SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5ngy'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DED_A_QPSA1001_1 (CYCLODEXTRIN GLUCANOTRANSFERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	6 / 12	TYR A1127 LEU A 629 LEU A 630 ASP A 677 ALA A 678 HIS A 789	None	1.11A	1dedA-5ngyA: 9.0	1dedA-5ngyA: 21.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DF7_A_MTXA501_2 (DIHYDROFOLATE REDUCTASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	TRP A 479 ARG A 453 THR A 478	None	0.86A	1df7A-5ngyA: undetectable	1df7A-5ngyA: 8.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FSL_B_NIOB145_1 (LEGHEMOGLOBIN A)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ILE A1062 HIS A 712 LEU A 734 VAL A 863	None	0.85A	1fslB-5ngyA: undetectable	1fslB-5ngyA: 8.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_A_NCTA1208_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	TYR A1234 THR A 659 TYR A1230 LEU A1135	None	1.34A	1uw6A-5ngyA: undetectable 1uw6B-5ngyA: undetectable	1uw6A-5ngyA: 11.02 1uw6B-5ngyA: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_D_NCTD1208_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	TYR A1234 THR A 659 TYR A1230 LEU A1135	None	1.31A	1uw6D-5ngyA: undetectable 1uw6E-5ngyA: undetectable	1uw6D-5ngyA: 11.02 1uw6E-5ngyA: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_G_NCTG1206_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	TYR A1234 THR A 659 TYR A1230 LEU A1135	None	1.32A	1uw6G-5ngyA: undetectable 1uw6H-5ngyA: undetectable	1uw6G-5ngyA: 11.02 1uw6H-5ngyA: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_P_NCTP1206_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	TYR A1234 THR A 659 TYR A1230 LEU A1135	None	1.31A	1uw6P-5ngyA: undetectable 1uw6Q-5ngyA: undetectable	1uw6P-5ngyA: 11.02 1uw6Q-5ngyA: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UW6_T_NCTT1208_1 (ACETYLCHOLINE-BINDIN G PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	LEU A1135 TYR A1234 THR A 659 TYR A1230	None	1.32A	1uw6P-5ngyA: undetectable 1uw6T-5ngyA: undetectable	1uw6P-5ngyA: 11.02 1uw6T-5ngyA: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Z9H_A_IMNA379_1 (MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	PRO A 864 VAL A 943 SER A 851 VAL A1024 LEU A1022	None	1.44A	1z9hA-5ngyA: undetectable	1z9hA-5ngyA: 12.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Z9H_B_IMNB381_1 (MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	PRO A 864 VAL A 943 SER A 851 VAL A1024 LEU A1022	None	1.44A	1z9hB-5ngyA: undetectable	1z9hB-5ngyA: 12.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Z9H_C_IMNC379_1 (MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	PRO A 864 VAL A 943 SER A 851 VAL A1024 LEU A1022	None	1.43A	1z9hC-5ngyA: undetectable	1z9hC-5ngyA: 12.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZLQ_B_EDTB1511_0 (NICKEL-BINDING PERIPLASMIC PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ARG A 918 ARG A 896 TYR A1168 THR A1100	None	1.41A	1zlqB-5ngyA: undetectable	1zlqB-5ngyA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J2P_F_SC2F1291_1 (FICOLIN-2)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 6	LEU A 972 SER A 891 ASP A 887 GLU A 988	None	1.12A	2j2pE-5ngyA: undetectable 2j2pF-5ngyA: undetectable	2j2pE-5ngyA: 11.27 2j2pF-5ngyA: 11.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XZ5_D_ACHD1211_0 (SOLUBLE ACETYLCHOLINE RECEPTOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ASP A1225 SER A1221 TYR A1272 SER A1228	None	1.03A	2xz5C-5ngyA: undetectable 2xz5D-5ngyA: undetectable	2xz5C-5ngyA: 11.31 2xz5D-5ngyA: 11.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZQ0_A_ACRA801_1 (ALPHA-GLUCOSIDASE (ALPHA-GLUCOSIDASE SUSB))	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	ASN A1277 SER A1276 ILE A1210 PHE A 582 GLU A 568	None	1.33A	2zq0A-5ngyA: 3.6	2zq0A-5ngyA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZQ0_B_ACRB811_1 (ALPHA-GLUCOSIDASE (ALPHA-GLUCOSIDASE SUSB))	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	ASN A1277 SER A1276 ILE A1210 PHE A 582 GLU A 568	None	1.33A	2zq0B-5ngyA: 4.0	2zq0B-5ngyA: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A27_A_SAMA250_1 (UNCHARACTERIZED PROTEIN MJ1557)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	MET A 736 GLU A1064 ASN A1068	None	0.95A	3a27A-5ngyA: undetectable	3a27A-5ngyA: 11.33
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_A_ACRA5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.44A	3aicA-5ngyA: 57.1	3aicA-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_A_ACRA5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.29A	3aicA-5ngyA: 57.1	3aicA-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_B_ACRB5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.41A	3aicB-5ngyA: 56.3	3aicB-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_B_ACRB5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.28A	3aicB-5ngyA: 56.3	3aicB-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_C_ACRC5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 TYR A1127 GLN A1183	None	0.36A	3aicC-5ngyA: 57.7	3aicC-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_D_ACRD5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.41A	3aicD-5ngyA: 57.8	3aicD-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_E_ACRE5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.44A	3aicE-5ngyA: 57.8	3aicE-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_E_ACRE5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.31A	3aicE-5ngyA: 57.9	3aicE-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_F_ACRF5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.46A	3aicF-5ngyA: 57.1	3aicF-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_F_ACRF5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.37A	3aicF-5ngyA: 57.1	3aicF-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_G_ACRG5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.41A	3aicG-5ngyA: 57.9	3aicG-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_G_ACRG5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.26A	3aicG-5ngyA: 57.9	3aicG-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_H_ACRH5044_1 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	9 / 12	LEU A 629 ARG A 675 ASP A 677 ALA A 678 ASN A 681 HIS A 789 ASP A 790 ASP A1118 GLN A1183	None	0.43A	3aicH-5ngyA: 57.8	3aicH-5ngyA: 39.64
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	3AIC_H_ACRH5044_2 (GLUCOSYLTRANSFERASE- SI)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	LEU A 630 TRP A 717 TYR A1127	None	0.28A	3aicH-5ngyA: 57.8	3aicH-5ngyA: 39.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_D_DVAD10_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	GLY A 938 GLY A 902 GLY A 920	None	0.38A	3bogD-5ngyA: undetectable	3bogD-5ngyA: 5.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BXO_A_SAMA238_1 (N,N-DIMETHYLTRANSFER ASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	TYR A 853 GLU A1064 ASP A 677	None	0.85A	3bxoA-5ngyA: undetectable	3bxoA-5ngyA: 11.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CJT_G_SAMG302_0 (RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	GLY A1012 GLY A1020 SER A1019 ILE A1010 ASN A 948	None	1.07A	3cjtG-5ngyA: undetectable	3cjtG-5ngyA: 11.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3GGU_B_017B201_2 (PROTEASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 9	GLY A1114 ALA A1119 ASP A1118 GLY A 631 THR A1130	None	1.05A	3gguB-5ngyA: undetectable	3gguB-5ngyA: 5.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L2V_A_RLTA397_1 (INTEGRASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	ASP A 721 ASP A 680 TYR A 626 GLN A 606	None	1.19A	3l2vA-5ngyA: undetectable	3l2vA-5ngyA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MDT_A_VORA506_1 (CHOLESTEROL 24-HYDROXYLASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 9	PHE A1102 VAL A1175 ILE A1087 ALA A1158 ALA A1164	None	1.26A	3mdtA-5ngyA: undetectable	3mdtA-5ngyA: 16.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NU3_B_478B401_1 (PROTEASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	LEU A 352 GLY A 328 ILE A 344 GLY A 341 ILE A 314	None	0.96A	3nu3A-5ngyA: undetectable	3nu3A-5ngyA: 5.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_D_SAMD6735_0 (16S RRNA METHYLASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	ALA A 430 ALA A 431 LEU A1287 LEU A1308 TYR A 434	None	1.02A	3p2kD-5ngyA: undetectable	3p2kD-5ngyA: 10.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S3M_A_DLUA398_1 (PFV INTEGRASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ASP A 721 ASP A 680 TYR A 626 GLN A 606	None	1.03A	3s3mA-5ngyA: undetectable	3s3mA-5ngyA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S3N_A_DLUA398_1 (PFV INTEGRASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ASP A 721 ASP A 680 TYR A 626 GLN A 606	None	0.96A	3s3nA-5ngyA: undetectable	3s3nA-5ngyA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S3O_A_DLUA399_1 (PFV INTEGRASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	ASP A 721 ASP A 680 TYR A 626 GLN A 606	None	0.97A	3s3oA-5ngyA: undetectable	3s3oA-5ngyA: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_D_ACTD502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	GLY A 562 THR A 564 ASN A 560	None	0.71A	3v4tD-5ngyA: undetectable	3v4tD-5ngyA: 15.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DAJ_C_0HKC2000_1 (MUSCARINIC ACETYLCHOLINE RECEPTOR M3, LYSOZYME)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	TYR A 867 SER A1067 THR A 883 TYR A 831 ASN A 832	None	1.45A	4dajC-5ngyA: undetectable	4dajC-5ngyA: 16.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K7G_B_ACTB902_0 (3-HYDROXYPROLINE DEHYDRATSE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	ASP A 623 PRO A 604 ASP A 721 SER A 718	None	0.91A	4k7gB-5ngyA: undetectable	4k7gB-5ngyA: 13.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LV9_A_20JA601_1 (NICOTINAMIDE PHOSPHORIBOSYLTRANSF ERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ASP A1289 SER A1332 SER A1317 TYR A1336	None	1.04A	4lv9A-5ngyA: 1.8 4lv9B-5ngyA: undetectable	4lv9A-5ngyA: 17.31 4lv9B-5ngyA: 17.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LV9_B_20JB601_1 (NICOTINAMIDE PHOSPHORIBOSYLTRANSF ERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	TYR A1336 ASP A1289 SER A1332 SER A1317	None	1.05A	4lv9A-5ngyA: 1.8 4lv9B-5ngyA: undetectable	4lv9A-5ngyA: 17.31 4lv9B-5ngyA: 17.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N49_A_SAMA601_1 (CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-M ETHYLTRANSFERASE 1)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 4	ASN A1125 GLY A1126 ASP A 680 ASP A1178	None	1.40A	4n49A-5ngyA: undetectable	4n49A-5ngyA: 15.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OJB_A_198A1001_2 (ANDROGEN RECEPTOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	ASN A1284 ILE A1214 ILE A1213 VAL A1195	None	0.85A	4ojbA-5ngyA: undetectable	4ojbA-5ngyA: 10.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OK1_A_198A1001_1 (ANDROGEN RECEPTOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	LEU A 893 LEU A 973 THR A 858 ILE A 939 VAL A 941	None	1.12A	4ok1A-5ngyA: undetectable	4ok1A-5ngyA: 10.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OLM_A_198A1001_2 (ANDROGEN RECEPTOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 6	ASN A1284 ILE A1214 ILE A1213 VAL A1195	None	0.94A	4olmA-5ngyA: undetectable	4olmA-5ngyA: 10.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P3Q_A_FOLA201_1 (DIHYDROFOLATE REDUCTASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 5	ASP A 685 LEU A 686 ARG A1132 THR A1255	None	1.47A	4p3qA-5ngyA: undetectable	4p3qA-5ngyA: 7.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q5M_A_ROCA1101_1 (PROTEASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	6 / 12	GLY A 631 ASP A 633 ASN A1274 ILE A 581 ILE A1278 ILE A 565	None CA A1501 (-2.3A) None None None None	1.46A	4q5mA-5ngyA: undetectable	4q5mA-5ngyA: 9.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QOI_A_ML1A303_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	PHE A1248 TYR A 693 GLY A1232 ILE A1265	None	1.00A	4qoiA-5ngyA: undetectable 4qoiB-5ngyA: 1.9	4qoiA-5ngyA: 10.00 4qoiB-5ngyA: 10.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UMJ_A_BFQA1297_1 (GERANYLTRANSTRANSFER ASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	SER A 757 ASP A 756 GLN A 743 LYS A 763	None	0.85A	4umjA-5ngyA: undetectable	4umjA-5ngyA: 13.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4URN_A_NOVA2000_1 (DNA TOPOISOMERASE IV, B SUBUNIT)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 11	ASN A 720 SER A 718 ASP A 680 ILE A 612 THR A 603	None	1.41A	4urnA-5ngyA: undetectable	4urnA-5ngyA: 10.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4URN_B_NOVB2000_1 (DNA TOPOISOMERASE IV, B SUBUNIT)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 11	ASN A 720 SER A 718 ASP A 680 ILE A 612 THR A 603	None	1.42A	4urnB-5ngyA: undetectable	4urnB-5ngyA: 10.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 7	ALA A1338 ARG A1370 GLY A1385 THR A1363	None	0.80A	5btdA-5ngyA: undetectable 5btdB-5ngyA: undetectable 5btdC-5ngyA: undetectable	5btdA-5ngyA: 17.87 5btdB-5ngyA: 12.22 5btdC-5ngyA: 17.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 6	ALA A1338 ARG A1370 GLY A1385 THR A1363	None	0.78A	5btgA-5ngyA: undetectable 5btgB-5ngyA: undetectable 5btgC-5ngyA: undetectable	5btgA-5ngyA: 17.87 5btgB-5ngyA: 12.22 5btgC-5ngyA: 17.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESL_A_1YNA701_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 5	ALA A1056 PRO A 864 GLY A 869 LEU A 893	None	1.01A	5eslA-5ngyA: undetectable	5eslA-5ngyA: 18.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IEN_A_VDYA201_2 (CDL2.2)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	ILE A 786 LEU A 744 VAL A 943 LEU A1022 TYR A 885	None	0.95A	5ienA-5ngyA: undetectable	5ienA-5ngyA: 9.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JMN_A_FUAA1101_1 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 5	ILE A1087 ILE A1173 HIS A1163 VAL A1175	None	0.89A	5jmnA-5ngyA: undetectable	5jmnA-5ngyA: 22.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L8D_A_EDTA609_0 (NICKEL-BINDING PERIPLASMIC PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ARG A 918 ARG A 896 TYR A1168 THR A1100	None	1.38A	5l8dA-5ngyA: undetectable	5l8dA-5ngyA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LAK_I_BEZI1_0 (3CL PROTEASE BEZ-TYR-TYR-ASN-ECC PEPTIDE INHIBITOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	SER A1332 TYR A1331 TYR A1330	None	0.65A	5lakA-5ngyA: undetectable 5lakI-5ngyA: undetectable	5lakA-5ngyA: 13.44 5lakI-5ngyA: 0.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LAK_J_BEZJ1_0 (3CL PROTEASE BEZ-TYR-TYR-ASN-ECC PEPTIDE INHIBITOR)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	SER A1332 TYR A1331 TYR A1330	None	0.62A	5lakC-5ngyA: undetectable 5lakJ-5ngyA: undetectable	5lakC-5ngyA: 13.44 5lakJ-5ngyA: 0.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MWU_A_EDTA609_0 (NICKEL-BINDING PERIPLASMIC PROTEIN)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ARG A 918 ARG A 896 TYR A1168 THR A1100	None	1.38A	5mwuA-5ngyA: undetectable	5mwuA-5ngyA: 18.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0S_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	6 / 12	ILE A1087 PHE A1066 GLN A1103 ILE A1159 ALA A1158 VAL A1175	None	1.18A	5n0sB-5ngyA: undetectable	5n0sB-5ngyA: 15.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0X_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	ILE A1087 PHE A1066 GLN A1103 ALA A1158 VAL A1175	None	1.27A	5n0xB-5ngyA: undetectable	5n0xB-5ngyA: 15.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ODH_G_ACTG710_0 (HETERODISULFIDE REDUCTASE, SUBUNIT A)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 4	ARG A 787 ILE A 786 TYR A 853 ILE A 889	None	1.47A	5odhG-5ngyA: undetectable	5odhG-5ngyA: 19.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QGR_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	3 / 3	VAL A 302 TYR A 294 GLN A 293	None	0.75A	5qgrA-5ngyA: undetectable	5qgrA-5ngyA: 9.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AG0_A_ACRA610_0 (ALPHA-AMYLASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	6 / 12	TYR A1127 TYR A 626 LEU A 629 ASP A 677 HIS A 789 ASP A 790	None	0.81A	6ag0A-5ngyA: 11.0	6ag0A-5ngyA: 5.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AG0_C_ACRC608_0 (ALPHA-AMYLASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	TYR A 626 LEU A 629 ASP A 677 HIS A 789 ASP A 790	None	0.82A	6ag0C-5ngyA: 11.0	6ag0C-5ngyA: 5.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BXL_A_SAMA401_0 (2-(3-AMINO-3-CARBOXY PROPYL)HISTIDINE SYNTHASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	GLY A1029 SER A 901 LYS A 921 GLN A 937 ASP A1032	None	1.37A	6bxlA-5ngyA: undetectable	6bxlA-5ngyA: 13.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BXL_B_SAMB401_0 (2-(3-AMINO-3-CARBOXY PROPYL)HISTIDINE SYNTHASE)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	5 / 12	GLY A1029 SER A 901 LYS A 921 GLN A 937 ASP A1032	None	1.35A	6bxlB-5ngyA: undetectable	6bxlB-5ngyA: 13.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BZO_C_FI8C1201_2 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA RNA POLYMERASE SIGMA FACTOR SIGA)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 4	LEU A 629 ASP A1182 GLN A1183 VAL A 812	None CA A1501 (-3.3A) None None	1.48A	6bzoF-5ngyA: undetectable	6bzoF-5ngyA: 18.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FBV_D_FI8D1904_1 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA')	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ARG A 787 GLU A 792 ARG A 865 GLN A1103	None	1.22A	6fbvD-5ngyA: undetectable	6fbvD-5ngyA: 21.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GIQ_T_PCFT101_0 (CYTOCHROME B-C1 COMPLEX SUBUNIT 1, MITOCHONDRIAL CYTOCHROME B-C1 COMPLEX SUBUNIT 9 CYTOCHROME B-C1 COMPLEX SUBUNIT RIESKE, MITOCHONDRIAL)	5ngy	DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q (Leuconostoc citreum)	4 / 8	ASP A 204 TYR A 180 GLY A 215 VAL A 218	None GLC A1507 (-3.8A) None None	0.98A	6giqL-5ngyA: undetectable 6giqP-5ngyA: undetectable 6giqT-5ngyA: undetectable	6giqL-5ngyA: 17.24 6giqP-5ngyA: 10.84 6giqT-5ngyA: 4.32

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1DED_A_QPSA1001_1","CYCLODEXTRIN GLUCANOTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",6,"TYR A1127;LEU A 629;LEU A 630;ASP A 677;ALA A 678;HIS A 789","None","1.11A","1dedA-5ngyA:9.0","1dedA-5ngyA:21.95"],["1DF7_A_MTXA501_2","DIHYDROFOLATE REDUCTASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"TRP A 479;ARG A 453;THR A 478","None","0.86A","1df7A-5ngyA:undetectable","1df7A-5ngyA:8.22"],["1FSL_B_NIOB145_1","LEGHEMOGLOBIN A","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ILE A1062;HIS A 712;LEU A 734;VAL A 863","None","0.85A","1fslB-5ngyA:undetectable","1fslB-5ngyA:8.45"],["1UW6_A_NCTA1208_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"TYR A1234;THR A 659;TYR A1230;LEU A1135","None","1.34A","1uw6A-5ngyA:undetectable;1uw6B-5ngyA:undetectable","1uw6A-5ngyA:11.02;1uw6B-5ngyA:11.02"],["1UW6_D_NCTD1208_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"TYR A1234;THR A 659;TYR A1230;LEU A1135","None","1.31A","1uw6D-5ngyA:undetectable;1uw6E-5ngyA:undetectable","1uw6D-5ngyA:11.02;1uw6E-5ngyA:11.02"],["1UW6_G_NCTG1206_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"TYR A1234;THR A 659;TYR A1230;LEU A1135","None","1.32A","1uw6G-5ngyA:undetectable;1uw6H-5ngyA:undetectable","1uw6G-5ngyA:11.02;1uw6H-5ngyA:11.02"],["1UW6_P_NCTP1206_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"TYR A1234;THR A 659;TYR A1230;LEU A1135","None","1.31A","1uw6P-5ngyA:undetectable;1uw6Q-5ngyA:undetectable","1uw6P-5ngyA:11.02;1uw6Q-5ngyA:11.02"],["1UW6_T_NCTT1208_1","ACETYLCHOLINE-BINDING PROTEIN;ACETYLCHOLINE-BINDING PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"LEU A1135;TYR A1234;THR A 659;TYR A1230","None","1.32A","1uw6P-5ngyA:undetectable;1uw6T-5ngyA:undetectable","1uw6P-5ngyA:11.02;1uw6T-5ngyA:11.02"],["1Z9H_A_IMNA379_1","MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"PRO A 864;VAL A 943;SER A 851;VAL A1024;LEU A1022","None","1.44A","1z9hA-5ngyA:undetectable","1z9hA-5ngyA:12.87"],["1Z9H_B_IMNB381_1","MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"PRO A 864;VAL A 943;SER A 851;VAL A1024;LEU A1022","None","1.44A","1z9hB-5ngyA:undetectable","1z9hB-5ngyA:12.87"],["1Z9H_C_IMNC379_1","MEMBRANE-ASSOCIATED PROSTAGLANDIN E SYNTHASE-2","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"PRO A 864;VAL A 943;SER A 851;VAL A1024;LEU A1022","None","1.43A","1z9hC-5ngyA:undetectable","1z9hC-5ngyA:12.87"],["1ZLQ_B_EDTB1511_0","NICKEL-BINDING PERIPLASMIC PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ARG A 918;ARG A 896;TYR A1168;THR A1100","None","1.41A","1zlqB-5ngyA:undetectable","1zlqB-5ngyA:18.50"],["2J2P_F_SC2F1291_1","FICOLIN-2;FICOLIN-2","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"LEU A 972;SER A 891;ASP A 887;GLU A 988","None","1.12A","2j2pE-5ngyA:undetectable;2j2pF-5ngyA:undetectable","2j2pE-5ngyA:11.27;2j2pF-5ngyA:11.27"],["2XZ5_D_ACHD1211_0","SOLUBLE ACETYLCHOLINE RECEPTOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A1225;SER A1221;TYR A1272;SER A1228","None","1.03A","2xz5C-5ngyA:undetectable;2xz5D-5ngyA:undetectable","2xz5C-5ngyA:11.31;2xz5D-5ngyA:11.31"],["2ZQ0_A_ACRA801_1","ALPHA-GLUCOSIDASE (ALPHA-GLUCOSIDASE SUSB)","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ASN A1277;SER A1276;ILE A1210;PHE A 582;GLU A 568","None","1.33A","2zq0A-5ngyA:3.6","2zq0A-5ngyA:20.28"],["2ZQ0_B_ACRB811_1","ALPHA-GLUCOSIDASE (ALPHA-GLUCOSIDASE SUSB)","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ASN A1277;SER A1276;ILE A1210;PHE A 582;GLU A 568","None","1.33A","2zq0B-5ngyA:4.0","2zq0B-5ngyA:20.28"],["3A27_A_SAMA250_1","UNCHARACTERIZED PROTEIN MJ1557","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"MET A 736;GLU A1064;ASN A1068","None","0.95A","3a27A-5ngyA:undetectable","3a27A-5ngyA:11.33"],["3AIC_A_ACRA5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.44A","3aicA-5ngyA:57.1","3aicA-5ngyA:39.64"],["3AIC_A_ACRA5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.29A","3aicA-5ngyA:57.1","3aicA-5ngyA:39.64"],["3AIC_B_ACRB5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.41A","3aicB-5ngyA:56.3","3aicB-5ngyA:39.64"],["3AIC_B_ACRB5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.28A","3aicB-5ngyA:56.3","3aicB-5ngyA:39.64"],["3AIC_C_ACRC5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;TYR A1127;GLN A1183","None","0.36A","3aicC-5ngyA:57.7","3aicC-5ngyA:39.64"],["3AIC_D_ACRD5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.41A","3aicD-5ngyA:57.8","3aicD-5ngyA:39.64"],["3AIC_E_ACRE5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.44A","3aicE-5ngyA:57.8","3aicE-5ngyA:39.64"],["3AIC_E_ACRE5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.31A","3aicE-5ngyA:57.9","3aicE-5ngyA:39.64"],["3AIC_F_ACRF5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.46A","3aicF-5ngyA:57.1","3aicF-5ngyA:39.64"],["3AIC_F_ACRF5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.37A","3aicF-5ngyA:57.1","3aicF-5ngyA:39.64"],["3AIC_G_ACRG5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.41A","3aicG-5ngyA:57.9","3aicG-5ngyA:39.64"],["3AIC_G_ACRG5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.26A","3aicG-5ngyA:57.9","3aicG-5ngyA:39.64"],["3AIC_H_ACRH5044_1","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",9,"LEU A 629;ARG A 675;ASP A 677;ALA A 678;ASN A 681;HIS A 789;ASP A 790;ASP A1118;GLN A1183","None","0.43A","3aicH-5ngyA:57.8","3aicH-5ngyA:39.64"],["3AIC_H_ACRH5044_2","GLUCOSYLTRANSFERASE-SI","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"LEU A 630;TRP A 717;TYR A1127","None","0.28A","3aicH-5ngyA:57.8","3aicH-5ngyA:39.64"],["3BOG_D_DVAD10_0","6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"GLY A 938;GLY A 902;GLY A 920","None","0.38A","3bogD-5ngyA:undetectable","3bogD-5ngyA:5.00"],["3BXO_A_SAMA238_1","N,N-DIMETHYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"TYR A 853;GLU A1064;ASP A 677","None","0.85A","3bxoA-5ngyA:undetectable","3bxoA-5ngyA:11.07"],["3CJT_G_SAMG302_0","RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"GLY A1012;GLY A1020;SER A1019;ILE A1010;ASN A 948","None","1.07A","3cjtG-5ngyA:undetectable","3cjtG-5ngyA:11.69"],["3GGU_B_017B201_2","PROTEASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"GLY A1114;ALA A1119;ASP A1118;GLY A 631;THR A1130","None","1.05A","3gguB-5ngyA:undetectable","3gguB-5ngyA:5.50"],["3L2V_A_RLTA397_1","INTEGRASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 721;ASP A 680;TYR A 626;GLN A 606","None","1.19A","3l2vA-5ngyA:undetectable","3l2vA-5ngyA:15.47"],["3MDT_A_VORA506_1","CHOLESTEROL 24-HYDROXYLASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"PHE A1102;VAL A1175;ILE A1087;ALA A1158;ALA A1164","None","1.26A","3mdtA-5ngyA:undetectable","3mdtA-5ngyA:16.37"],["3NU3_B_478B401_1","PROTEASE;PROTEASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"LEU A 352;GLY A 328;ILE A 344;GLY A 341;ILE A 314","None","0.96A","3nu3A-5ngyA:undetectable","3nu3A-5ngyA:5.96"],["3P2K_D_SAMD6735_0","16S RRNA METHYLASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ALA A 430;ALA A 431;LEU A1287;LEU A1308;TYR A 434","None","1.02A","3p2kD-5ngyA:undetectable","3p2kD-5ngyA:10.93"],["3S3M_A_DLUA398_1","PFV INTEGRASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 721;ASP A 680;TYR A 626;GLN A 606","None","1.03A","3s3mA-5ngyA:undetectable","3s3mA-5ngyA:15.47"],["3S3N_A_DLUA398_1","PFV INTEGRASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 721;ASP A 680;TYR A 626;GLN A 606","None","0.96A","3s3nA-5ngyA:undetectable","3s3nA-5ngyA:15.47"],["3S3O_A_DLUA399_1","PFV INTEGRASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 721;ASP A 680;TYR A 626;GLN A 606","None","0.97A","3s3oA-5ngyA:undetectable","3s3oA-5ngyA:15.47"],["3V4T_D_ACTD502_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"GLY A 562;THR A 564;ASN A 560","None","0.71A","3v4tD-5ngyA:undetectable","3v4tD-5ngyA:15.41"],["4DAJ_C_0HKC2000_1","MUSCARINIC ACETYLCHOLINE RECEPTOR M3, LYSOZYME","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"TYR A 867;SER A1067;THR A 883;TYR A 831;ASN A 832","None","1.45A","4dajC-5ngyA:undetectable","4dajC-5ngyA:16.46"],["4K7G_B_ACTB902_0","3-HYDROXYPROLINE DEHYDRATSE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 623;PRO A 604;ASP A 721;SER A 718","None","0.91A","4k7gB-5ngyA:undetectable","4k7gB-5ngyA:13.86"],["4LV9_A_20JA601_1","NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE;NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A1289;SER A1332;SER A1317;TYR A1336","None","1.04A","4lv9A-5ngyA:1.8;4lv9B-5ngyA:undetectable","4lv9A-5ngyA:17.31;4lv9B-5ngyA:17.31"],["4LV9_B_20JB601_1","NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE;NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"TYR A1336;ASP A1289;SER A1332;SER A1317","None","1.05A","4lv9A-5ngyA:1.8;4lv9B-5ngyA:undetectable","4lv9A-5ngyA:17.31;4lv9B-5ngyA:17.31"],["4N49_A_SAMA601_1","CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-METHYLTRANSFERASE 1","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASN A1125;GLY A1126;ASP A 680;ASP A1178","None","1.40A","4n49A-5ngyA:undetectable","4n49A-5ngyA:15.37"],["4OJB_A_198A1001_2","ANDROGEN RECEPTOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASN A1284;ILE A1214;ILE A1213;VAL A1195","None","0.85A","4ojbA-5ngyA:undetectable","4ojbA-5ngyA:10.79"],["4OK1_A_198A1001_1","ANDROGEN RECEPTOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"LEU A 893;LEU A 973;THR A 858;ILE A 939;VAL A 941","None","1.12A","4ok1A-5ngyA:undetectable","4ok1A-5ngyA:10.79"],["4OLM_A_198A1001_2","ANDROGEN RECEPTOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASN A1284;ILE A1214;ILE A1213;VAL A1195","None","0.94A","4olmA-5ngyA:undetectable","4olmA-5ngyA:10.79"],["4P3Q_A_FOLA201_1","DIHYDROFOLATE REDUCTASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 685;LEU A 686;ARG A1132;THR A1255","None","1.47A","4p3qA-5ngyA:undetectable","4p3qA-5ngyA:7.42"],["4Q5M_A_ROCA1101_1","PROTEASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",6,"GLY A 631;ASP A 633;ASN A1274;ILE A 581;ILE A1278;ILE A 565","None; CA A1501 (-2.3A);None;None;None;None","1.46A","4q5mA-5ngyA:undetectable","4q5mA-5ngyA:9.52"],["4QOI_A_ML1A303_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"PHE A1248;TYR A 693;GLY A1232;ILE A1265","None","1.00A","4qoiA-5ngyA:undetectable;4qoiB-5ngyA:1.9","4qoiA-5ngyA:10.00;4qoiB-5ngyA:10.00"],["4UMJ_A_BFQA1297_1","GERANYLTRANSTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"SER A 757;ASP A 756;GLN A 743;LYS A 763","None","0.85A","4umjA-5ngyA:undetectable","4umjA-5ngyA:13.60"],["4URN_A_NOVA2000_1","DNA TOPOISOMERASE IV, B SUBUNIT","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ASN A 720;SER A 718;ASP A 680;ILE A 612;THR A 603","None","1.41A","4urnA-5ngyA:undetectable","4urnA-5ngyA:10.53"],["4URN_B_NOVB2000_1","DNA TOPOISOMERASE IV, B SUBUNIT","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ASN A 720;SER A 718;ASP A 680;ILE A 612;THR A 603","None","1.42A","4urnB-5ngyA:undetectable","4urnB-5ngyA:10.53"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ALA A1338;ARG A1370;GLY A1385;THR A1363","None","0.80A","5btdA-5ngyA:undetectable;5btdB-5ngyA:undetectable;5btdC-5ngyA:undetectable","5btdA-5ngyA:17.87;5btdB-5ngyA:12.22;5btdC-5ngyA:17.87"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ALA A1338;ARG A1370;GLY A1385;THR A1363","None","0.78A","5btgA-5ngyA:undetectable;5btgB-5ngyA:undetectable;5btgC-5ngyA:undetectable","5btgA-5ngyA:17.87;5btgB-5ngyA:12.22;5btgC-5ngyA:17.87"],["5ESL_A_1YNA701_2","LANOSTEROL 14-ALPHA DEMETHYLASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ALA A1056;PRO A 864;GLY A 869;LEU A 893","None","1.01A","5eslA-5ngyA:undetectable","5eslA-5ngyA:18.40"],["5IEN_A_VDYA201_2","CDL2.2","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ILE A 786;LEU A 744;VAL A 943;LEU A1022;TYR A 885","None","0.95A","5ienA-5ngyA:undetectable","5ienA-5ngyA:9.64"],["5JMN_A_FUAA1101_1","MULTIDRUG EFFLUX PUMP SUBUNIT ACRB","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ILE A1087;ILE A1173;HIS A1163;VAL A1175","None","0.89A","5jmnA-5ngyA:undetectable","5jmnA-5ngyA:22.74"],["5L8D_A_EDTA609_0","NICKEL-BINDING PERIPLASMIC PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ARG A 918;ARG A 896;TYR A1168;THR A1100","None","1.38A","5l8dA-5ngyA:undetectable","5l8dA-5ngyA:18.50"],["5LAK_I_BEZI1_0","3CL PROTEASE;BEZ-TYR-TYR-ASN-ECC PEPTIDE INHIBITOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"SER A1332;TYR A1331;TYR A1330","None","0.65A","5lakA-5ngyA:undetectable;5lakI-5ngyA:undetectable","5lakA-5ngyA:13.44;5lakI-5ngyA:0.71"],["5LAK_J_BEZJ1_0","3CL PROTEASE;BEZ-TYR-TYR-ASN-ECC PEPTIDE INHIBITOR","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"SER A1332;TYR A1331;TYR A1330","None","0.62A","5lakC-5ngyA:undetectable;5lakJ-5ngyA:undetectable","5lakC-5ngyA:13.44;5lakJ-5ngyA:0.71"],["5MWU_A_EDTA609_0","NICKEL-BINDING PERIPLASMIC PROTEIN","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ARG A 918;ARG A 896;TYR A1168;THR A1100","None","1.38A","5mwuA-5ngyA:undetectable","5mwuA-5ngyA:18.50"],["5N0S_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",6,"ILE A1087;PHE A1066;GLN A1103;ILE A1159;ALA A1158;VAL A1175","None","1.18A","5n0sB-5ngyA:undetectable","5n0sB-5ngyA:15.37"],["5N0X_B_SAMB501_0","PEPTIDE N-METHYLTRANSFERASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"ILE A1087;PHE A1066;GLN A1103;ALA A1158;VAL A1175","None","1.27A","5n0xB-5ngyA:undetectable","5n0xB-5ngyA:15.34"],["5ODH_G_ACTG710_0","HETERODISULFIDE REDUCTASE, SUBUNIT A","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ARG A 787;ILE A 786;TYR A 853;ILE A 889","None","1.47A","5odhG-5ngyA:undetectable","5odhG-5ngyA:19.17"],["5QGR_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",3,"VAL A 302;TYR A 294;GLN A 293","None","0.75A","5qgrA-5ngyA:undetectable","5qgrA-5ngyA:9.04"],["6AG0_A_ACRA610_0","ALPHA-AMYLASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",6,"TYR A1127;TYR A 626;LEU A 629;ASP A 677;HIS A 789;ASP A 790","None","0.81A","6ag0A-5ngyA:11.0","6ag0A-5ngyA:5.39"],["6AG0_C_ACRC608_0","ALPHA-AMYLASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"TYR A 626;LEU A 629;ASP A 677;HIS A 789;ASP A 790","None","0.82A","6ag0C-5ngyA:11.0","6ag0C-5ngyA:5.39"],["6BXL_A_SAMA401_0","2-(3-AMINO-3-CARBOXYPROPYL)HISTIDINE SYNTHASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"GLY A1029;SER A 901;LYS A 921;GLN A 937;ASP A1032","None","1.37A","6bxlA-5ngyA:undetectable","6bxlA-5ngyA:13.54"],["6BXL_B_SAMB401_0","2-(3-AMINO-3-CARBOXYPROPYL)HISTIDINE SYNTHASE","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",5,"GLY A1029;SER A 901;LYS A 921;GLN A 937;ASP A1032","None","1.35A","6bxlB-5ngyA:undetectable","6bxlB-5ngyA:13.54"],["6BZO_C_FI8C1201_2","DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA;RNA POLYMERASE SIGMA FACTOR SIGA","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"LEU A 629;ASP A1182;GLN A1183;VAL A 812","None; CA A1501 (-3.3A);None;None","1.48A","6bzoF-5ngyA:undetectable","6bzoF-5ngyA:18.33"],["6FBV_D_FI8D1904_1","DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA'","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ARG A 787;GLU A 792;ARG A 865;GLN A1103","None","1.22A","6fbvD-5ngyA:undetectable","6fbvD-5ngyA:21.43"],["6GIQ_T_PCFT101_0","CYTOCHROME B-C1 COMPLEX SUBUNIT 1, MITOCHONDRIAL;CYTOCHROME B-C1 COMPLEX SUBUNIT 9;CYTOCHROME B-C1 COMPLEX SUBUNIT RIESKE, MITOCHONDRIAL","5ngy","DSR-M GLUCANSUCRASE INACTIVE MUTANT E715Q","Leuconostoc citreum",4,"ASP A 204;TYR A 180;GLY A 215;VAL A 218","None;GLC A1507 (-3.8A);None;None","0.98A","6giqL-5ngyA:undetectable;6giqP-5ngyA:undetectable;6giqT-5ngyA:undetectable","6giqL-5ngyA:17.24;6giqP-5ngyA:10.84;6giqT-5ngyA:4.32"]]