SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5w4c'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_V_TRPV81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.91A	1c9sL-5w4cA: undetectable 1c9sV-5w4cA: undetectable	1c9sL-5w4cA: undetectable 1c9sV-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_E_TRPE81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 9	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.92A	1gtfD-5w4cA: undetectable 1gtfE-5w4cA: undetectable	1gtfD-5w4cA: undetectable 1gtfE-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_V_TRPV81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 12	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.96A	1gtnL-5w4cA: undetectable 1gtnV-5w4cA: undetectable	1gtnL-5w4cA: undetectable 1gtnV-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L2I_B_CCSB417_0 (ESTROGEN RECEPTOR)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	PRO A 123 PHE A 124 LYS A 32 VAL A 34	None	1.29A	1l2iB-5w4cA: undetectable	1l2iB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NV8_A_SAMA300_0 (HEMK PROTEIN)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 12	THR A 107 ILE A 36 GLY A 41 THR A 147 ALA A 335	None FAD A 401 (-4.7A) FAD A 401 (-3.2A) FAD A 401 (-4.1A) None	0.97A	1nv8A-5w4cA: undetectable	1nv8A-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P7L_C_SAMC685_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.11A	1p7lC-5w4cA: undetectable	1p7lC-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P7L_C_SAMC885_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.10A	1p7lD-5w4cA: undetectable	1p7lD-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RG9_A_SAMA385_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.09A	1rg9A-5w4cA: undetectable	1rg9A-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RG9_B_SAMB485_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.10A	1rg9B-5w4cA: undetectable	1rg9B-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RG9_C_SAMC585_0 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.11A	1rg9C-5w4cA: undetectable	1rg9C-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RG9_C_SAMC685_1 (S-ADENOSYLMETHIONINE SYNTHETASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	HIS A 278 THR A 74 PHE A 67 ASP A 316	None None None FAD A 401 (-3.0A)	1.11A	1rg9D-5w4cA: undetectable	1rg9D-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_E_TRPE81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 166 ALA A 244 THR A 161 ILE A 167 GLY A 248	None	0.94A	1utdE-5w4cA: undetectable 1utdF-5w4cA: undetectable	1utdE-5w4cA: undetectable 1utdF-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_H_TRPH81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 166 ALA A 244 THR A 161 ILE A 167 GLY A 248	None	0.91A	1utdH-5w4cA: undetectable 1utdI-5w4cA: undetectable	1utdH-5w4cA: undetectable 1utdI-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_S_TRPS81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 11	GLY A 166 ALA A 244 THR A 161 ILE A 167 GLY A 248	None	0.95A	1utdS-5w4cA: undetectable 1utdT-5w4cA: undetectable	1utdS-5w4cA: undetectable 1utdT-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NNJ_A_225A501_1 (CYTOCHROME P450 2C8)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	ALA A 195 THR A 199 VAL A 233 VAL A 235 VAL A 208	None	1.04A	2nnjA-5w4cA: undetectable	2nnjA-5w4cA: 9.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5K_A_08JA1_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	PRO A 83 VAL A 79 LEU A 73 ILE A 326	None FAD A 401 ( 3.8A) FAD A 401 (-3.9A) None	0.89A	3u5kA-5w4cA: undetectable	3u5kA-5w4cA: 19.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5K_C_08JC3_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	PRO A 83 VAL A 79 LEU A 73 ILE A 326	None FAD A 401 ( 3.8A) FAD A 401 (-3.9A) None	0.86A	3u5kC-5w4cA: undetectable	3u5kC-5w4cA: 19.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5K_D_08JD4_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	PRO A 83 VAL A 79 LEU A 73 ILE A 326	None FAD A 401 ( 3.8A) FAD A 401 (-3.9A) None	0.88A	3u5kD-5w4cA: undetectable	3u5kD-5w4cA: 19.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UBS_A_DIFA503_1 (PENTALENIC ACID SYNTHASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	LEU A 251 ALA A 241 LEU A 156 ILE A 256	None	0.67A	4ubsA-5w4cA: undetectable	4ubsA-5w4cA: 12.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZJZ_A_BEZA1001_0 (BENZOATE-COENZYME A LIGASE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	ALA A 314 GLY A 332 ALA A 45 GLY A 42	None	0.70A	4zjzA-5w4cA: undetectable	4zjzA-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.89A	5bs8A-5w4cA: undetectable 5bs8B-5w4cA: undetectable 5bs8C-5w4cA: undetectable	5bs8A-5w4cA: 10.38 5bs8B-5w4cA: 15.26 5bs8C-5w4cA: 10.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.85A	5btaA-5w4cA: undetectable 5btaC-5w4cA: undetectable 5btaD-5w4cA: undetectable	5btaA-5w4cA: 10.38 5btaC-5w4cA: 10.38 5btaD-5w4cA: 15.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.87A	5btaA-5w4cA: undetectable 5btaB-5w4cA: undetectable 5btaC-5w4cA: undetectable	5btaA-5w4cA: 10.38 5btaB-5w4cA: 15.26 5btaC-5w4cA: 10.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.86A	5btcA-5w4cA: undetectable 5btcC-5w4cA: undetectable 5btcD-5w4cA: undetectable	5btcA-5w4cA: 10.38 5btcC-5w4cA: 10.38 5btcD-5w4cA: 15.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTC_G_CPFG102_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.88A	5btcA-5w4cA: undetectable 5btcB-5w4cA: undetectable 5btcC-5w4cA: undetectable	5btcA-5w4cA: 10.38 5btcB-5w4cA: 15.26 5btcC-5w4cA: 10.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.86A	5btdA-5w4cA: undetectable 5btdB-5w4cA: undetectable 5btdC-5w4cA: undetectable	5btdA-5w4cA: 10.38 5btdB-5w4cA: 15.26 5btdC-5w4cA: 10.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.85A	5btdA-5w4cA: undetectable 5btdC-5w4cA: undetectable 5btdD-5w4cA: undetectable	5btdA-5w4cA: 10.38 5btdC-5w4cA: 10.38 5btdD-5w4cA: 15.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTF_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 7	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.87A	5btfA-5w4cA: undetectable 5btfC-5w4cA: undetectable 5btfD-5w4cA: undetectable	5btfA-5w4cA: 10.38 5btfC-5w4cA: 10.38 5btfD-5w4cA: 15.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	ARG A 99 GLY A 70 THR A 111 GLU A 60	None FAD A 401 ( 4.5A) None None	0.95A	5btgA-5w4cA: undetectable 5btgB-5w4cA: undetectable 5btgC-5w4cA: undetectable	5btgA-5w4cA: 10.38 5btgB-5w4cA: 15.26 5btgC-5w4cA: 10.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.95A	5eevA-5w4cA: undetectable 5eevB-5w4cA: undetectable	5eevA-5w4cA: undetectable 5eevB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.95A	5eewA-5w4cA: undetectable 5eewB-5w4cA: undetectable	5eewA-5w4cA: undetectable 5eewB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEX_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.94A	5eexA-5w4cA: undetectable 5eexB-5w4cA: undetectable	5eexA-5w4cA: undetectable 5eexB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEY_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.94A	5eeyA-5w4cA: undetectable 5eeyB-5w4cA: undetectable	5eeyA-5w4cA: undetectable 5eeyB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.94A	5eezA-5w4cA: undetectable 5eezB-5w4cA: undetectable	5eezA-5w4cA: undetectable 5eezB-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF0_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.95A	5ef0A-5w4cA: undetectable 5ef0B-5w4cA: undetectable	5ef0A-5w4cA: undetectable 5ef0B-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.95A	5ef1A-5w4cA: undetectable 5ef1B-5w4cA: undetectable	5ef1A-5w4cA: undetectable 5ef1B-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.94A	5ef2A-5w4cA: undetectable 5ef2B-5w4cA: undetectable	5ef2A-5w4cA: undetectable 5ef2B-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF3_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	5 / 10	GLY A 248 GLY A 166 ALA A 244 THR A 161 ILE A 167	None	0.95A	5ef3A-5w4cA: undetectable 5ef3B-5w4cA: undetectable	5ef3A-5w4cA: undetectable 5ef3B-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HRQ_K_IPHK101_0 (INSULIN A-CHAIN INSULIN B-CHAIN)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	VAL A 208 HIS A 207 HIS A 230 LEU A 227	None	1.08A	5hrqH-5w4cA: undetectable 5hrqK-5w4cA: undetectable 5hrqL-5w4cA: undetectable	5hrqH-5w4cA: undetectable 5hrqK-5w4cA: undetectable 5hrqL-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VLM_F_CVIF301_1 (REGULATORY PROTEIN TETR)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 8	ILE A 143 GLN A 305 VAL A 289 ASP A 118	None	1.15A	5vlmF-5w4cA: undetectable	5vlmF-5w4cA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GQI_A_ACTA604_0 (CYCLOHEXANONE MONOOXYGENASE FROM THERMOCRISPUM MUNICIPALE)	5w4c	THIOREDOXIN REDUCTASE (Cryptococcus neoformans)	4 / 6	PRO A 56 ILE A 109 GLY A 106 GLU A 103	None	1.12A	6gqiA-5w4cA: 10.6	6gqiA-5w4cA: undetectable

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_V_TRPV81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.91A","1c9sL-5w4cA:undetectable;1c9sV-5w4cA:undetectable","1c9sL-5w4cA:undetectable;1c9sV-5w4cA:undetectable"],["1GTF_E_TRPE81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.92A","1gtfD-5w4cA:undetectable;1gtfE-5w4cA:undetectable","1gtfD-5w4cA:undetectable;1gtfE-5w4cA:undetectable"],["1GTN_V_TRPV81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.96A","1gtnL-5w4cA:undetectable;1gtnV-5w4cA:undetectable","1gtnL-5w4cA:undetectable;1gtnV-5w4cA:undetectable"],["1L2I_B_CCSB417_0","ESTROGEN RECEPTOR","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"PRO A 123;PHE A 124;LYS A  32;VAL A  34","None","1.29A","1l2iB-5w4cA:undetectable","1l2iB-5w4cA:undetectable"],["1NV8_A_SAMA300_0","HEMK PROTEIN","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"THR A 107;ILE A  36;GLY A  41;THR A 147;ALA A 335","None;FAD A 401 (-4.7A);FAD A 401 (-3.2A);FAD A 401 (-4.1A);None","0.97A","1nv8A-5w4cA:undetectable","1nv8A-5w4cA:undetectable"],["1P7L_C_SAMC685_0","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.11A","1p7lC-5w4cA:undetectable","1p7lC-5w4cA:undetectable"],["1P7L_C_SAMC885_1","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.10A","1p7lD-5w4cA:undetectable","1p7lD-5w4cA:undetectable"],["1RG9_A_SAMA385_0","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.09A","1rg9A-5w4cA:undetectable","1rg9A-5w4cA:undetectable"],["1RG9_B_SAMB485_1","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.10A","1rg9B-5w4cA:undetectable","1rg9B-5w4cA:undetectable"],["1RG9_C_SAMC585_0","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.11A","1rg9C-5w4cA:undetectable","1rg9C-5w4cA:undetectable"],["1RG9_C_SAMC685_1","S-ADENOSYLMETHIONINE SYNTHETASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"HIS A 278;THR A  74;PHE A  67;ASP A 316","None;None;None;FAD A 401 (-3.0A)","1.11A","1rg9D-5w4cA:undetectable","1rg9D-5w4cA:undetectable"],["1UTD_E_TRPE81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 166;ALA A 244;THR A 161;ILE A 167;GLY A 248","None","0.94A","1utdE-5w4cA:undetectable;1utdF-5w4cA:undetectable","1utdE-5w4cA:undetectable;1utdF-5w4cA:undetectable"],["1UTD_H_TRPH81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 166;ALA A 244;THR A 161;ILE A 167;GLY A 248","None","0.91A","1utdH-5w4cA:undetectable;1utdI-5w4cA:undetectable","1utdH-5w4cA:undetectable;1utdI-5w4cA:undetectable"],["1UTD_S_TRPS81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 166;ALA A 244;THR A 161;ILE A 167;GLY A 248","None","0.95A","1utdS-5w4cA:undetectable;1utdT-5w4cA:undetectable","1utdS-5w4cA:undetectable;1utdT-5w4cA:undetectable"],["2NNJ_A_225A501_1","CYTOCHROME P450 2C8","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"ALA A 195;THR A 199;VAL A 233;VAL A 235;VAL A 208","None","1.04A","2nnjA-5w4cA:undetectable","2nnjA-5w4cA:9.67"],["3U5K_A_08JA1_1","BROMODOMAIN-CONTAINING PROTEIN 4","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"PRO A  83;VAL A  79;LEU A  73;ILE A 326","None;FAD A 401 ( 3.8A);FAD A 401 (-3.9A);None","0.89A","3u5kA-5w4cA:undetectable","3u5kA-5w4cA:19.70"],["3U5K_C_08JC3_1","BROMODOMAIN-CONTAINING PROTEIN 4","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"PRO A  83;VAL A  79;LEU A  73;ILE A 326","None;FAD A 401 ( 3.8A);FAD A 401 (-3.9A);None","0.86A","3u5kC-5w4cA:undetectable","3u5kC-5w4cA:19.70"],["3U5K_D_08JD4_1","BROMODOMAIN-CONTAINING PROTEIN 4","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"PRO A  83;VAL A  79;LEU A  73;ILE A 326","None;FAD A 401 ( 3.8A);FAD A 401 (-3.9A);None","0.88A","3u5kD-5w4cA:undetectable","3u5kD-5w4cA:19.70"],["4UBS_A_DIFA503_1","PENTALENIC ACID SYNTHASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"LEU A 251;ALA A 241;LEU A 156;ILE A 256","None","0.67A","4ubsA-5w4cA:undetectable","4ubsA-5w4cA:12.63"],["4ZJZ_A_BEZA1001_0","BENZOATE-COENZYME A LIGASE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ALA A 314;GLY A 332;ALA A  45;GLY A  42","None","0.70A","4zjzA-5w4cA:undetectable","4zjzA-5w4cA:undetectable"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.89A","5bs8A-5w4cA:undetectable;5bs8B-5w4cA:undetectable;5bs8C-5w4cA:undetectable","5bs8A-5w4cA:10.38;5bs8B-5w4cA:15.26;5bs8C-5w4cA:10.38"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.85A","5btaA-5w4cA:undetectable;5btaC-5w4cA:undetectable;5btaD-5w4cA:undetectable","5btaA-5w4cA:10.38;5btaC-5w4cA:10.38;5btaD-5w4cA:15.26"],["5BTA_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.87A","5btaA-5w4cA:undetectable;5btaB-5w4cA:undetectable;5btaC-5w4cA:undetectable","5btaA-5w4cA:10.38;5btaB-5w4cA:15.26;5btaC-5w4cA:10.38"],["5BTC_G_CPFG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.86A","5btcA-5w4cA:undetectable;5btcC-5w4cA:undetectable;5btcD-5w4cA:undetectable","5btcA-5w4cA:10.38;5btcC-5w4cA:10.38;5btcD-5w4cA:15.26"],["5BTC_G_CPFG102_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.88A","5btcA-5w4cA:undetectable;5btcB-5w4cA:undetectable;5btcC-5w4cA:undetectable","5btcA-5w4cA:10.38;5btcB-5w4cA:15.26;5btcC-5w4cA:10.38"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.86A","5btdA-5w4cA:undetectable;5btdB-5w4cA:undetectable;5btdC-5w4cA:undetectable","5btdA-5w4cA:10.38;5btdB-5w4cA:15.26;5btdC-5w4cA:10.38"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.85A","5btdA-5w4cA:undetectable;5btdC-5w4cA:undetectable;5btdD-5w4cA:undetectable","5btdA-5w4cA:10.38;5btdC-5w4cA:10.38;5btdD-5w4cA:15.26"],["5BTF_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.87A","5btfA-5w4cA:undetectable;5btfC-5w4cA:undetectable;5btfD-5w4cA:undetectable","5btfA-5w4cA:10.38;5btfC-5w4cA:10.38;5btfD-5w4cA:15.26"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ARG A  99;GLY A  70;THR A 111;GLU A  60","None;FAD A 401 ( 4.5A);None;None","0.95A","5btgA-5w4cA:undetectable;5btgB-5w4cA:undetectable;5btgC-5w4cA:undetectable","5btgA-5w4cA:10.38;5btgB-5w4cA:15.26;5btgC-5w4cA:10.38"],["5EEV_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.95A","5eevA-5w4cA:undetectable;5eevB-5w4cA:undetectable","5eevA-5w4cA:undetectable;5eevB-5w4cA:undetectable"],["5EEW_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.95A","5eewA-5w4cA:undetectable;5eewB-5w4cA:undetectable","5eewA-5w4cA:undetectable;5eewB-5w4cA:undetectable"],["5EEX_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.94A","5eexA-5w4cA:undetectable;5eexB-5w4cA:undetectable","5eexA-5w4cA:undetectable;5eexB-5w4cA:undetectable"],["5EEY_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.94A","5eeyA-5w4cA:undetectable;5eeyB-5w4cA:undetectable","5eeyA-5w4cA:undetectable;5eeyB-5w4cA:undetectable"],["5EEZ_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.94A","5eezA-5w4cA:undetectable;5eezB-5w4cA:undetectable","5eezA-5w4cA:undetectable;5eezB-5w4cA:undetectable"],["5EF0_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.95A","5ef0A-5w4cA:undetectable;5ef0B-5w4cA:undetectable","5ef0A-5w4cA:undetectable;5ef0B-5w4cA:undetectable"],["5EF1_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.95A","5ef1A-5w4cA:undetectable;5ef1B-5w4cA:undetectable","5ef1A-5w4cA:undetectable;5ef1B-5w4cA:undetectable"],["5EF2_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.94A","5ef2A-5w4cA:undetectable;5ef2B-5w4cA:undetectable","5ef2A-5w4cA:undetectable;5ef2B-5w4cA:undetectable"],["5EF3_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",5,"GLY A 248;GLY A 166;ALA A 244;THR A 161;ILE A 167","None","0.95A","5ef3A-5w4cA:undetectable;5ef3B-5w4cA:undetectable","5ef3A-5w4cA:undetectable;5ef3B-5w4cA:undetectable"],["5HRQ_K_IPHK101_0","INSULIN A-CHAIN;INSULIN B-CHAIN","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"VAL A 208;HIS A 207;HIS A 230;LEU A 227","None","1.08A","5hrqH-5w4cA:undetectable;5hrqK-5w4cA:undetectable;5hrqL-5w4cA:undetectable","5hrqH-5w4cA:undetectable;5hrqK-5w4cA:undetectable;5hrqL-5w4cA:undetectable"],["5VLM_F_CVIF301_1","REGULATORY PROTEIN TETR","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"ILE A 143;GLN A 305;VAL A 289;ASP A 118","None","1.15A","5vlmF-5w4cA:undetectable","5vlmF-5w4cA:undetectable"],["6GQI_A_ACTA604_0","CYCLOHEXANONE MONOOXYGENASE FROM THERMOCRISPUM MUNICIPALE","5w4c","THIOREDOXIN REDUCTASE","Cryptococcus neoformans",4,"PRO A  56;ILE A 109;GLY A 106;GLU A 103","None","1.12A","6gqiA-5w4cA:10.6","6gqiA-5w4cA:undetectable"]]