081 ALA A1125 LEU A1126 LEU A1086 LEU A1111	None	1.06A	4wg0I-5m59A: undetectable 4wg0J-5m59A: undetectable 4wg0K-5m59A: undetectable	4wg0I-5m59A: 2.23 4wg0J-5m59A: 2.23 4wg0K-5m59A: 2.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XUE_A_SAMA303_1 (CATECHOL O-METHYLTRANSFERASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	GLY A 673 SER A 945 GLU A 677 ASP A 671	None	1.33A	4xueA-5m59A: 3.9	4xueA-5m59A: 8.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4C_A_IPHA905_0 (PROTEIN ARGONAUTE-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	PHE A1566 PRO A1568 VAL A1570 ALA A1401	None	1.20A	4z4cA-5m59A: undetectable	4z4cA-5m59A: 19.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4D_A_IPHA904_0 (PROTEIN ARGONAUTE-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	PHE A1566 PRO A1568 VAL A1570 ALA A1401	None	1.23A	4z4dA-5m59A: undetectable	4z4dA-5m59A: 19.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4E_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	PHE A1566 PRO A1568 VAL A1570 ALA A1401	None	1.21A	4z4eA-5m59A: undetectable	4z4eA-5m59A: 19.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_B_SORB1341_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	ARG A1727 PHE A1284 ASP A1286 ILE A1272	None	1.41A	5a06B-5m59A: undetectable	5a06B-5m59A: 11.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	ALA A1128 ARG A 672 THR A 637 GLU A 639	None	0.94A	5btgA-5m59A: 1.6 5btgB-5m59A: 1.8 5btgC-5m59A: 1.6	5btgA-5m59A: 15.62 5btgB-5m59A: 9.11 5btgC-5m59A: 15.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DQF_A_LCRA612_1 (SERUM ALBUMIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 9	ASP A1506 GLY A1541 LEU A1398 LEU A1546 ALA A1400	None	1.11A	5dqfA-5m59A: 2.9	5dqfA-5m59A: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5E26_A_PAUA602_0 (PANTOTHENATE KINASE 2, MITOCHONDRIAL)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 7	GLY A1553 GLY A1541 TYR A1564 ALA A1549	None	0.88A	5e26A-5m59A: undetectable 5e26B-5m59A: undetectable	5e26A-5m59A: 11.78 5e26B-5m59A: 11.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FLC_C_RAPC999_1 (SERINE/THREONINE-PRO TEIN KINASE MTOR FKBP)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	GLY A1800 TRP A1806 TYR A1813 PHE A1812	None	0.88A	5flcB-5m59A: undetectable	5flcB-5m59A: 21.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FLC_G_RAPG999_1 (SERINE/THREONINE-PRO TEIN KINASE MTOR FKBP)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	GLY A1800 TRP A1806 TYR A1813 PHE A1812	None	0.88A	5flcF-5m59A: undetectable	5flcF-5m59A: 21.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FSA_B_X2NB590_2 (CYP51 VARIANT1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	PRO A 552 LEU A 933 SER A 727	None	0.63A	5fsaB-5m59A: undetectable	5fsaB-5m59A: 13.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GPG_A_RAPA301_2 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP3 SERINE/THREONINE-PRO TEIN KINASE MTOR)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	5 / 9	LEU B2275 SER A1337 PHE A1338 ASP A1276 PHE B2245	None	1.34A	5gpgB-5m59B: undetectable	5gpgB-5m59B: 16.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I1N_G_DVAG9_0 (D-VILLIN HEADPIECE SUBDOMAIN VILLIN-1)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	ALA B2052 ASN B2055 LEU B2056	None	0.23A	5i1nB-5m59B: undetectable	5i1nB-5m59B: 10.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I1O_F_DVAF9_0 (D-VILLIN HEADPIECE SUBDOMAIN VILLIN-1)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	ALA B2052 ASN B2055 LEU B2056	None	0.29A	5i1oC-5m59B: undetectable	5i1oC-5m59B: 10.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I1P_F_DVAF9_0 (D-VILLIN HEADPIECE SUBDOMAIN VILLIN-1)	5m59	PUTATIVE PRE-MRNA SPLICING FACTOR (Chaetomium thermophilum)	3 / 3	ALA B2052 ASN B2055 LEU B2056	None	0.32A	5i1pA-5m59B: undetectable	5i1pA-5m59B: 10.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5K9D_A_ACTA407_0 (DIHYDROOROTATE DEHYDROGENASE (QUINONE), MITOCHONDRIAL)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	THR A1794 GLN A1490 ARG A1489 GLU A1791	None	1.47A	5k9dA-5m59A: undetectable	5k9dA-5m59A: 12.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KR2_A_ROCA101_2 (PROTEASE PR5-SQV)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 11	ASP A1507 GLY A1541 ILE A1556 VAL A1428 ILE A1430	None	1.20A	5kr2B-5m59A: undetectable	5kr2B-5m59A: 4.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LJE_A_RTLA201_1 (RETINOL-BINDING PROTEIN 1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	LEU A1947 ILE A1901 THR A1903 MET A1932	None	1.11A	5ljeA-5m59A: undetectable	5ljeA-5m59A: 6.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LJE_A_RTLA201_1 (RETINOL-BINDING PROTEIN 1)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 6	LEU A1947 ILE A1901 THR A1903 MET A1997	None	1.14A	5ljeA-5m59A: undetectable	5ljeA-5m59A: 6.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MTH_B_ACTB302_0 (ANTIBODY FAB HEAVY CHAIN ANTIBODY FAB LIGHT CHAIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	GLU A2126 TYR A2177 TYR A2074 ARG A2103	None	1.34A	5mthA-5m59A: 4.0 5mthB-5m59A: 4.2	5mthA-5m59A: 8.82 5mthB-5m59A: 8.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NVP_A_ACAA18_1 (ENVELOPE GLYCOPROTEIN,GP41)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	LYS A1088 GLU A1085 LEU A1121 GLU A1122 LEU A1126	None	1.42A	5nvpA-5m59A: undetectable	5nvpA-5m59A: 2.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UUN_A_ACTA307_0 (GLUTATHIONE S-TRANSFERASE-LIKE PROTEIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 4	LEU A 947 LEU A 951 SER A1008 ALA A1010	None	0.94A	5uunA-5m59A: undetectable	5uunA-5m59A: 10.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VLM_G_CVIG301_0 (REGULATORY PROTEIN TETR)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLN A1949 ALA A1950 LEU A1899 VAL A1967 PHE A1908	None	1.27A	5vlmG-5m59A: undetectable	5vlmG-5m59A: 7.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B1E_B_LF7B801_1 (DIPEPTIDYL PEPTIDASE 4)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	ARG A 682 GLU A 954 TYR A1041 SER A1038 VAL A 956	None	1.01A	6b1eB-5m59A: undetectable	6b1eB-5m59A: 17.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BPY_A_ACTA408_0 (THIOREDOXIN REDUCTASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	3 / 3	PRO A1198 SER A1200 SER A1201	None	0.54A	6bpyA-5m59A: undetectable	6bpyA-5m59A: 11.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C2M_D_SUED1202_0 (NS3 PROTEASE)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	5 / 12	GLN A1738 GLY A1741 VAL A1573 ALA A1401 ALA A1400	None	0.99A	6c2mD-5m59A: undetectable	6c2mD-5m59A: 4.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6F3M_D_ADND502_2 (-)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 5	ILE A 773 THR A 756 THR A 781 LEU A 827	None	1.14A	6f3mD-5m59A: undetectable	6f3mD-5m59A: 13.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MDQ_A_TESA605_0 (SERUM ALBUMIN)	5m59	PRE-MRNA SPLICING HELICASE-LIKE PROTEIN (Chaetomium thermophilum)	4 / 8	LEU A2056 GLY A2057 LEU A2058 GLU A2021	None	0.87A	6mdqA-5m59A: 2.8	6mdqA-5m59A: 3.51