SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5t5i'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	11GS_B_EAAB211_1 (GLUTATHIONE S-TRANSFERASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	TYR B 207 GLY C 202 ILE C 251 GLY C 221	None	0.77A	11gsB-5t5iB: undetectable	11gsB-5t5iB: 17.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1BDW_B_DVAB8_0 (GRAMICIDIN A)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii)	3 / 3	VAL D  60 VAL D  51 TRP D  83	None	0.99A	1bdwA-5t5iD: undetectable 1bdwB-5t5iD: undetectable	1bdwA-5t5iD: 10.42 1bdwB-5t5iD: 10.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DRE_A_MTXA161_1 (DIHYDROFOLATE REDUCTASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	ALA C 250 ASP B 211 LEU C 219 PHE C 222 ILE C 209	None	1.26A	1dreA-5t5iC: undetectable	1dreA-5t5iC: 21.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_A_EAAA223_1 (GLUTATHIONE TRANSFERASE A1-1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	PHE B 166 GLY G  35 ARG B 163 VAL G  48	None	1.05A	1gsfA-5t5iB: undetectable	1gsfA-5t5iB: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_B_EAAB223_1 (GLUTATHIONE TRANSFERASE A1-1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	PHE B 166 GLY G  35 ARG B 163 VAL G  48	None	1.05A	1gsfB-5t5iB: undetectable	1gsfB-5t5iB: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GSF_D_EAAD223_1 (GLUTATHIONE TRANSFERASE A1-1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	PHE B 166 GLY G  35 ARG B 163 VAL G  48	None	1.05A	1gsfD-5t5iB: undetectable	1gsfD-5t5iB: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HSG_B_MK1B902_1 (HIV-1 PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 10	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	0.99A	1hsgA-5t5iG: undetectable	1hsgA-5t5iG: 24.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HXB_A_ROCA100_3 (HIV-1 PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.02A	1hxbB-5t5iG: undetectable	1hxbB-5t5iG: 23.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q8J_B_C2FB802_0 (5-METHYLTETRAHYDROFO LATE S-HOMOCYSTEINE METHYLTRANSFERASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	GLY C  99 ILE C 192 GLY C 163 SER C 138 ILE C 162	None	0.93A	1q8jB-5t5iC: undetectable	1q8jB-5t5iC: 21.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RMT_C_ADNC1503_1 (CLASS B ACID PHOSPHATASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	PHE C 218 TYR B 224 LEU B 223 GLY C 247	None	0.80A	1rmtC-5t5iC: undetectable	1rmtC-5t5iC: 20.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SDU_B_MK1B902_1 (PROTEASE RETROPEPSIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 11	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.01A	1sduA-5t5iG: undetectable	1sduA-5t5iG: 25.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1SH9_B_RITB301_2 (POL POLYPROTEIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	5 / 10	ARG B 288 ASP B  18 ILE B  19 GLY B  38 ILE B  37	None None None SF4  B 501 ( 4.0A) SF4  B 501 (-4.5A)	1.05A	1sh9B-5t5iB: undetectable	1sh9B-5t5iB: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TV8_A_SAMA1501_0 (MOLYBDENUM COFACTOR BIOSYNTHESIS PROTEIN A)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	THR F 298 GLU B 173 THR F 299 VAL F 278	None	1.20A	1tv8A-5t5iF: undetectable	1tv8A-5t5iF: 22.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A1M_B_CAMB2422_0 (CYTOCHROME P450-CAM)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 8	THR B  92 VAL B  99 GLY B 100 ILE B 417	MGD  B 503 ( 4.9A) None None None	0.79A	2a1mB-5t5iB: undetectable	2a1mB-5t5iB: 21.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ACL_C_REAC503_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii)	6 / 10	ILE D  78 ALA D  30 ALA D  31 ASN D  50 ALA D  29 ILE D 107	None	1.47A	2aclC-5t5iD: undetectable	2aclC-5t5iD: 19.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOF_C_FRDC305_1 (POL POLYPROTEIN PEPTIDE INHIBITOR)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 5	GLY C 221 PRO C 270 ALA C 269 ILE C 268	None	0.90A	2aofA-5t5iC: undetectable	2aofA-5t5iC: 18.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOI_C_FRDC305_2 (POL POLYPROTEIN PEPTIDE INHIBITOR)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	4 / 5	LEU G  60 PRO G  23 VAL G  24 ILE G  45	None None None SF4  G 102 ( 3.9A)	1.02A	2aoiB-5t5iG: undetectable	2aoiB-5t5iG: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AVO_B_MK1B902_1 (POL POLYPROTEIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 9	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.06A	2avoA-5t5iG: undetectable	2avoA-5t5iG: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BR4_E_SAME301_1 (CEPHALOSPORIN HYDROXYLASE CMCI)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	3 / 3	SER C 115 ASP B 328 CYH B 309	None	1.15A	2br4E-5t5iC: undetectable	2br4E-5t5iC: 19.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HRE_B_CHDB701_0 (FERROCHELATASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	3 / 3	LYS B 140 GLY G  37 PRO G  38	None	0.91A	2hreB-5t5iB: undetectable	2hreB-5t5iB: 21.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2I30_A_SALA1100_1 (SERUM ALBUMIN)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 6	HIS C 249 PHE C 222 GLY C 256 LYS C 255	None	1.36A	2i30A-5t5iC: undetectable	2i30A-5t5iC: 16.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J9C_C_ACTC1120_0 (HYPOTHETICAL NITROGEN REGULATORY PII-LIKE PROTEIN MJ0059)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	3 / 3	LYS B  41 TYR B 291 PRO B  10	MGD  B 503 ( 3.3A) None None	1.41A	2j9cC-5t5iB: undetectable	2j9cC-5t5iB: 18.16
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OAX_F_SNLF6001_2 (MINERALOCORTICOID RECEPTOR)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 5	LEU B 103 LEU B 418 LEU B 412 MET B 339	None	0.99A	2oaxF-5t5iB: undetectable	2oaxF-5t5iB: 21.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PXC_A_SAMA500_0 (GENOME POLYPROTEIN [CONTAINS: CAPSID PROTEIN C (CORE PROTEIN) ENVELOPE PROTEIN M (MATRIX PROTEIN) MAJOR ENVELOPE PROTEIN E NON-STRUCTURAL PROTEIN 1 (NS1) NON-STRUCTURAL PROTEIN 2A (NS2A) FLAVIVIRIN PROTEASE NS2B REGULATORY SUBUNIT FLAVIVIRIN PROTEASE NS3 CATALYTIC SUBUNIT NON-STRUCTURAL PROTEIN 4A (NS4A) NON-STRUCTURAL PROTEIN 4B (NS4B) RNA-DIRECTED RNA POLYMERASE (EC 2.7.7.48) (NS5)])	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	0.90A	2pxcA-5t5iC: undetectable	2pxcA-5t5iC: 23.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5Q_B_1UNB900_1 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 9	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.12A	2r5qA-5t5iG: undetectable	2r5qA-5t5iG: 27.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R5Q_D_1UND900_1 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 9	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.12A	2r5qC-5t5iG: undetectable	2r5qC-5t5iG: 27.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VH3_A_DAHA2_1 (RANASMURFIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 9	ALA G  33 ALA B 167 SER B 162 GLY G  16 ALA G  21	None None None SF4  G 101 (-4.0A) None	1.18A	2vh3A-5t5iG: undetectable	2vh3A-5t5iG: 19.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WEK_B_DIFB1374_1 (ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 6	MET B 339 PRO B  84 ILE B  77 LEU B 421	None	1.35A	2wekB-5t5iB: 3.0	2wekB-5t5iB: 22.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Z0A_A_GLYA73_0 (NONSTRUCTURAL PROTEIN 1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter wolfeii)	4 / 5	GLN F  27 GLN F  89 ILE F  25 ARG F  23	None	1.38A	2z0aA-5t5iF: undetectable	2z0aA-5t5iF: 12.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Z9W_A_PXLA1197_1 (ASPARTATE AMINOTRANSFERASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 11	PRO B 186 LEU B 201 ASP B 206 SER B 259 ASN D   6	MGD  B 504 (-4.4A) None MGD  B 504 (-2.9A) MGD  B 504 (-3.7A) MGD  B 504 (-3.3A)	1.23A	2z9wA-5t5iB: 2.8	2z9wA-5t5iB: 21.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Z9W_B_PXLB1197_1 (ASPARTATE AMINOTRANSFERASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 11	PRO B 186 LEU B 201 ASP B 206 SER B 259 ASN D   6	MGD  B 504 (-4.4A) None MGD  B 504 (-2.9A) MGD  B 504 (-3.7A) MGD  B 504 (-3.3A)	1.23A	2z9wB-5t5iB: undetectable	2z9wB-5t5iB: 21.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BUF_A_AEGA394_0 (BETA-SECRETASE 1)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 5	ASP C  70 ILE C  21 ILE C   5 GLY C  71	None	0.88A	3bufA-5t5iC: undetectable	3bufA-5t5iC: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3C6G_A_VD3A701_1 (CYTOCHROME P450 2R1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G   5 ALA G  21 GLY G  62 THR F  57 ILE G  76	SF4  G 102 ( 4.6A) None SF4  G 102 (-4.3A) None SF4  G 101 ( 3.8A)	1.07A	3c6gA-5t5iG: undetectable	3c6gA-5t5iG: 9.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3D1Y_A_ROCA201_2 (HIV-1 PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 9	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.02A	3d1yB-5t5iG: undetectable	3d1yB-5t5iG: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K4V_D_ROCD201_1 (HIV-1 PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.03A	3k4vC-5t5iG: undetectable	3k4vC-5t5iG: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LXI_A_CAMA423_0 (CYTOCHROME P450)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 10	TYR B 207 THR B 268 LEU C 219 GLY C 221 VAL B 227	None	1.30A	3lxiA-5t5iB: undetectable	3lxiA-5t5iB: 23.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LXI_B_CAMB423_0 (CYTOCHROME P450)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 11	TYR B 207 THR B 268 LEU C 219 GLY C 221 VAL B 227	None	1.30A	3lxiB-5t5iB: undetectable	3lxiB-5t5iB: 23.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3M6V_B_SAMB465_0 (RRNA METHYLASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	PRO C 181 GLY C 182 GLY C 201 ASP C 134 LEU B 124	None	1.09A	3m6vB-5t5iC: undetectable	3m6vB-5t5iC: 19.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N3I_A_ROCA201_2 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 6	PRO B 345 ASP B 414 ILE B 365 VAL B 101	None MGD  B 503 (-3.0A) MGD  B 503 (-4.9A) None	0.88A	3n3iA-5t5iB: undetectable	3n3iA-5t5iB: 17.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N9J_B_EAAB214_1 (GLUTATHIONE S-TRANSFERASE P)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	TYR B 207 GLY C 202 ILE C 251 GLY C 221	None	0.79A	3n9jB-5t5iB: undetectable	3n9jB-5t5iB: 17.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NDU_D_ROCD100_1 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.04A	3nduC-5t5iG: undetectable	3nduC-5t5iG: 24.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NDU_D_ROCD100_2 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	0.96A	3nduD-5t5iG: undetectable	3nduD-5t5iG: 24.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PRS_A_RITA1001_1 (ENDOTHIAPEPSIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	5 / 10	ILE B 341 ASP B 414 ALA B 342 THR B 257 ILE B  37	None MGD  B 503 (-3.0A) MGD  B 503 (-3.4A) None SF4  B 501 (-4.5A)	1.16A	3prsA-5t5iB: undetectable	3prsA-5t5iB: 20.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PWR_A_ROCA401_1 (PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 12	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.01A	3pwrA-5t5iG: undetectable	3pwrA-5t5iG: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3QEL_D_QELD2_2 (GLUTAMATE [NMDA] RECEPTOR SUBUNIT EPSILON-2)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 9	ALA G  26 ILE G  20 PHE B 166 THR F 321 PRO F 319	None None None K  F 410 (-4.7A) SF4  G 102 ( 4.8A)	1.43A	3qelD-5t5iG: undetectable	3qelD-5t5iG: 12.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S45_B_478B201_1 (PROTEASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 9	ALA C 158 ILE C 192 GLY C 163 ILE C 172 ILE C 173	None	0.98A	3s45A-5t5iC: undetectable	3s45A-5t5iC: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3S_B_9PLB1_1 (CYTOCHROME P450 2A13)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 6	PHE D 100 ASN D  85 PHE B 349 THR B 372	MGD  B 503 (-3.7A) MGD  B 503 (-3.2A) None None	1.07A	3t3sB-5t5iD: undetectable	3t3sB-5t5iD: 15.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3S_E_9PLE1_1 (CYTOCHROME P450 2A13)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	PHE D 100 ASN D  85 PHE B 349 THR B 372	MGD  B 503 (-3.7A) MGD  B 503 (-3.2A) None None	1.08A	3t3sE-5t5iD: undetectable	3t3sE-5t5iD: 15.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TGV_B_BEZB160_0 (HEME-BINDING PROTEIN HUTZ)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	4 / 4	LEU G   5 GLY G   4 LEU G  78 GLU G  79	SF4  G 102 ( 4.6A) None None None	1.09A	3tgvB-5t5iG: undetectable	3tgvB-5t5iG: 19.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_A_ACTA502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 5	TYR B  87 VAL B 340 SER B 343 GLY B 346	None None MGD  B 503 (-2.7A) None	1.45A	3v4tA-5t5iB: undetectable 3v4tD-5t5iB: undetectable	3v4tA-5t5iB: 24.20 3v4tD-5t5iB: 24.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9N_B_CAMB1420_0 (CYTOCHROME P450)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 10	TYR B 207 THR B 268 LEU C 219 GLY C 221 VAL B 227	None	1.29A	4c9nB-5t5iB: undetectable	4c9nB-5t5iB: 22.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C9P_A_CAMA423_0 (CYTOCHROME P450)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 9	TYR B 207 THR B 268 LEU C 219 GLY C 221 VAL B 227	None	1.34A	4c9pA-5t5iB: undetectable	4c9pA-5t5iB: 22.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_A_MTLA870_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 8	ASN B  33 ILE B  19 ASN B   6 ASP B  17	None	1.03A	4d33A-5t5iB: undetectable	4d33A-5t5iB: 21.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EJG_A_NCTA501_1 (CYTOCHROME P450 2A13)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 7	PHE C  26 ALA C  18 THR C  76 LEU C   6	None	1.04A	4ejgA-5t5iC: undetectable	4ejgA-5t5iC: 17.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HYT_A_OBNA1104_2 (SODIUM/POTASSIUM-TRA NSPORTING ATPASE SUBUNIT ALPHA-1)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 5	PRO B 186 ASP B 185 ILE B 256 VAL B 147	MGD  B 504 (-4.4A) MGD  B 504 (-3.1A) None None	1.25A	4hytA-5t5iB: 3.2	4hytA-5t5iB: 17.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J5J_B_478B401_2 (PROTEASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 10	ASN C  95 ILE C  79 VAL C  73 GLY C  92 VAL C  98	None	1.06A	4j5jB-5t5iC: undetectable	4j5jB-5t5iC: 16.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JVL_A_ESTA702_1 (ESTROGEN SULFOTRANSFERASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter wolfeii)	4 / 9	TYR F 156 CYH F 157 HIS F 173 ILE F 209	None SF4  F 407 (-2.2A) None None	1.18A	4jvlA-5t5iF: undetectable	4jvlA-5t5iF: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KIC_A_SAMA401_0 (METHYLTRANSFERASE MPPJ)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	GLY C 247 GLY C 256 ILE C 251 ARG B 214 PHE C 245	None	0.87A	4kicA-5t5iC: undetectable	4kicA-5t5iC: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KIC_B_SAMB401_0 (METHYLTRANSFERASE MPPJ)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	GLY C 247 GLY C 256 ILE C 251 ARG B 214 PHE C 245	None	0.88A	4kicB-5t5iC: undetectable	4kicB-5t5iC: 21.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MMC_A_29JA603_1 (TRANSPORTER)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 10	TYR B 207 ASP B 267 TYR C 135 GLY C 202 GLY B 261	None	1.45A	4mmcA-5t5iB: undetectable	4mmcA-5t5iB: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R29_C_SAMC301_0 (UNCHARACTERIZED PROTEIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	ALA C 200 ALA C 250 GLY C 221 PHE C 222 GLU B 208	None	1.24A	4r29C-5t5iC: undetectable	4r29C-5t5iC: 24.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R82_A_ACTA205_0 (OXIDOREDUCTASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 5	GLY B  13 ARG B 395 GLU B 397 PHE B 136	None	1.14A	4r82A-5t5iB: undetectable 4r82B-5t5iB: undetectable	4r82A-5t5iB: 18.56 4r82B-5t5iB: 18.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UDC_A_DEXA1778_2 (GLUCOCORTICOID RECEPTOR)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	3 / 3	MET B 287 GLN B 298 TYR B 394	None	1.12A	4udcA-5t5iB: undetectable	4udcA-5t5iB: 20.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YPM_A_BO2A801_1 (LON PROTEASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	6 / 12	THR B 294 THR B 301 GLY B 120 PRO B 121 SER B 122 ALA B 125	None	1.45A	4ypmA-5t5iB: undetectable	4ypmA-5t5iB: 22.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE1_A_X2NA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 5	VAL G  52 TYR B 148 ILE B 182 PRO G  72	None	1.30A	4ze1A-5t5iG: undetectable	4ze1A-5t5iG: 10.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZB_E_ACTE403_0 (PROTON-GATED ION CHANNEL)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	3 / 3	ARG B 264 TYR C 135 GLU C 161	None	0.70A	4zzbE-5t5iB: undetectable	4zzbE-5t5iB: 21.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B6I_A_ADNA302_1 (FLUORINASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 7	THR B 301 TYR B 306 PRO B 307 SER B 304	None	1.16A	5b6iA-5t5iB: undetectable	5b6iA-5t5iB: 20.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	ALA C 254 ASP B 267 ARG B 264 GLU C 161	None	1.02A	5bs8A-5t5iC: undetectable 5bs8B-5t5iC: undetectable 5bs8C-5t5iC: undetectable	5bs8A-5t5iC: 20.75 5bs8B-5t5iC: 21.25 5bs8C-5t5iC: 20.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	ALA C 254 ASP B 267 ARG B 264 GLU C 161	None	1.02A	5btdA-5t5iC: undetectable 5btdB-5t5iC: undetectable 5btdC-5t5iC: undetectable	5btdA-5t5iC: 20.75 5btdB-5t5iC: 21.25 5btdC-5t5iC: 20.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	ALA C 254 ASP B 267 ARG B 264 GLU C 161	None	0.99A	5btdA-5t5iC: undetectable 5btdC-5t5iC: undetectable 5btdD-5t5iC: undetectable	5btdA-5t5iC: 20.75 5btdC-5t5iC: 20.75 5btdD-5t5iC: 21.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_H_SAMH301_1 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 5	THR B  92 GLU B 366 HIS B 368 ASP B 414	MGD  B 503 ( 4.9A) MGD  B 503 (-2.9A) MGD  B 503 (-4.4A) MGD  B 503 (-3.0A)	1.27A	5c0oH-5t5iB: 2.1	5c0oH-5t5iB: 20.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDN_N_EVPN2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	4 / 6	SER G  70 GLU G  69 GLY G  37 GLY G  35	SF4  G 101 ( 4.4A) None None None	0.87A	5cdnR-5t5iG: undetectable 5cdnS-5t5iG: undetectable	5cdnR-5t5iG: 12.05 5cdnS-5t5iG: 19.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDN_O_EVPO2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 6	GLY C  71 ASP C  70 ARG C  91 GLY C  92	None	0.91A	5cdnC-5t5iC: undetectable 5cdnD-5t5iC: undetectable	5cdnC-5t5iC: 21.10 5cdnD-5t5iC: 23.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CDN_P_EVPP2101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	4 / 6	GLY C  71 ASP C  70 ARG C  91 GLY C  92	None	0.93A	5cdnT-5t5iC: undetectable 5cdnU-5t5iC: undetectable	5cdnT-5t5iC: 21.10 5cdnU-5t5iC: 23.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DPD_A_SAMA601_0 (PROTEIN LYSINE METHYLTRANSFERASE 1)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	GLY C  99 GLN C 119 ILE C 107 VAL C  94 VAL C 109	None	1.12A	5dpdA-5t5iC: undetectable	5dpdA-5t5iC: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DPD_B_SAMB601_0 (PROTEIN LYSINE METHYLTRANSFERASE 1)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	TYR C 135 GLY C 182 ILE C 209 VAL C 196 VAL C 211	None	1.17A	5dpdB-5t5iC: undetectable	5dpdB-5t5iC: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_A_SAMA4001_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	0.95A	5ehiA-5t5iC: undetectable	5ehiA-5t5iC: 22.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EHI_C_SAMC4000_0 (NS5 METHYLTRANSFERASE DENGUE VIRUS)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	1.03A	5ehiC-5t5iC: undetectable	5ehiC-5t5iC: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EIW_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	0.98A	5eiwA-5t5iC: undetectable	5eiwA-5t5iC: 22.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EKX_A_SAMA301_0 (NS5 METHYLTRANSFERASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	0.94A	5ekxA-5t5iC: undetectable	5ekxA-5t5iC: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESG_A_1YNA701_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	GLU B  46 ILE D  11 GLY G  51 THR B  31 HIS B  44	None	1.36A	5esgA-5t5iB: undetectable	5esgA-5t5iB: 22.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EWJ_D_QELD503_1 (NMDA GLUTAMATE RECEPTOR SUBUNIT GLUTAMATE RECEPTOR IONOTROPIC, NMDA 2B)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	ALA G  26 ILE G  20 PHE B 166 THR F 321 PRO F 319	None None None K  F 410 (-4.7A) SF4  G 102 ( 4.8A)	1.41A	5ewjC-5t5iG: undetectable 5ewjD-5t5iG: undetectable	5ewjC-5t5iG: 11.24 5ewjD-5t5iG: 12.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_A_REAA602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	5 / 12	ILE B 270 ARG B 214 PHE B 252 LEU B 250 THR B 257	None	1.37A	5fhzA-5t5iB: 2.1	5fhzA-5t5iB: 20.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5I73_A_68PA705_1 (SODIUM-DEPENDENT SEROTONIN TRANSPORTER)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 9	ARG C 141 ALA B 125 GLN B 127 GLU C 161 ILE B 266	None	1.34A	5i73A-5t5iC: undetectable	5i73A-5t5iC: 17.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KKZ_E_ASCE1004_0 (CYTOCHROME B UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 7	HIS B 160 ILE B 249 VAL B 146 TYR B 148	None	1.25A	5kkzC-5t5iB: undetectable 5kkzE-5t5iB: undetectable	5kkzC-5t5iB: 19.29 5kkzE-5t5iB: 22.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KKZ_K_ASCK1004_0 (CYTOCHROME B UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 7	ILE B 249 VAL B 146 TYR B 148 HIS B 160	None	1.26A	5kkzK-5t5iB: undetectable 5kkzQ-5t5iB: undetectable	5kkzK-5t5iB: 22.49 5kkzQ-5t5iB: 19.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KKZ_O_ASCO1004_0 (CYTOCHROME B UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 7	HIS B 160 ILE B 249 VAL B 146 TYR B 148	None	1.17A	5kkzM-5t5iB: undetectable 5kkzO-5t5iB: undetectable	5kkzM-5t5iB: 19.29 5kkzO-5t5iB: 22.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5KR2_C_ROCC101_2 (PROTEASE PR5-SQV)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter wolfeii)	5 / 9	LEU G  60 ILE G  76 PRO G  23 VAL G  24 ILE G  45	None SF4  G 101 ( 3.8A) None None SF4  G 102 ( 3.9A)	1.07A	5kr2D-5t5iG: undetectable	5kr2D-5t5iG: 24.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF7_H_6V8H305_0 (PROTEASOME SUBUNIT BETA TYPE-3 PROTEASOME SUBUNIT BETA TYPE-7)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter wolfeii)	5 / 11	THR F  57 GLU F 275 ALA F  53 GLY F  52 LEU F 301	None None None None SF4  F 402 ( 4.9A)	1.05A	5lf7H-5t5iF: undetectable 5lf7I-5t5iF: undetectable	5lf7H-5t5iF: 20.74 5lf7I-5t5iF: 19.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF7_V_6V8V303_0 (PROTEASOME SUBUNIT BETA TYPE-3 PROTEASOME SUBUNIT BETA TYPE-7)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter wolfeii)	5 / 11	THR F  57 GLU F 275 ALA F  53 GLY F  52 LEU F 301	None None None None SF4  F 402 ( 4.9A)	1.02A	5lf7V-5t5iF: undetectable 5lf7W-5t5iF: undetectable	5lf7V-5t5iF: 20.74 5lf7W-5t5iF: 19.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5MUR_E_PFLE406_1 (PROTON-GATED ION CHANNEL)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 10	ILE C 128 ILE C 126 ILE C 171 ILE C 173 ILE C 172	None	0.96A	5murE-5t5iC: undetectable	5murE-5t5iC: 15.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NJV_D_SAMD301_0 (NS5)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter wolfeii; Methanothermobac ter wolfeii)	5 / 12	GLY C 111 GLY C 133 GLY C 114 ASP D  93 ASP C 131	None	1.02A	5njvD-5t5iC: undetectable	5njvD-5t5iC: 19.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ODC_G_ACTG703_0 (HETERODISULFIDE REDUCTASE, SUBUNIT A HETERODISULFIDE REDUCTASE, SUBUNIT B HETERODISULFIDE REDUCTASE, SUBUNIT C)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 4	GLU C 217 ARG B 205 ARG C 199 GLU B 208	None	1.47A	5odcB-5t5iC: undetectable 5odcC-5t5iC: undetectable 5odcG-5t5iC: 2.0	5odcB-5t5iC: 23.44 5odcC-5t5iC: 18.66 5odcG-5t5iC: 20.06
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5V4V_B_NCAB402_0 (NADPH DEHYDROGENASE 3)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 8	THR B 114 PHE D 100 PRO D  98 TYR B  87	MGD  B 503 ( 3.9A) MGD  B 503 (-3.7A) None None	1.32A	5v4vB-5t5iB: undetectable	5v4vB-5t5iB: 23.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AG0_A_ACRA608_0 (ALPHA-AMYLASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 6	GLY B 120 GLN B 127 TYR B 319 TYR B 308	None	1.08A	6ag0A-5t5iB: undetectable	6ag0A-5t5iB: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AG0_C_ACRC606_0 (ALPHA-AMYLASE)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B (Methanothermobac ter sp. CaT2)	4 / 6	GLY B 120 GLN B 127 TYR B 319 TYR B 308	None	1.09A	6ag0C-5t5iB: undetectable	6ag0C-5t5iB: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C2M_A_SUEA1202_0 (NS3 PROTEASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	GLY C 118 VAL C  94 ILE C 192 GLY C 163 ALA C 158	None	1.13A	6c2mA-5t5iC: undetectable	6c2mA-5t5iC: 14.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C2M_B_SUEB1202_0 (NS3 PROTEASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	GLY C 118 VAL C  94 ILE C 192 GLY C 163 ALA C 158	None	1.12A	6c2mB-5t5iC: undetectable	6c2mB-5t5iC: 14.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C2M_D_SUED1202_0 (NS3 PROTEASE)	5t5i	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter wolfeii)	5 / 12	GLY C 118 VAL C  94 ILE C 192 GLY C 163 ALA C 158	None	1.00A	6c2mD-5t5iC: undetectable	6c2mD-5t5iC: 14.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CI6_A_NBOA607_1 (SERUM ALBUMIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 7	ASN B 327 ALA D  96 GLU B 323 LEU B 330	None	1.09A	6ci6A-5t5iB: undetectable	6ci6A-5t5iB: 9.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6G9B_B_IXXB705_1 (ENVELOPE GLYCOPROTEIN,ENVELOP E GLYCOPROTEIN ENVELOPE GLYCOPROTEIN)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDF (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 5	ARG B 174 ALA F 273 GLN F 268 ILE F 266	None	1.45A	6g9bA-5t5iB: undetectable 6g9bB-5t5iB: undetectable	6g9bA-5t5iB: 12.31 6g9bB-5t5iB: 11.01
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GBN_C_ADNC501_2 (-)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	4 / 5	THR B 372 THR B 114 HIS B 290 GLY D  81	None MGD  B 503 ( 3.9A) MGD  B 504 (-3.5A) None	1.09A	6gbnC-5t5iB: undetectable	6gbnC-5t5iB: 21.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GNE_A_ACRA602_1 (-)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDD TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT FWDG (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	VAL G  73 GLN D  34 PRO B 158 CYH G  15 GLY G  14	None None SF4  B 501 ( 4.3A) SF4  G 101 (-2.2A) SF4  G 101 ( 3.9A)	1.11A	6gneA-5t5iG: undetectable	6gneA-5t5iG: 10.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GNG_B_QPSB601_3 (-)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	3 / 3	ASP B 185 ASP B 204 ASN C 160	MGD  B 504 (-3.1A) None None	0.64A	6gngB-5t5iB: undetectable	6gngB-5t5iB: 21.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6H0F_H_Y70H502_0 (IKAROS (IKZF1) PROTEIN CEREBLON)	5t5i	TUNGSTEN FORMYLMETHANOFURAN DEHYDROGENASE SUBUNIT B TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT C (Methanothermobac ter sp. CaT2; Methanothermobac ter wolfeii)	5 / 12	ASN C  75 PRO C  15 GLU C  17 PHE C  52 ASN B 332	None	1.44A	6h0fH-5t5iC: undetectable 6h0fI-5t5iC: undetectable	6h0fH-5t5iC: 11.85 6h0fI-5t5iC: 11.11