SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5o6v'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1BDW_B_DVAB6_0 (GRAMICIDIN A)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	3 / 3	TRP A 44 ALA A 47 VAL A 141	None	0.97A	1bdwA-5o6vA: undetectable 1bdwB-5o6vA: undetectable	1bdwA-5o6vA: undetectable 1bdwB-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7B_A_HLTA4003_1 (SERUM ALBUMIN)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 9	ILE A 137 LEU A 45 VAL A 192 GLY A 191 LEU A 283	None	1.18A	1e7bA-5o6vA: undetectable	1e7bA-5o6vA: 8.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FBM_B_RTLB951_1 (PROTEIN (CARTILAGE OLIGOMERIC MATRIX PROTEIN))	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 4	THR A 172 LEU A 184 VAL A 292 LEU A 23	None	1.05A	1fbmB-5o6vA: undetectable	1fbmB-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I9G_A_SAMA301_0 (HYPOTHETICAL PROTEIN RV2118C)	5o6v	ENVELOPE PROTEIN SMALL ENVELOPE PROTEIN M (Tick-borne encephalitis virus; Tick-borne encephalitis virus)	5 / 12	GLY A 468 ALA A 483 LEU A 482 LEU D 52 MET A 476	None	1.16A	1i9gA-5o6vA: undetectable	1i9gA-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIM_A_CHDA525_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 3)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 6	HIS A 282 THR A 140 TYR A 139 HIS A 275	None	1.50A	2eimA-5o6vA: 2.0 2eimC-5o6vA: undetectable	2eimA-5o6vA: undetectable 2eimC-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIM_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	4 / 5	TYR H 95 MET H 93 THR H 114 LEU H 115	None	1.44A	2eimJ-5o6vH: undetectable	2eimJ-5o6vH: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EIM_W_CHDW1060_0 (CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	4 / 5	TYR H 95 MET H 93 THR H 114 LEU H 115	None	1.44A	2eimW-5o6vH: undetectable	2eimW-5o6vH: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WA2_B_SAMB1267_1 (NON-STRUCTURAL PROTEIN 5)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	3 / 3	SER A 397 HIS A 323 ASP A 10	None	0.55A	2wa2B-5o6vA: undetectable	2wa2B-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG2_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	4 / 5	TYR H 95 MET H 93 THR H 114 LEU H 115	None	1.42A	3ag2J-5o6vH: undetectable	3ag2J-5o6vH: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AG4_J_CHDJ60_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 7A1)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	4 / 5	TYR H 95 MET H 93 THR H 114 LEU H 115	None	1.43A	3ag4J-5o6vH: undetectable	3ag4J-5o6vH: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CYX_A_ROCA201_3 (HIV-1 PROTEASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	GLY A 417 ALA A 420 ASP A 422 GLY A 191 VAL A 192	None	0.71A	3cyxB-5o6vA: undetectable	3cyxB-5o6vA: 21.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DL9_B_V2HB602_0 (CYTOCHROME P450 2R1)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	THR A 359 VAL A 385 ALA A 355 THR A 313 ILE A 364	None	1.25A	3dl9B-5o6vA: undetectable	3dl9B-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MZE_A_CFXA364_2 (D-ALANYL-D-ALANINE CARBOXYPEPTIDASE DACA)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	3 / 3	SER H 168 SER H 167 HIS H 171	None	0.78A	3mzeA-5o6vH: undetectable	3mzeA-5o6vH: 16.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3MZE_A_CFXA364_2 (D-ALANYL-D-ALANINE CARBOXYPEPTIDASE DACA)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	3 / 3	SER H 185 SER H 186 HIS H 206	None	0.81A	3mzeA-5o6vH: undetectable	3mzeA-5o6vH: 16.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXV_B_478B200_1 (HIV-1 PROTEASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 9	GLY A 417 ALA A 420 ASP A 422 GLY A 191 VAL A 192	None	0.80A	3oxvA-5o6vA: undetectable	3oxvA-5o6vA: 24.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXV_C_478C200_1 (HIV-1 PROTEASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 9	GLY A 417 ALA A 420 ASP A 422 GLY A 191 VAL A 192	None	0.88A	3oxvC-5o6vA: undetectable	3oxvC-5o6vA: 24.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXW_B_017B200_1 (HIV-1 PROTEASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 10	GLY A 417 ALA A 420 ASP A 422 GLY A 191 VAL A 192	None	0.80A	3oxwA-5o6vA: undetectable	3oxwA-5o6vA: 24.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXW_D_017D200_1 (HIV-1 PROTEASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 10	GLY A 417 ALA A 420 ASP A 422 GLY A 191 VAL A 192	None	0.75A	3oxwC-5o6vA: undetectable	3oxwC-5o6vA: 24.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3Z_C_9PLC501_1 (CYTOCHROME P450 2E1)	5o6v	ENVELOPE PROTEIN SMALL ENVELOPE PROTEIN M (Tick-borne encephalitis virus)	4 / 5	PHE A 449 ALA D 45 THR D 48 LEU A 460	None	1.21A	3t3zC-5o6vA: undetectable	3t3zC-5o6vA: 14.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_A_RTZA2_1 (CYTOCHROME P450 2D6)	5o6v	ENVELOPE PROTEIN SMALL ENVELOPE PROTEIN M (Tick-borne encephalitis virus)	5 / 11	THR D 53 VAL D 49 LEU A 460 VAL A 462 PHE A 449	None	1.39A	3tbgA-5o6vD: undetectable	3tbgA-5o6vD: 9.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_C_RTZC2_1 (CYTOCHROME P450 2D6)	5o6v	ENVELOPE PROTEIN SMALL ENVELOPE PROTEIN M (Tick-borne encephalitis virus)	5 / 10	THR D 53 VAL D 49 LEU A 460 VAL A 462 PHE A 449	None	1.41A	3tbgC-5o6vD: undetectable	3tbgC-5o6vD: 9.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_A_SAMA401_1 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 5	HIS A 146 SER A 40 THR A 34 ASP A 46	None	0.97A	3tm4A-5o6vA: undetectable	3tm4A-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TM4_B_SAMB401_1 (TRNA (GUANINE N2-)-METHYLTRANSFERA SE TRM14)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 5	HIS A 146 SER A 40 THR A 34 ASP A 46	None	0.99A	3tm4B-5o6vA: undetectable	3tm4B-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PB1_A_RBVA501_1 (NUPC FAMILY PROTEIN)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	GLY A 177 TYR A 304 ASN A 366 GLU A 365 ASN A 367	None	1.32A	4pb1A-5o6vA: undetectable	4pb1A-5o6vA: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PGH_A_SAMA401_0 (CAFFEIC ACID O-METHYLTRANSFERASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 11	GLY A 369 GLY A 148 THR A 359 ASP A 149 ILE A 364	None	1.10A	4pghA-5o6vA: undetectable	4pghA-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PGH_D_SAMD401_0 (CAFFEIC ACID O-METHYLTRANSFERASE)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	GLY A 369 GLY A 148 THR A 359 ASP A 149 ILE A 364	None	1.11A	4pghD-5o6vA: undetectable	4pghD-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4URO_D_NOVD2000_1 (DNA GYRASE SUBUNIT B)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	SER A 1 ASP A 42 ILE A 358 SER A 321 THR A 32	None	1.32A	4uroD-5o6vA: undetectable	4uroD-5o6vA: 18.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 7	ARG A 160 ASP A 42 THR A 325 GLU A 373	None	1.01A	5btdA-5o6vA: undetectable 5btdC-5o6vA: undetectable 5btdD-5o6vA: undetectable	5btdA-5o6vA: 10.41 5btdC-5o6vA: 10.41 5btdD-5o6vA: 18.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 7	ARG A 160 ASP A 42 THR A 325 GLU A 373	None	1.01A	5btfA-5o6vA: undetectable 5btfC-5o6vA: undetectable 5btfD-5o6vA: undetectable	5btfA-5o6vA: 10.41 5btfC-5o6vA: 10.41 5btfD-5o6vA: 18.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JHD_E_EDTE301_0 (BETA-2-MICROGLOBULIN TCRBETA CHAIN)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 8	SER A 40 THR A 34 THR A 32 PRO A 362	None	1.13A	5jhdE-5o6vA: 4.3 5jhdG-5o6vA: 4.1	5jhdE-5o6vA: undetectable 5jhdG-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KQY_B_017B101_2 (PROTEASE E35D-DRV)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 7	GLY A 417 ALA A 420 ASP A 422 GLY A 191	None	0.66A	5kqyB-5o6vA: undetectable	5kqyB-5o6vA: 21.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L4E_D_EDPD402_1 (PROTON-GATED ION CHANNEL)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 8	THR A 32 SER A 1 THR A 325 SER A 321	None	0.93A	5l4eA-5o6vA: undetectable 5l4eB-5o6vA: 2.8 5l4eC-5o6vA: undetectable 5l4eD-5o6vA: undetectable 5l4eE-5o6vA: undetectable	5l4eA-5o6vA: 14.18 5l4eB-5o6vA: 14.18 5l4eC-5o6vA: 14.18 5l4eD-5o6vA: 14.18 5l4eE-5o6vA: 14.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5L4E_D_EDPD402_1 (PROTON-GATED ION CHANNEL)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 8	THR A 325 SER A 321 THR A 32 SER A 1	None	0.93A	5l4eA-5o6vA: undetectable 5l4eB-5o6vA: 2.8 5l4eC-5o6vA: undetectable 5l4eD-5o6vA: undetectable 5l4eE-5o6vA: undetectable	5l4eA-5o6vA: 14.18 5l4eB-5o6vA: 14.18 5l4eC-5o6vA: 14.18 5l4eD-5o6vA: 14.18 5l4eE-5o6vA: 14.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QGN_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	3 / 3	VAL A 198 VAL A 131 GLN A 55	None	0.64A	5qgnA-5o6vA: undetectable	5qgnA-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QH5_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	3 / 3	VAL A 198 VAL A 131 GLN A 55	None	0.67A	5qh5A-5o6vA: undetectable	5qh5A-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5QHH_A_ACTA301_0 (PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	3 / 3	VAL A 198 VAL A 131 GLN A 55	None	0.67A	5qhhA-5o6vA: undetectable	5qhhA-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z86_J_CHDJ101_0 (CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5o6v	FAB 19/1786 - HEAVY CHAIN (Mus musculus)	4 / 5	TYR H 95 MET H 93 THR H 114 LEU H 115	None	1.42A	5z86J-5o6vH: undetectable	5z86J-5o6vH: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BZO_C_FI8C1201_2 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA RNA POLYMERASE SIGMA FACTOR SIGA)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 4	LEU A 194 ASP A 133 GLN A 50 VAL A 43	None	1.45A	6bzoF-5o6vA: undetectable	6bzoF-5o6vA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DWN_B_AQ4B602_0 (CYTOCHROME P450 1A1)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	5 / 12	ILE A 358 SER A 1 PHE A 11 ASP A 42 ASP A 10	None	1.38A	6dwnB-5o6vA: undetectable	6dwnB-5o6vA: 19.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FOS_B_PQNB2002_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	5o6v	ENVELOPE PROTEIN (Tick-borne encephalitis virus)	4 / 6	TRP A 235 ALA A 238 LEU A 241 ALA A 63	None	1.09A	6fosB-5o6vA: undetectable	6fosB-5o6vA: 16.25

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1BDW_B_DVAB6_0","GRAMICIDIN A","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",3,"TRP A  44;ALA A  47;VAL A 141","None","0.97A","1bdwA-5o6vA:undetectable;1bdwB-5o6vA:undetectable","1bdwA-5o6vA:undetectable;1bdwB-5o6vA:undetectable"],["1E7B_A_HLTA4003_1","SERUM ALBUMIN","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"ILE A 137;LEU A  45;VAL A 192;GLY A 191;LEU A 283","None","1.18A","1e7bA-5o6vA:undetectable","1e7bA-5o6vA:8.09"],["1FBM_B_RTLB951_1","PROTEIN (CARTILAGE OLIGOMERIC MATRIX PROTEIN)","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"THR A 172;LEU A 184;VAL A 292;LEU A  23","None","1.05A","1fbmB-5o6vA:undetectable","1fbmB-5o6vA:undetectable"],["1I9G_A_SAMA301_0","HYPOTHETICAL PROTEIN RV2118C","5o6v","ENVELOPE PROTEIN;SMALL ENVELOPE PROTEIN M","Tick-borne encephalitis virus;Tick-borne encephalitis virus",5,"GLY A 468;ALA A 483;LEU A 482;LEU D  52;MET A 476","None","1.16A","1i9gA-5o6vA:undetectable","1i9gA-5o6vA:undetectable"],["2EIM_A_CHDA525_0","CYTOCHROME C OXIDASE SUBUNIT 1;CYTOCHROME C OXIDASE SUBUNIT 3","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"HIS A 282;THR A 140;TYR A 139;HIS A 275","None","1.50A","2eimA-5o6vA:2.0;2eimC-5o6vA:undetectable","2eimA-5o6vA:undetectable;2eimC-5o6vA:undetectable"],["2EIM_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",4,"TYR H  95;MET H  93;THR H 114;LEU H 115","None","1.44A","2eimJ-5o6vH:undetectable","2eimJ-5o6vH:undetectable"],["2EIM_W_CHDW1060_0","CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-HEART","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",4,"TYR H  95;MET H  93;THR H 114;LEU H 115","None","1.44A","2eimW-5o6vH:undetectable","2eimW-5o6vH:undetectable"],["2WA2_B_SAMB1267_1","NON-STRUCTURAL PROTEIN 5","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",3,"SER A 397;HIS A 323;ASP A  10","None","0.55A","2wa2B-5o6vA:undetectable","2wa2B-5o6vA:undetectable"],["3AG2_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",4,"TYR H  95;MET H  93;THR H 114;LEU H 115","None","1.42A","3ag2J-5o6vH:undetectable","3ag2J-5o6vH:undetectable"],["3AG4_J_CHDJ60_0","CYTOCHROME C OXIDASE POLYPEPTIDE 7A1","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",4,"TYR H  95;MET H  93;THR H 114;LEU H 115","None","1.43A","3ag4J-5o6vH:undetectable","3ag4J-5o6vH:undetectable"],["3CYX_A_ROCA201_3","HIV-1 PROTEASE;HIV-1 PROTEASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 417;ALA A 420;ASP A 422;GLY A 191;VAL A 192","None","0.71A","3cyxB-5o6vA:undetectable","3cyxB-5o6vA:21.88"],["3DL9_B_V2HB602_0","CYTOCHROME P450 2R1","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"THR A 359;VAL A 385;ALA A 355;THR A 313;ILE A 364","None","1.25A","3dl9B-5o6vA:undetectable","3dl9B-5o6vA:undetectable"],["3MZE_A_CFXA364_2","D-ALANYL-D-ALANINE CARBOXYPEPTIDASE DACA","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",3,"SER H 168;SER H 167;HIS H 171","None","0.78A","3mzeA-5o6vH:undetectable","3mzeA-5o6vH:16.48"],["3MZE_A_CFXA364_2","D-ALANYL-D-ALANINE CARBOXYPEPTIDASE DACA","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",3,"SER H 185;SER H 186;HIS H 206","None","0.81A","3mzeA-5o6vH:undetectable","3mzeA-5o6vH:16.48"],["3OXV_B_478B200_1","HIV-1 PROTEASE;HIV-1 PROTEASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 417;ALA A 420;ASP A 422;GLY A 191;VAL A 192","None","0.80A","3oxvA-5o6vA:undetectable","3oxvA-5o6vA:24.49"],["3OXV_C_478C200_1","HIV-1 PROTEASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 417;ALA A 420;ASP A 422;GLY A 191;VAL A 192","None","0.88A","3oxvC-5o6vA:undetectable","3oxvC-5o6vA:24.49"],["3OXW_B_017B200_1","HIV-1 PROTEASE;HIV-1 PROTEASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 417;ALA A 420;ASP A 422;GLY A 191;VAL A 192","None","0.80A","3oxwA-5o6vA:undetectable","3oxwA-5o6vA:24.49"],["3OXW_D_017D200_1","HIV-1 PROTEASE;HIV-1 PROTEASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 417;ALA A 420;ASP A 422;GLY A 191;VAL A 192","None","0.75A","3oxwC-5o6vA:undetectable","3oxwC-5o6vA:24.49"],["3T3Z_C_9PLC501_1","CYTOCHROME P450 2E1","5o6v","ENVELOPE PROTEIN;SMALL ENVELOPE PROTEIN M","Tick-borne encephalitis virus",4,"PHE A 449;ALA D  45;THR D  48;LEU A 460","None","1.21A","3t3zC-5o6vA:undetectable","3t3zC-5o6vA:14.20"],["3TBG_A_RTZA2_1","CYTOCHROME P450 2D6","5o6v","ENVELOPE PROTEIN;SMALL ENVELOPE PROTEIN M","Tick-borne encephalitis virus",5,"THR D  53;VAL D  49;LEU A 460;VAL A 462;PHE A 449","None","1.39A","3tbgA-5o6vD:undetectable","3tbgA-5o6vD:9.32"],["3TBG_C_RTZC2_1","CYTOCHROME P450 2D6","5o6v","ENVELOPE PROTEIN;SMALL ENVELOPE PROTEIN M","Tick-borne encephalitis virus",5,"THR D  53;VAL D  49;LEU A 460;VAL A 462;PHE A 449","None","1.41A","3tbgC-5o6vD:undetectable","3tbgC-5o6vD:9.32"],["3TM4_A_SAMA401_1","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"HIS A 146;SER A  40;THR A  34;ASP A  46","None","0.97A","3tm4A-5o6vA:undetectable","3tm4A-5o6vA:undetectable"],["3TM4_B_SAMB401_1","TRNA (GUANINE N2-)-METHYLTRANSFERASE TRM14","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"HIS A 146;SER A  40;THR A  34;ASP A  46","None","0.99A","3tm4B-5o6vA:undetectable","3tm4B-5o6vA:undetectable"],["4PB1_A_RBVA501_1","NUPC FAMILY PROTEIN","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 177;TYR A 304;ASN A 366;GLU A 365;ASN A 367","None","1.32A","4pb1A-5o6vA:undetectable","4pb1A-5o6vA:11.41"],["4PGH_A_SAMA401_0","CAFFEIC ACID O-METHYLTRANSFERASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 369;GLY A 148;THR A 359;ASP A 149;ILE A 364","None","1.10A","4pghA-5o6vA:undetectable","4pghA-5o6vA:undetectable"],["4PGH_D_SAMD401_0","CAFFEIC ACID O-METHYLTRANSFERASE","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"GLY A 369;GLY A 148;THR A 359;ASP A 149;ILE A 364","None","1.11A","4pghD-5o6vA:undetectable","4pghD-5o6vA:undetectable"],["4URO_D_NOVD2000_1","DNA GYRASE SUBUNIT B","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"SER A   1;ASP A  42;ILE A 358;SER A 321;THR A  32","None","1.32A","4uroD-5o6vA:undetectable","4uroD-5o6vA:18.23"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"ARG A 160;ASP A  42;THR A 325;GLU A 373","None","1.01A","5btdA-5o6vA:undetectable;5btdC-5o6vA:undetectable;5btdD-5o6vA:undetectable","5btdA-5o6vA:10.41;5btdC-5o6vA:10.41;5btdD-5o6vA:18.10"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"ARG A 160;ASP A  42;THR A 325;GLU A 373","None","1.01A","5btfA-5o6vA:undetectable;5btfC-5o6vA:undetectable;5btfD-5o6vA:undetectable","5btfA-5o6vA:10.41;5btfC-5o6vA:10.41;5btfD-5o6vA:18.10"],["5JHD_E_EDTE301_0","BETA-2-MICROGLOBULIN;TCRBETA CHAIN","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"SER A  40;THR A  34;THR A  32;PRO A 362","None","1.13A","5jhdE-5o6vA:4.3;5jhdG-5o6vA:4.1","5jhdE-5o6vA:undetectable;5jhdG-5o6vA:undetectable"],["5KQY_B_017B101_2","PROTEASE E35D-DRV","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"GLY A 417;ALA A 420;ASP A 422;GLY A 191","None","0.66A","5kqyB-5o6vA:undetectable","5kqyB-5o6vA:21.88"],["5L4E_D_EDPD402_1","PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"THR A  32;SER A   1;THR A 325;SER A 321","None","0.93A","5l4eA-5o6vA:undetectable;5l4eB-5o6vA:2.8;5l4eC-5o6vA:undetectable;5l4eD-5o6vA:undetectable;5l4eE-5o6vA:undetectable","5l4eA-5o6vA:14.18;5l4eB-5o6vA:14.18;5l4eC-5o6vA:14.18;5l4eD-5o6vA:14.18;5l4eE-5o6vA:14.18"],["5L4E_D_EDPD402_1","PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL;PROTON-GATED ION CHANNEL","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"THR A 325;SER A 321;THR A  32;SER A   1","None","0.93A","5l4eA-5o6vA:undetectable;5l4eB-5o6vA:2.8;5l4eC-5o6vA:undetectable;5l4eD-5o6vA:undetectable;5l4eE-5o6vA:undetectable","5l4eA-5o6vA:14.18;5l4eB-5o6vA:14.18;5l4eC-5o6vA:14.18;5l4eD-5o6vA:14.18;5l4eE-5o6vA:14.18"],["5QGN_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",3,"VAL A 198;VAL A 131;GLN A  55","None","0.64A","5qgnA-5o6vA:undetectable","5qgnA-5o6vA:undetectable"],["5QH5_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",3,"VAL A 198;VAL A 131;GLN A  55","None","0.67A","5qh5A-5o6vA:undetectable","5qh5A-5o6vA:undetectable"],["5QHH_A_ACTA301_0","PEROXISOMAL COENZYME A DIPHOSPHATASE NUDT7","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",3,"VAL A 198;VAL A 131;GLN A  55","None","0.67A","5qhhA-5o6vA:undetectable","5qhhA-5o6vA:undetectable"],["5Z86_J_CHDJ101_0","CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","5o6v","FAB 19\/1786 - HEAVY CHAIN","Mus musculus",4,"TYR H  95;MET H  93;THR H 114;LEU H 115","None","1.42A","5z86J-5o6vH:undetectable","5z86J-5o6vH:undetectable"],["6BZO_C_FI8C1201_2","DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA;RNA POLYMERASE SIGMA FACTOR SIGA","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"LEU A 194;ASP A 133;GLN A  50;VAL A  43","None","1.45A","6bzoF-5o6vA:undetectable","6bzoF-5o6vA:undetectable"],["6DWN_B_AQ4B602_0","CYTOCHROME P450 1A1","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",5,"ILE A 358;SER A   1;PHE A  11;ASP A  42;ASP A  10","None","1.38A","6dwnB-5o6vA:undetectable","6dwnB-5o6vA:19.59"],["6FOS_B_PQNB2002_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","5o6v","ENVELOPE PROTEIN","Tick-borne encephalitis virus",4,"TRP A 235;ALA A 238;LEU A 241;ALA A  63","None","1.09A","6fosB-5o6vA:undetectable","6fosB-5o6vA:16.25"]]