SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5tf0'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DF7_A_MTXA501_2 (DIHYDROFOLATE REDUCTASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	TRP A 566 ARG A 560 THR A 565	None	0.95A	1df7A-5tf0A: 1.3	1df7A-5tf0A: 11.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GMK_A_DVAA8_0 (GRAMICIDIN A)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 4	VAL A 171 TRP A 437 TRP A 168	None	1.30A	1gmkA-5tf0A: undetectable 1gmkB-5tf0A: undetectable	1gmkA-5tf0A: 1.58 1gmkB-5tf0A: 1.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GMK_C_DVAC8_0 (GRAMICIDIN A)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 4	VAL A 171 TRP A 437 TRP A 168	None	1.27A	1gmkC-5tf0A: undetectable 1gmkD-5tf0A: undetectable	1gmkC-5tf0A: 1.58 1gmkD-5tf0A: 1.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JHO_A_NIOA991_1 (NICOTINATE MONONUCLEOTIDE:5,6-D IMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.12A	1jhoA-5tf0A: 2.4	1jhoA-5tf0A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JHR_A_NIOA991_1 (NICOTINATE MONONUCLEOTIDE:5,6-D IMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.16A	1jhrA-5tf0A: 2.1	1jhrA-5tf0A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1KT3_A_RTLA184_0 (PLASMA RETINOL-BINDING PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	LEU A 107 LEU A 84 LEU A 96 GLN A 94	None	1.10A	1kt3A-5tf0A: undetectable	1kt3A-5tf0A: 13.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5K_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.14A	1l5kA-5tf0A: undetectable	1l5kA-5tf0A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5L_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.13A	1l5lA-5tf0A: undetectable	1l5lA-5tf0A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5M_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.14A	1l5mA-5tf0A: 0.5	1l5mA-5tf0A: 19.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_G_AG2G7003_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 6	LEU A 51 ASP A 320 GLY A 287 ARG A 280	None	0.77A	1mt1G-5tf0A: undetectable 1mt1J-5tf0A: undetectable	1mt1G-5tf0A: 6.25 1mt1J-5tf0A: 9.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_H_AG2H7012_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 6	ARG A 280 LEU A 51 ASP A 320 GLY A 287	None	0.80A	1n13H-5tf0A: undetectable 1n13K-5tf0A: undetectable	1n13H-5tf0A: 9.31 1n13K-5tf0A: 6.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_J_AG2J7013_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	LEU A 51 ASP A 320 GLY A 287 ARG A 280	None	0.81A	1n13G-5tf0A: undetectable 1n13J-5tf0A: undetectable	1n13G-5tf0A: 6.25 1n13J-5tf0A: 9.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NBH_A_SAMA293_1 (GLYCINE N-METHYLTRANSFERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	ARG A 708 ASP A 178 ASN A 175	None	0.95A	1nbhA-5tf0A: undetectable	1nbhA-5tf0A: 18.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NBH_D_SAMD3293_1 (GLYCINE N-METHYLTRANSFERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	ARG A 708 ASP A 178 ASN A 175	None	0.94A	1nbhD-5tf0A: undetectable	1nbhD-5tf0A: 18.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1OLT_A_SAMA501_0 (OXYGEN-INDEPENDENT COPROPORPHYRINOGEN III OXIDASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLU A 355 ASP A 320 GLY A 287 ARG A 280 ASP A 286	None	1.38A	1oltA-5tf0A: undetectable	1oltA-5tf0A: 20.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VPT_A_SAMA400_0 (VP39)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	TYR A 698 ILE A 758 GLY A 759 GLY A 651 VAL A 681	None	1.08A	1vptA-5tf0A: undetectable	1vptA-5tf0A: 19.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XR2_B_C2FB1201_0 (5-METHYLTETRAHYDROPT EROYLTRIGLUTAMATE--H OMOCYSTEINE METHYLTRANSFERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 8	THR A 229 SER A 528 ARG A 167 GLU A 173	None	1.35A	1xr2B-5tf0A: undetectable	1xr2B-5tf0A: 21.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A58_B_RBFB301_1 (6,7-DIMETHYL-8-RIBIT YLLUMAZINE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ILE A 208 LEU A 202 ALA A 144 GLY A 192 SER A 191	None	1.08A	2a58A-5tf0A: 3.9 2a58B-5tf0A: 4.1	2a58A-5tf0A: 12.52 2a58B-5tf0A: 12.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A58_C_RBFC302_1 (6,7-DIMETHYL-8-RIBIT YLLUMAZINE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ILE A 208 LEU A 202 ALA A 144 GLY A 192 SER A 191	None	1.09A	2a58B-5tf0A: 4.1 2a58C-5tf0A: 4.1	2a58B-5tf0A: 12.52 2a58C-5tf0A: 12.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2A58_E_RBFE304_1 (6,7-DIMETHYL-8-RIBIT YLLUMAZINE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ILE A 208 LEU A 202 ALA A 144 GLY A 192 SER A 191	None	1.08A	2a58D-5tf0A: 4.2 2a58E-5tf0A: 4.1	2a58D-5tf0A: 12.52 2a58E-5tf0A: 12.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FCN_A_DVAA35_0 (UBIQUITIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 4	GLN A 94 GLU A 99 ILE A 98 PRO A 106	None	1.44A	2fcnA-5tf0A: undetectable	2fcnA-5tf0A: 7.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OIP_E_MTXE621_1 (CHAIN A, CRYSTAL STRUCTURE OF DHFR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ALA A 144 LEU A 202 LYS A 203 ILE A 108 LEU A 362	None	0.80A	2oipE-5tf0A: undetectable	2oipE-5tf0A: 22.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OKC_B_SAMB500_0 (TYPE I RESTRICTION ENZYME STYSJI M PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ILE A 152 GLY A 80 GLY A 110 PRO A 106 PHE A 363	None	1.18A	2okcB-5tf0A: undetectable	2okcB-5tf0A: 22.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHF_A_ACTA509_0 (CHORISMATE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	ARG A 529 GLN A 538 PRO A 535	None	0.89A	2qhfA-5tf0A: undetectable	2qhfA-5tf0A: 19.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2UXO_B_TACB1211_1 (HTH-TYPE TRANSCRIPTIONAL REGULATOR TTGR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	LEU A 516 LEU A 592 LEU A 541 ILE A 463 VAL A 511	None	1.18A	2uxoB-5tf0A: undetectable	2uxoB-5tf0A: 14.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YVL_B_SAMB602_0 (HYPOTHETICAL PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ILE A 105 GLY A 49 GLY A 76 ALA A 97 PHE A 328	None	1.14A	2yvlB-5tf0A: undetectable	2yvlB-5tf0A: 15.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_G_SVRG506_3 (PHOSPHOLIPASE A2)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	PRO A 709 PHE A 650 LYS A 711	None	1.21A	3bjwG-5tf0A: undetectable	3bjwG-5tf0A: 9.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BOG_D_DHID8_0 (6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 4	SER A 163 GLY A 219 GLY A 176 GLY A 174	None	0.88A	3bogB-5tf0A: undetectable 3bogD-5tf0A: undetectable	3bogB-5tf0A: undetectable 3bogD-5tf0A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_A_SAMA300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.00A	3eeyA-5tf0A: undetectable	3eeyA-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_B_SAMB300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.00A	3eeyB-5tf0A: undetectable	3eeyB-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_C_SAMC300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.00A	3eeyC-5tf0A: 3.2	3eeyC-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_D_SAMD300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.01A	3eeyD-5tf0A: undetectable	3eeyD-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_E_SAME300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.02A	3eeyE-5tf0A: undetectable	3eeyE-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_F_SAMF300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.03A	3eeyF-5tf0A: 2.5	3eeyF-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_H_SAMH300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.03A	3eeyH-5tf0A: undetectable	3eeyH-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_I_SAMI300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.01A	3eeyI-5tf0A: undetectable	3eeyI-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_J_SAMJ300_0 (PUTATIVE RRNA METHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 169 ASP A 165 ILE A 123 GLY A 126 THR A 558	None	1.03A	3eeyJ-5tf0A: undetectable	3eeyJ-5tf0A: 13.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HJ3_B_MTXB609_1 (CHAIN A, CRYSTAL STRUCTURE OF DHFR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ALA A 144 LEU A 202 LYS A 203 ILE A 108 LEU A 362	None	0.92A	3hj3B-5tf0A: undetectable	3hj3B-5tf0A: 20.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_A_PZIA802_0 (GLUTAMATE RECEPTOR 2)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	ASP A 322 ASN A 52 SER A 297	None	0.75A	3lslA-5tf0A: undetectable 3lslD-5tf0A: undetectable	3lslA-5tf0A: 17.03 3lslD-5tf0A: 17.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_D_PZID802_0 (GLUTAMATE RECEPTOR 2)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	SER A 297 ASP A 322 ASN A 52	None	0.84A	3lslA-5tf0A: undetectable 3lslD-5tf0A: undetectable	3lslA-5tf0A: 17.03 3lslD-5tf0A: 17.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_G_PZIG801_0 (GLUTAMATE RECEPTOR 2)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	PRO A 572 SER A 404 ASN A 401	None	0.82A	3lslG-5tf0A: undetectable	3lslG-5tf0A: 17.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NUO_B_478B478_2 (PROTEASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 452 VAL A 461 GLY A 589 ILE A 588 ILE A 463	None	0.87A	3nuoB-5tf0A: undetectable	3nuoB-5tf0A: 8.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_E_ACTE503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	GLN A 612 THR A 563 ASN A 609	None	0.85A	3v4tE-5tf0A: undetectable	3v4tE-5tf0A: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VAS_B_ADNB401_2 (PUTATIVE ADENOSINE KINASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 5	LEU A 592 ALA A 587 THR A 555 PHE A 396	None	1.03A	3vasB-5tf0A: undetectable	3vasB-5tf0A: 20.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E1G_A_LNLA701_2 (PROSTAGLANDIN G/H SYNTHASE 2)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 5	ARG A 529 VAL A 171 LEU A 125 SER A 172	None	1.38A	4e1gA-5tf0A: undetectable	4e1gA-5tf0A: 19.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J4V_A_SVRA301_1 (NUCLEOCAPSID PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	GLY A 221 ASN A 261 ALA A 268 VAL A 230 MET A 232	None	1.37A	4j4vA-5tf0A: undetectable	4j4vA-5tf0A: 15.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J4V_B_SVRB301_1 (NUCLEOCAPSID PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	GLY A 221 ASN A 261 ALA A 268 VAL A 230 MET A 232	None	1.38A	4j4vB-5tf0A: 0.0	4j4vB-5tf0A: 15.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J4V_D_SVRD301_1 (NUCLEOCAPSID PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	GLY A 221 ASN A 261 ALA A 268 VAL A 230 MET A 232	None	1.37A	4j4vD-5tf0A: undetectable 4j4vE-5tf0A: undetectable	4j4vD-5tf0A: 15.58 4j4vE-5tf0A: 15.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4J4V_E_SVRE301_1 (NUCLEOCAPSID PROTEIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	GLY A 221 ASN A 261 ALA A 268 VAL A 230 MET A 232	None	1.42A	4j4vA-5tf0A: 0.0 4j4vE-5tf0A: undetectable	4j4vA-5tf0A: 15.58 4j4vE-5tf0A: 15.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_1 (S-ADENOSYLMETHIONINE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 8	HIS A 115 PRO A 124 ALA A 143 TYR A 193	None	0.99A	4k0bB-5tf0A: undetectable	4k0bB-5tf0A: 21.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KQI_A_NIOA403_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 169 GLY A 176 LEU A 125 SER A 163 GLY A 174	None	1.22A	4kqiA-5tf0A: undetectable	4kqiA-5tf0A: 19.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KY8_B_MTXB603_1 (BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLA TE REDUCTASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ALA A 144 LEU A 202 LYS A 203 ILE A 108 LEU A 362	None	1.02A	4ky8B-5tf0A: undetectable	4ky8B-5tf0A: 20.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KY8_C_MTXC603_1 (BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLA TE REDUCTASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ALA A 144 LEU A 202 LYS A 203 ILE A 108 LEU A 362	None	1.00A	4ky8C-5tf0A: undetectable	4ky8C-5tf0A: 20.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KY8_D_MTXD603_1 (BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLA TE REDUCTASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ALA A 144 LEU A 202 LYS A 203 ILE A 108 LEU A 362	None	1.00A	4ky8D-5tf0A: undetectable	4ky8D-5tf0A: 20.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L7I_B_SAMB501_1 (S-ADENOSYLMETHIONINE SYNTHASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 8	HIS A 115 PRO A 124 ALA A 143 TYR A 193	None	0.95A	4l7iB-5tf0A: undetectable	4l7iB-5tf0A: 21.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OK1_A_198A1001_1 (ANDROGEN RECEPTOR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	LEU A 499 GLY A 468 LEU A 516 ILE A 512 VAL A 552	None	1.13A	4ok1A-5tf0A: undetectable	4ok1A-5tf0A: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OK1_A_198A1001_2 (ANDROGEN RECEPTOR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 8	LEU A 77 ASN A 52 MET A 343 ILE A 296	None	0.97A	4ok1A-5tf0A: undetectable	4ok1A-5tf0A: 14.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVL_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qvlK-5tf0A: undetectable 4qvlL-5tf0A: undetectable	4qvlK-5tf0A: 13.67 4qvlL-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVL_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qvlY-5tf0A: undetectable 4qvlZ-5tf0A: undetectable	4qvlY-5tf0A: 13.67 4qvlZ-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qvmK-5tf0A: undetectable 4qvmL-5tf0A: undetectable	4qvmK-5tf0A: 13.98 4qvmL-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QVM_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qvmY-5tf0A: undetectable 4qvmZ-5tf0A: undetectable	4qvmY-5tf0A: 13.98 4qvmZ-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW1_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qw1K-5tf0A: undetectable 4qw1L-5tf0A: undetectable	4qw1K-5tf0A: 13.67 4qw1L-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW1_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	4qw1Y-5tf0A: undetectable 4qw1Z-5tf0A: undetectable	4qw1Y-5tf0A: 13.67 4qw1Z-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.02A	4qw3K-5tf0A: undetectable 4qw3L-5tf0A: undetectable	4qw3K-5tf0A: 13.84 4qw3L-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QW3_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 10	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.02A	4qw3Y-5tf0A: undetectable 4qw3Z-5tf0A: undetectable	4qw3Y-5tf0A: 13.84 4qw3Z-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RVJ_B_478B101_2 (HIV-1 PROTEASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 452 VAL A 461 GLY A 589 ILE A 588 ILE A 463	None	0.88A	4rvjB-5tf0A: undetectable	4rvjB-5tf0A: 8.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RVJ_D_478D101_2 (HIV-1 PROTEASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	GLY A 452 VAL A 461 GLY A 589 ILE A 588 ILE A 463	None	0.88A	4rvjD-5tf0A: undetectable	4rvjD-5tf0A: 8.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UDC_A_DEXA1778_2 (GLUCOCORTICOID RECEPTOR)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	MET A 680 GLN A 696 TYR A 698	None	1.00A	4udcA-5tf0A: undetectable	4udcA-5tf0A: 16.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UXQ_A_0LIA1752_2 (FIBROBLAST GROWTH FACTOR RECEPTOR 4)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	VAL A 577 ILE A 513 ALA A 427 ILE A 512	None	0.75A	4uxqA-5tf0A: undetectable	4uxqA-5tf0A: 19.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X1K_D_LOCD502_2 (TUBULIN BETA CHAIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	ASN A 508 THR A 419 ALA A 421 ALA A 466 ILE A 512	None	1.14A	4x1kD-5tf0A: undetectable	4x1kD-5tf0A: 20.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XT7_A_TOPA302_1 (RV2671)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ASN A 239 ILE A 706 SER A 705 GLY A 704 GLU A 750	None None None MG A 800 ( 4.1A) None	1.42A	4xt7A-5tf0A: undetectable	4xt7A-5tf0A: 15.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZBQ_A_DIFA601_1 (SERUM ALBUMIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	VAL A 537 LEU A 545 GLY A 424 SER A 469 LEU A 499	None	1.35A	4zbqA-5tf0A: undetectable	4zbqA-5tf0A: 21.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZDY_A_1YNA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 435 ILE A 90 GLY A 110 HIS A 115 THR A 436	None	1.10A	4zdyA-5tf0A: undetectable	4zdyA-5tf0A: 22.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	ASP A 226 ARG A 170 GLY A 524 GLU A 173	None	0.84A	5btaA-5tf0A: undetectable 5btaC-5tf0A: undetectable 5btaD-5tf0A: undetectable	5btaA-5tf0A: 22.51 5btaC-5tf0A: 22.51 5btaD-5tf0A: 16.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_F_GFNF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	ASP A 226 ARG A 170 GLY A 524 GLU A 173	None	0.89A	5btfA-5tf0A: undetectable 5btfB-5tf0A: 2.9 5btfC-5tf0A: undetectable	5btfA-5tf0A: 22.51 5btfB-5tf0A: 16.92 5btfC-5tf0A: 22.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BXN_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.02A	5bxnK-5tf0A: undetectable 5bxnL-5tf0A: undetectable	5bxnK-5tf0A: 13.67 5bxnL-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BXN_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 11	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.03A	5bxnY-5tf0A: undetectable 5bxnZ-5tf0A: undetectable	5bxnY-5tf0A: 13.67 5bxnZ-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_K_BO2K301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.01A	5d0xK-5tf0A: undetectable 5d0xL-5tf0A: undetectable	5d0xK-5tf0A: 13.80 5d0xL-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5D0X_Y_BO2Y301_1 (PROTEASOME SUBUNIT BETA TYPE-5 PROTEASOME SUBUNIT BETA TYPE-6)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 9	ALA A 421 ALA A 509 GLY A 424 GLY A 468 ALA A 466	None	1.02A	5d0xY-5tf0A: undetectable 5d0xZ-5tf0A: undetectable	5d0xY-5tf0A: 13.80 5d0xZ-5tf0A: 15.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ESL_A_1YNA701_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 435 ILE A 90 GLY A 110 HIS A 115 THR A 436	None	1.13A	5eslA-5tf0A: undetectable	5eslA-5tf0A: 22.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GWX_A_SAMA301_1 (GLYCINE SARCOSINE N-METHYLTRANSFERASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	ARG A 708 ASN A 239 ASP A 178	None	0.87A	5gwxA-5tf0A: undetectable	5gwxA-5tf0A: 18.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HNX_B_TA1B902_1 (TUBULIN BETA-2B CHAIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	LEU A 534 LEU A 564 THR A 565 PRO A 166 ARG A 167	None	1.38A	5hnxB-5tf0A: 1.5	5hnxB-5tf0A: 21.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5K50_A_ACTA1403_0 (L-THREONINE 3-DEHYDROGENASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 5	SER A 191 VAL A 190 GLY A 252 ALA A 251	None	0.75A	5k50A-5tf0A: undetectable	5k50A-5tf0A: 17.85
Available target for annotated drug, i.e. matched protein structure has more than 30% sequence identity to known drug target.	5M6G_A_SORA711_0 (BETA-GLUCOSIDASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	10 / 12	LEU A 82 ASP A 112 PHE A 156 ARG A 170 LYS A 213 HIS A 214 MET A 257 MET A 323 TRP A 437 GLU A 525	None EDO A 802 (-2.9A) EDO A 802 (-4.0A) None EDO A 802 ( 3.8A) None EDO A 802 (-3.5A) EDO A 802 (-3.6A) None None	0.45A	5m6gA-5tf0A: 38.4	5m6gA-5tf0A: 32.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X80_C_SALC201_1 (UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 7	VAL A 397 VAL A 694 GLY A 651 TYR A 652	None	1.00A	5x80C-5tf0A: undetectable 5x80D-5tf0A: undetectable	5x80C-5tf0A: 15.48 5x80D-5tf0A: 15.48
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6B58_A_ACTA603_0 (FUMARATE REDUCTASE FLAVOPROTEIN SUBUNIT)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	3 / 3	TYR A 648 ASN A 576 LEU A 399	None	0.80A	6b58A-5tf0A: undetectable	6b58A-5tf0A: 23.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6E8Q_A_X2NA602_0 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	5 / 12	GLY A 435 ILE A 90 GLY A 110 HIS A 115 THR A 436	None	1.13A	6e8qA-5tf0A: undetectable	6e8qA-5tf0A: 8.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA824_0 (GEPHYRIN)	5tf0	GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN (Bacteroides intestinalis)	4 / 4	LEU A 532 ASP A 165 PRO A 166 ARG A 167	None	0.93A	6fgdA-5tf0A: 3.2	6fgdA-5tf0A: 21.16

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1DF7_A_MTXA501_2","DIHYDROFOLATE REDUCTASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"TRP A 566;ARG A 560;THR A 565","None","0.95A","1df7A-5tf0A:1.3","1df7A-5tf0A:11.74"],["1GMK_A_DVAA8_0","GRAMICIDIN A","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"VAL A 171;TRP A 437;TRP A 168","None","1.30A","1gmkA-5tf0A:undetectable;1gmkB-5tf0A:undetectable","1gmkA-5tf0A:1.58;1gmkB-5tf0A:1.58"],["1GMK_C_DVAC8_0","GRAMICIDIN A","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"VAL A 171;TRP A 437;TRP A 168","None","1.27A","1gmkC-5tf0A:undetectable;1gmkD-5tf0A:undetectable","1gmkC-5tf0A:1.58;1gmkD-5tf0A:1.58"],["1JHO_A_NIOA991_1","NICOTINATE MONONUCLEOTIDE:5,6-DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.12A","1jhoA-5tf0A:2.4","1jhoA-5tf0A:19.89"],["1JHR_A_NIOA991_1","NICOTINATE MONONUCLEOTIDE:5,6-DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.16A","1jhrA-5tf0A:2.1","1jhrA-5tf0A:19.89"],["1KT3_A_RTLA184_0","PLASMA RETINOL-BINDING PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A 107;LEU A  84;LEU A  96;GLN A  94","None","1.10A","1kt3A-5tf0A:undetectable","1kt3A-5tf0A:13.84"],["1L5K_A_NIOA991_1","NICOTINATE-NUCLEOTIDE--DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.14A","1l5kA-5tf0A:undetectable","1l5kA-5tf0A:19.89"],["1L5L_A_NIOA991_1","NICOTINATE-NUCLEOTIDE--DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.13A","1l5lA-5tf0A:undetectable","1l5lA-5tf0A:19.89"],["1L5M_A_NIOA991_1","NICOTINATE-NUCLEOTIDE--DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.14A","1l5mA-5tf0A:0.5","1l5mA-5tf0A:19.89"],["1MT1_G_AG2G7003_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A  51;ASP A 320;GLY A 287;ARG A 280","None","0.77A","1mt1G-5tf0A:undetectable;1mt1J-5tf0A:undetectable","1mt1G-5tf0A:6.25;1mt1J-5tf0A:9.31"],["1N13_H_AG2H7012_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"ARG A 280;LEU A  51;ASP A 320;GLY A 287","None","0.80A","1n13H-5tf0A:undetectable;1n13K-5tf0A:undetectable","1n13H-5tf0A:9.31;1n13K-5tf0A:6.25"],["1N13_J_AG2J7013_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A  51;ASP A 320;GLY A 287;ARG A 280","None","0.81A","1n13G-5tf0A:undetectable;1n13J-5tf0A:undetectable","1n13G-5tf0A:6.25;1n13J-5tf0A:9.31"],["1NBH_A_SAMA293_1","GLYCINE N-METHYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"ARG A 708;ASP A 178;ASN A 175","None","0.95A","1nbhA-5tf0A:undetectable","1nbhA-5tf0A:18.23"],["1NBH_D_SAMD3293_1","GLYCINE N-METHYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"ARG A 708;ASP A 178;ASN A 175","None","0.94A","1nbhD-5tf0A:undetectable","1nbhD-5tf0A:18.23"],["1OLT_A_SAMA501_0","OXYGEN-INDEPENDENT COPROPORPHYRINOGEN III OXIDASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLU A 355;ASP A 320;GLY A 287;ARG A 280;ASP A 286","None","1.38A","1oltA-5tf0A:undetectable","1oltA-5tf0A:20.65"],["1VPT_A_SAMA400_0","VP39","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"TYR A 698;ILE A 758;GLY A 759;GLY A 651;VAL A 681","None","1.08A","1vptA-5tf0A:undetectable","1vptA-5tf0A:19.82"],["1XR2_B_C2FB1201_0","5-METHYLTETRAHYDROPTEROYLTRIGLUTAMATE--HOMOCYSTEINE METHYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"THR A 229;SER A 528;ARG A 167;GLU A 173","None","1.35A","1xr2B-5tf0A:undetectable","1xr2B-5tf0A:21.57"],["2A58_B_RBFB301_1","6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE;6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ILE A 208;LEU A 202;ALA A 144;GLY A 192;SER A 191","None","1.08A","2a58A-5tf0A:3.9;2a58B-5tf0A:4.1","2a58A-5tf0A:12.52;2a58B-5tf0A:12.52"],["2A58_C_RBFC302_1","6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE;6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ILE A 208;LEU A 202;ALA A 144;GLY A 192;SER A 191","None","1.09A","2a58B-5tf0A:4.1;2a58C-5tf0A:4.1","2a58B-5tf0A:12.52;2a58C-5tf0A:12.52"],["2A58_E_RBFE304_1","6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE;6,7-DIMETHYL-8-RIBITYLLUMAZINE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ILE A 208;LEU A 202;ALA A 144;GLY A 192;SER A 191","None","1.08A","2a58D-5tf0A:4.2;2a58E-5tf0A:4.1","2a58D-5tf0A:12.52;2a58E-5tf0A:12.52"],["2FCN_A_DVAA35_0","UBIQUITIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"GLN A  94;GLU A  99;ILE A  98;PRO A 106","None","1.44A","2fcnA-5tf0A:undetectable","2fcnA-5tf0A:7.23"],["2OIP_E_MTXE621_1","CHAIN A, CRYSTAL STRUCTURE OF DHFR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 144;LEU A 202;LYS A 203;ILE A 108;LEU A 362","None","0.80A","2oipE-5tf0A:undetectable","2oipE-5tf0A:22.56"],["2OKC_B_SAMB500_0","TYPE I RESTRICTION ENZYME STYSJI M PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ILE A 152;GLY A  80;GLY A 110;PRO A 106;PHE A 363","None","1.18A","2okcB-5tf0A:undetectable","2okcB-5tf0A:22.42"],["2QHF_A_ACTA509_0","CHORISMATE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"ARG A 529;GLN A 538;PRO A 535","None","0.89A","2qhfA-5tf0A:undetectable","2qhfA-5tf0A:19.66"],["2UXO_B_TACB1211_1","HTH-TYPE TRANSCRIPTIONAL REGULATOR TTGR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"LEU A 516;LEU A 592;LEU A 541;ILE A 463;VAL A 511","None","1.18A","2uxoB-5tf0A:undetectable","2uxoB-5tf0A:14.54"],["2YVL_B_SAMB602_0","HYPOTHETICAL PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ILE A 105;GLY A  49;GLY A  76;ALA A  97;PHE A 328","None","1.14A","2yvlB-5tf0A:undetectable","2yvlB-5tf0A:15.47"],["3BJW_G_SVRG506_3","PHOSPHOLIPASE A2","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"PRO A 709;PHE A 650;LYS A 711","None","1.21A","3bjwG-5tf0A:undetectable","3bjwG-5tf0A:9.26"],["3BOG_D_DHID8_0","6.5 KDA GLYCINE-RICH ANTIFREEZE PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"SER A 163;GLY A 219;GLY A 176;GLY A 174","None","0.88A","3bogB-5tf0A:undetectable;3bogD-5tf0A:undetectable","3bogB-5tf0A:undetectable;3bogD-5tf0A:undetectable"],["3EEY_A_SAMA300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.00A","3eeyA-5tf0A:undetectable","3eeyA-5tf0A:13.18"],["3EEY_B_SAMB300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.00A","3eeyB-5tf0A:undetectable","3eeyB-5tf0A:13.18"],["3EEY_C_SAMC300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.00A","3eeyC-5tf0A:3.2","3eeyC-5tf0A:13.18"],["3EEY_D_SAMD300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.01A","3eeyD-5tf0A:undetectable","3eeyD-5tf0A:13.18"],["3EEY_E_SAME300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.02A","3eeyE-5tf0A:undetectable","3eeyE-5tf0A:13.18"],["3EEY_F_SAMF300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.03A","3eeyF-5tf0A:2.5","3eeyF-5tf0A:13.18"],["3EEY_H_SAMH300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.03A","3eeyH-5tf0A:undetectable","3eeyH-5tf0A:13.18"],["3EEY_I_SAMI300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.01A","3eeyI-5tf0A:undetectable","3eeyI-5tf0A:13.18"],["3EEY_J_SAMJ300_0","PUTATIVE RRNA METHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;ASP A 165;ILE A 123;GLY A 126;THR A 558","None","1.03A","3eeyJ-5tf0A:undetectable","3eeyJ-5tf0A:13.18"],["3HJ3_B_MTXB609_1","CHAIN A, CRYSTAL STRUCTURE OF DHFR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 144;LEU A 202;LYS A 203;ILE A 108;LEU A 362","None","0.92A","3hj3B-5tf0A:undetectable","3hj3B-5tf0A:20.94"],["3LSL_A_PZIA802_0","GLUTAMATE RECEPTOR 2","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"ASP A 322;ASN A  52;SER A 297","None","0.75A","3lslA-5tf0A:undetectable;3lslD-5tf0A:undetectable","3lslA-5tf0A:17.03;3lslD-5tf0A:17.03"],["3LSL_D_PZID802_0","GLUTAMATE RECEPTOR 2","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"SER A 297;ASP A 322;ASN A  52","None","0.84A","3lslA-5tf0A:undetectable;3lslD-5tf0A:undetectable","3lslA-5tf0A:17.03;3lslD-5tf0A:17.03"],["3LSL_G_PZIG801_0","GLUTAMATE RECEPTOR 2","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"PRO A 572;SER A 404;ASN A 401","None","0.82A","3lslG-5tf0A:undetectable","3lslG-5tf0A:17.03"],["3NUO_B_478B478_2","PROTEASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 452;VAL A 461;GLY A 589;ILE A 588;ILE A 463","None","0.87A","3nuoB-5tf0A:undetectable","3nuoB-5tf0A:8.94"],["3V4T_E_ACTE503_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"GLN A 612;THR A 563;ASN A 609","None","0.85A","3v4tE-5tf0A:undetectable","3v4tE-5tf0A:20.56"],["3VAS_B_ADNB401_2","PUTATIVE ADENOSINE KINASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A 592;ALA A 587;THR A 555;PHE A 396","None","1.03A","3vasB-5tf0A:undetectable","3vasB-5tf0A:20.61"],["4E1G_A_LNLA701_2","PROSTAGLANDIN G\/H SYNTHASE 2","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"ARG A 529;VAL A 171;LEU A 125;SER A 172","None","1.38A","4e1gA-5tf0A:undetectable","4e1gA-5tf0A:19.95"],["4J4V_A_SVRA301_1","NUCLEOCAPSID PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 221;ASN A 261;ALA A 268;VAL A 230;MET A 232","None","1.37A","4j4vA-5tf0A:undetectable","4j4vA-5tf0A:15.58"],["4J4V_B_SVRB301_1","NUCLEOCAPSID PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 221;ASN A 261;ALA A 268;VAL A 230;MET A 232","None","1.38A","4j4vB-5tf0A:0.0","4j4vB-5tf0A:15.58"],["4J4V_D_SVRD301_1","NUCLEOCAPSID PROTEIN;NUCLEOCAPSID PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 221;ASN A 261;ALA A 268;VAL A 230;MET A 232","None","1.37A","4j4vD-5tf0A:undetectable;4j4vE-5tf0A:undetectable","4j4vD-5tf0A:15.58;4j4vE-5tf0A:15.58"],["4J4V_E_SVRE301_1","NUCLEOCAPSID PROTEIN;NUCLEOCAPSID PROTEIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 221;ASN A 261;ALA A 268;VAL A 230;MET A 232","None","1.42A","4j4vA-5tf0A:0.0;4j4vE-5tf0A:undetectable","4j4vA-5tf0A:15.58;4j4vE-5tf0A:15.58"],["4K0B_B_SAMB504_1","S-ADENOSYLMETHIONINE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"HIS A 115;PRO A 124;ALA A 143;TYR A 193","None","0.99A","4k0bB-5tf0A:undetectable","4k0bB-5tf0A:21.07"],["4KQI_A_NIOA403_1","NICOTINATE-NUCLEOTIDE--DIMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 169;GLY A 176;LEU A 125;SER A 163;GLY A 174","None","1.22A","4kqiA-5tf0A:undetectable","4kqiA-5tf0A:19.65"],["4KY8_B_MTXB603_1","BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLATE REDUCTASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 144;LEU A 202;LYS A 203;ILE A 108;LEU A 362","None","1.02A","4ky8B-5tf0A:undetectable","4ky8B-5tf0A:20.98"],["4KY8_C_MTXC603_1","BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLATE REDUCTASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 144;LEU A 202;LYS A 203;ILE A 108;LEU A 362","None","1.00A","4ky8C-5tf0A:undetectable","4ky8C-5tf0A:20.98"],["4KY8_D_MTXD603_1","BIFUNCTIONAL THYMIDYLATE SYNTHASE-DIHYDROFOLATE REDUCTASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 144;LEU A 202;LYS A 203;ILE A 108;LEU A 362","None","1.00A","4ky8D-5tf0A:undetectable","4ky8D-5tf0A:20.98"],["4L7I_B_SAMB501_1","S-ADENOSYLMETHIONINE SYNTHASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"HIS A 115;PRO A 124;ALA A 143;TYR A 193","None","0.95A","4l7iB-5tf0A:undetectable","4l7iB-5tf0A:21.07"],["4OK1_A_198A1001_1","ANDROGEN RECEPTOR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"LEU A 499;GLY A 468;LEU A 516;ILE A 512;VAL A 552","None","1.13A","4ok1A-5tf0A:undetectable","4ok1A-5tf0A:14.76"],["4OK1_A_198A1001_2","ANDROGEN RECEPTOR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A  77;ASN A  52;MET A 343;ILE A 296","None","0.97A","4ok1A-5tf0A:undetectable","4ok1A-5tf0A:14.76"],["4QVL_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qvlK-5tf0A:undetectable;4qvlL-5tf0A:undetectable","4qvlK-5tf0A:13.67;4qvlL-5tf0A:15.44"],["4QVL_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qvlY-5tf0A:undetectable;4qvlZ-5tf0A:undetectable","4qvlY-5tf0A:13.67;4qvlZ-5tf0A:15.44"],["4QVM_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qvmK-5tf0A:undetectable;4qvmL-5tf0A:undetectable","4qvmK-5tf0A:13.98;4qvmL-5tf0A:15.44"],["4QVM_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qvmY-5tf0A:undetectable;4qvmZ-5tf0A:undetectable","4qvmY-5tf0A:13.98;4qvmZ-5tf0A:15.44"],["4QW1_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qw1K-5tf0A:undetectable;4qw1L-5tf0A:undetectable","4qw1K-5tf0A:13.67;4qw1L-5tf0A:15.44"],["4QW1_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","4qw1Y-5tf0A:undetectable;4qw1Z-5tf0A:undetectable","4qw1Y-5tf0A:13.67;4qw1Z-5tf0A:15.44"],["4QW3_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.02A","4qw3K-5tf0A:undetectable;4qw3L-5tf0A:undetectable","4qw3K-5tf0A:13.84;4qw3L-5tf0A:15.44"],["4QW3_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.02A","4qw3Y-5tf0A:undetectable;4qw3Z-5tf0A:undetectable","4qw3Y-5tf0A:13.84;4qw3Z-5tf0A:15.44"],["4RVJ_B_478B101_2","HIV-1 PROTEASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 452;VAL A 461;GLY A 589;ILE A 588;ILE A 463","None","0.88A","4rvjB-5tf0A:undetectable","4rvjB-5tf0A:8.80"],["4RVJ_D_478D101_2","HIV-1 PROTEASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 452;VAL A 461;GLY A 589;ILE A 588;ILE A 463","None","0.88A","4rvjD-5tf0A:undetectable","4rvjD-5tf0A:8.80"],["4UDC_A_DEXA1778_2","GLUCOCORTICOID RECEPTOR","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"MET A 680;GLN A 696;TYR A 698","None","1.00A","4udcA-5tf0A:undetectable","4udcA-5tf0A:16.49"],["4UXQ_A_0LIA1752_2","FIBROBLAST GROWTH FACTOR RECEPTOR 4","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"VAL A 577;ILE A 513;ALA A 427;ILE A 512","None","0.75A","4uxqA-5tf0A:undetectable","4uxqA-5tf0A:19.14"],["4X1K_D_LOCD502_2","TUBULIN BETA CHAIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ASN A 508;THR A 419;ALA A 421;ALA A 466;ILE A 512","None","1.14A","4x1kD-5tf0A:undetectable","4x1kD-5tf0A:20.81"],["4XT7_A_TOPA302_1","RV2671","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ASN A 239;ILE A 706;SER A 705;GLY A 704;GLU A 750","None;None;None; MG A 800 ( 4.1A);None","1.42A","4xt7A-5tf0A:undetectable","4xt7A-5tf0A:15.87"],["4ZBQ_A_DIFA601_1","SERUM ALBUMIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"VAL A 537;LEU A 545;GLY A 424;SER A 469;LEU A 499","None","1.35A","4zbqA-5tf0A:undetectable","4zbqA-5tf0A:21.77"],["4ZDY_A_1YNA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 435;ILE A  90;GLY A 110;HIS A 115;THR A 436","None","1.10A","4zdyA-5tf0A:undetectable","4zdyA-5tf0A:22.31"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"ASP A 226;ARG A 170;GLY A 524;GLU A 173","None","0.84A","5btaA-5tf0A:undetectable;5btaC-5tf0A:undetectable;5btaD-5tf0A:undetectable","5btaA-5tf0A:22.51;5btaC-5tf0A:22.51;5btaD-5tf0A:16.92"],["5BTF_F_GFNF101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"ASP A 226;ARG A 170;GLY A 524;GLU A 173","None","0.89A","5btfA-5tf0A:undetectable;5btfB-5tf0A:2.9;5btfC-5tf0A:undetectable","5btfA-5tf0A:22.51;5btfB-5tf0A:16.92;5btfC-5tf0A:22.51"],["5BXN_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.02A","5bxnK-5tf0A:undetectable;5bxnL-5tf0A:undetectable","5bxnK-5tf0A:13.67;5bxnL-5tf0A:15.44"],["5BXN_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.03A","5bxnY-5tf0A:undetectable;5bxnZ-5tf0A:undetectable","5bxnY-5tf0A:13.67;5bxnZ-5tf0A:15.44"],["5D0X_K_BO2K301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.01A","5d0xK-5tf0A:undetectable;5d0xL-5tf0A:undetectable","5d0xK-5tf0A:13.80;5d0xL-5tf0A:15.44"],["5D0X_Y_BO2Y301_1","PROTEASOME SUBUNIT BETA TYPE-5;PROTEASOME SUBUNIT BETA TYPE-6","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"ALA A 421;ALA A 509;GLY A 424;GLY A 468;ALA A 466","None","1.02A","5d0xY-5tf0A:undetectable;5d0xZ-5tf0A:undetectable","5d0xY-5tf0A:13.80;5d0xZ-5tf0A:15.44"],["5ESL_A_1YNA701_1","LANOSTEROL 14-ALPHA DEMETHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 435;ILE A  90;GLY A 110;HIS A 115;THR A 436","None","1.13A","5eslA-5tf0A:undetectable","5eslA-5tf0A:22.31"],["5GWX_A_SAMA301_1","GLYCINE SARCOSINE N-METHYLTRANSFERASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"ARG A 708;ASN A 239;ASP A 178","None","0.87A","5gwxA-5tf0A:undetectable","5gwxA-5tf0A:18.37"],["5HNX_B_TA1B902_1","TUBULIN BETA-2B CHAIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"LEU A 534;LEU A 564;THR A 565;PRO A 166;ARG A 167","None","1.38A","5hnxB-5tf0A:1.5","5hnxB-5tf0A:21.29"],["5K50_A_ACTA1403_0","L-THREONINE 3-DEHYDROGENASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"SER A 191;VAL A 190;GLY A 252;ALA A 251","None","0.75A","5k50A-5tf0A:undetectable","5k50A-5tf0A:17.85"],["5M6G_A_SORA711_0","BETA-GLUCOSIDASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",10,"LEU A  82;ASP A 112;PHE A 156;ARG A 170;LYS A 213;HIS A 214;MET A 257;MET A 323;TRP A 437;GLU A 525","None;EDO A 802 (-2.9A);EDO A 802 (-4.0A);None;EDO A 802 ( 3.8A);None;EDO A 802 (-3.5A);EDO A 802 (-3.6A);None;None","0.45A","5m6gA-5tf0A:38.4","5m6gA-5tf0A:32.50"],["5X80_C_SALC201_1","UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887;UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"VAL A 397;VAL A 694;GLY A 651;TYR A 652","None","1.00A","5x80C-5tf0A:undetectable;5x80D-5tf0A:undetectable","5x80C-5tf0A:15.48;5x80D-5tf0A:15.48"],["6B58_A_ACTA603_0","FUMARATE REDUCTASE FLAVOPROTEIN SUBUNIT","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",3,"TYR A 648;ASN A 576;LEU A 399","None","0.80A","6b58A-5tf0A:undetectable","6b58A-5tf0A:23.07"],["6E8Q_A_X2NA602_0","LANOSTEROL 14-ALPHA DEMETHYLASE","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",5,"GLY A 435;ILE A  90;GLY A 110;HIS A 115;THR A 436","None","1.13A","6e8qA-5tf0A:undetectable","6e8qA-5tf0A:8.99"],["6FGD_A_ACTA824_0","GEPHYRIN","5tf0","GLYCOSYL HYDROLASE FAMILY 3 N-TERMINAL DOMAIN PROTEIN","Bacteroides intestinalis",4,"LEU A 532;ASP A 165;PRO A 166;ARG A 167","None","0.93A","6fgdA-5tf0A:3.2","6fgdA-5tf0A:21.16"]]