SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5x4j'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AEG_A_4APA296_1 (CYTOCHROME C PEROXIDASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 8	HIS A 107 GLY A 438 GLY A 87 ASP A 105	ZN A 502 (-3.4A) None None None	0.83A	1aegA-5x4jA: undetectable	1aegA-5x4jA: 12.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CQP_A_803A311_1 (ANTIGEN CD11A (P180))	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 10	LEU A 104 VAL A 121 LEU A 147 LYS A 18 VAL A 17	None	1.12A	1cqpA-5x4jA: 5.0 1cqpB-5x4jA: 5.2	1cqpA-5x4jA: 21.18 1cqpB-5x4jA: 21.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7B_A_HLTA4002_1 (SERUM ALBUMIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 4	ARG A 295 ALA A 298 ALA A 162 GLU A 168	None	0.93A	1e7bA-5x4jA: undetectable	1e7bA-5x4jA: 9.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7B_B_HLTB4002_1 (SERUM ALBUMIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 4	ARG A 295 ALA A 298 ALA A 162 GLU A 168	None	0.90A	1e7bB-5x4jA: undetectable	1e7bB-5x4jA: 9.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NW5_A_SAMA401_1 (MODIFICATION METHYLASE RSRI)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	3 / 3	ASP A 105 HIS A 440 ASP A 165	None ZN A 502 ( 4.8A) ZN A 501 (-2.3A)	0.89A	1nw5A-5x4jA: undetectable	1nw5A-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q6I_B_FK5B401_1 (FKBP-TYPE PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKPA)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 10	TYR A 363 ARG A 450 LEU A 405 VAL A 373 ILE A 368	None	1.41A	1q6iB-5x4jA: undetectable	1q6iB-5x4jA: 17.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_A_SAMA801_1 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 6	ARG A 11 ASP A 183 ASN A 177 GLU A 146	None	1.09A	1rjdA-5x4jA: undetectable	1rjdA-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_B_SAMB802_1 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 6	ARG A 11 ASP A 183 ASN A 177 GLU A 146	None	1.08A	1rjdB-5x4jA: undetectable	1rjdB-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RJD_C_SAMC803_1 (CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 6	ARG A 11 ASP A 183 ASN A 177 GLU A 146	None	1.08A	1rjdC-5x4jA: 2.9	1rjdC-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Y4L_B_SVRB301_1 (PHOSPHOLIPASE A2 HOMOLOG 2)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	GLY A 407 GLY A 445 LEU A 422 GLY A 423 ARG A 427	None CL A 505 ( 3.7A) None None None	1.21A	1y4lA-5x4jA: undetectable	1y4lA-5x4jA: 18.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BR4_A_SAMA301_1 (CEPHALOSPORIN HYDROXYLASE CMCI)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	3 / 3	LYS A -1 ASP A 170 ASP A 273	None	1.00A	2br4A-5x4jA: undetectable	2br4A-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CML_A_ZMRA1478_1 (NEURAMINIDASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 7	SER A 135 ASP A 36 SER A 137 ASN A 177	None ZN A 501 (-3.1A) None None	1.15A	2cmlA-5x4jA: undetectable	2cmlA-5x4jA: 11.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2CML_B_ZMRB2478_1 (NEURAMINIDASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 8	SER A 135 ASP A 36 SER A 137 ASN A 177	None ZN A 501 (-3.1A) None None	1.11A	2cmlB-5x4jA: undetectable	2cmlB-5x4jA: 11.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2I91_A_ACTA601_0 (60 KDA SS-A/RO RIBONUCLEOPROTEIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 7	ALA A 83 SER A 82 SER A 137 THR A 140	ZN A 501 ( 4.8A) None None None	1.01A	2i91A-5x4jA: 4.8	2i91A-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2I91_B_ACTB602_0 (60 KDA SS-A/RO RIBONUCLEOPROTEIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 7	ALA A 83 SER A 82 SER A 137 THR A 140	ZN A 501 ( 4.8A) None None None	1.00A	2i91B-5x4jA: 4.6	2i91B-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IDW_B_017B401_1 (PROTEASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	LEU A 464 ILE A 448 GLY A 407 ALA A 425 ILE A 460	None	0.73A	2idwA-5x4jA: undetectable	2idwA-5x4jA: 21.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V7B_A_BEZA1529_0 (BENZOATE-COENZYME A LIGASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 9	ALA A 83 ALA A 162 GLY A 161 GLY A 138 HIS A 106	ZN A 501 ( 4.8A) None None None ZN A 501 (-3.3A)	1.27A	2v7bA-5x4jA: 2.7	2v7bA-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V7B_B_BEZB1529_0 (BENZOATE-COENZYME A LIGASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 9	ALA A 83 ALA A 162 GLY A 161 GLY A 138 HIS A 106	ZN A 501 ( 4.8A) None None None ZN A 501 (-3.3A)	1.28A	2v7bB-5x4jA: undetectable	2v7bB-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2W9H_A_TOPA1160_1 (DIHYDROFOLATE REDUCTASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 10	ALA A 409 LEU A 426 VAL A 361 ILE A 448 PHE A 395	None	1.08A	2w9hA-5x4jA: undetectable	2w9hA-5x4jA: 22.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WA2_B_SAMB1267_0 (NON-STRUCTURAL PROTEIN 5)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	SER A 88 GLY A 85 GLY A 445 GLY A 437 GLU A 436	None None CL A 505 ( 3.7A) None None	0.99A	2wa2B-5x4jA: undetectable	2wa2B-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_A_DR7A100_2 (PROTEASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 9	ALA A 429 GLY A 423 PRO A 391 VAL A 359 ILE A 460	None	1.14A	3em4B-5x4jA: undetectable	3em4B-5x4jA: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FPJ_A_SAMA301_0 (PUTATIVE UNCHARACTERIZED PROTEIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	ILE A 103 GLY A 85 ILE A 30 LEU A 91 VAL A 101	None	0.99A	3fpjA-5x4jA: undetectable	3fpjA-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3IJX_H_HCZH800_1 (GLUTAMATE RECEPTOR 2)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 5	PRO A 123 SER A 135 LEU A 120 SER A 86	None	1.43A	3ijxH-5x4jA: undetectable	3ijxH-5x4jA: 14.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NUO_B_478B478_1 (PROTEASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 9	ALA A 429 GLY A 423 PRO A 391 VAL A 359 ILE A 460	None	1.13A	3nuoA-5x4jA: undetectable	3nuoA-5x4jA: 19.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ZQE_B_DXCB1079_0 (PROTEIN PRGI, CELL INVASION PROTEIN SIPD)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	LYS A 251 GLN A 208 LEU A 206 TYR A 212 ARG A 201	None	1.44A	3zqeA-5x4jA: undetectable 3zqeB-5x4jA: undetectable	3zqeA-5x4jA: undetectable 3zqeB-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CTK_C_SAMC1263_0 (POLYPROTEIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	6 / 12	SER A 88 GLY A 85 GLY A 445 GLY A 437 GLY A 87 GLU A 436	None None CL A 505 ( 3.7A) None None None	1.12A	4ctkC-5x4jA: undetectable	4ctkC-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4E7C_D_ACTD504_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	3 / 3	GLY A 365 SER A 367 TRP A 344	None	1.00A	4e7cD-5x4jA: undetectable	4e7cD-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L8F_B_MTXB301_1 (GAMMA-GLUTAMYL HYDROLASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	GLY A 437 GLY A 438 GLY A 423 ALA A 430 LEU A 426	None	1.06A	4l8fB-5x4jA: 2.3	4l8fB-5x4jA: 12.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L8F_D_MTXD301_1 (GAMMA-GLUTAMYL HYDROLASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	GLY A 437 GLY A 438 GLY A 423 ALA A 430 LEU A 426	None	1.06A	4l8fD-5x4jA: 2.3	4l8fD-5x4jA: 12.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LG1_A_SAMA301_0 (PROTEIN-LYSINE METHYLTRANSFERASE METTL21D)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	ALA A 41 GLY A 313 GLY A 310 ALA A 42 GLU A 322	None	1.06A	4lg1A-5x4jA: undetectable	4lg1A-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LG1_B_SAMB301_0 (PROTEIN-LYSINE METHYLTRANSFERASE METTL21D)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	ALA A 41 GLY A 313 GLY A 310 ALA A 42 GLU A 322	None	1.07A	4lg1B-5x4jA: undetectable	4lg1B-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LL3_A_017A202_2 (PROTEASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 9	ALA A 429 GLY A 423 PRO A 391 VAL A 359 ILE A 460	None	1.21A	4ll3B-5x4jA: undetectable	4ll3B-5x4jA: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N09_B_ADNB401_1 (ADENOSINE KINASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	GLY A 138 GLY A 136 ALA A 41 GLY A 164 ASP A 165	None ZN A 501 ( 4.8A) None None ZN A 501 (-2.3A)	0.97A	4n09B-5x4jA: 3.5	4n09B-5x4jA: 12.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4N09_D_ADND401_1 (ADENOSINE KINASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	GLY A 138 GLY A 136 ALA A 41 GLY A 164 ASP A 165	None ZN A 501 ( 4.8A) None None ZN A 501 (-2.3A)	0.96A	4n09D-5x4jA: 3.1	4n09D-5x4jA: 12.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4P65_G_IPHG101_0 (INSULIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	LEU A 459 VAL A 359 LEU A 464 LEU A 426 ALA A 429	None	1.07A	4p65B-5x4jA: undetectable 4p65D-5x4jA: undetectable 4p65G-5x4jA: undetectable 4p65H-5x4jA: undetectable	4p65B-5x4jA: undetectable 4p65D-5x4jA: undetectable 4p65G-5x4jA: undetectable 4p65H-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 6	ALA A 228 ARG A 295 GLY A 200 GLU A 293	None	0.97A	5btgA-5x4jA: 2.6 5btgB-5x4jA: undetectable 5btgC-5x4jA: 3.3	5btgA-5x4jA: 10.60 5btgB-5x4jA: 17.11 5btgC-5x4jA: 10.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5C0O_H_SAMH301_0 (TRNA (ADENINE(58)-N(1))-M ETHYLTRANSFERASE TRMI)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	ALA A 158 GLY A 138 SER A 137 GLY A 136 LEU A 104	None None None ZN A 501 ( 4.8A) None	0.96A	5c0oH-5x4jA: 2.8	5c0oH-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DPD_B_SAMB601_0 (PROTEIN LYSINE METHYLTRANSFERASE 1)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	GLY A 85 ASP A 105 SER A 82 VAL A 63 VAL A 60	None	0.98A	5dpdB-5x4jA: undetectable	5dpdB-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5YK2_A_ERYA501_0 (PROBABLE CONSERVED ATP-BINDING PROTEIN ABC TRANSPORTER)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 11	GLY A 161 ASP A 36 ALA A 162 ALA A 158 ILE A 43	None ZN A 501 (-3.1A) None None None	1.16A	5yk2A-5x4jA: undetectable	5yk2A-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA824_0 (GEPHYRIN)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	4 / 4	LEU A 300 ASP A 289 PRO A 290 ARG A 291	None	1.15A	6fgdA-5x4jA: 5.5	6fgdA-5x4jA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MD4_A_BRLA501_0 (PEROXISOME PROLIFERATOR-ACTIVAT ED RECEPTOR GAMMA)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	GLY A 164 HIS A 107 LEU A 134 ILE A 159 HIS A 440	None ZN A 502 (-3.4A) None None ZN A 502 ( 4.8A)	1.42A	6md4A-5x4jA: undetectable	6md4A-5x4jA: 19.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_A_DCFA401_0 (ADENOSINE DEAMINASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	HIS A 106 SER A 86 HIS A 440 ASP A 165 ASP A 36	ZN A 501 (-3.3A) None ZN A 502 ( 4.8A) ZN A 501 (-2.3A) ZN A 501 (-3.1A)	1.11A	6n91A-5x4jA: undetectable	6n91A-5x4jA: 20.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6N91_B_DCFB401_0 (ADENOSINE DEAMINASE)	5x4j	UNCHARACTERIZED PROTEIN (Pyrococcus furiosus)	5 / 12	HIS A 106 SER A 86 HIS A 440 ASP A 165 ASP A 36	ZN A 501 (-3.3A) None ZN A 502 ( 4.8A) ZN A 501 (-2.3A) ZN A 501 (-3.1A)	1.11A	6n91B-5x4jA: undetectable	6n91B-5x4jA: 20.45

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1AEG_A_4APA296_1","CYTOCHROME C PEROXIDASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"HIS A 107;GLY A 438;GLY A  87;ASP A 105"," ZN A 502 (-3.4A);None;None;None","0.83A","1aegA-5x4jA:undetectable","1aegA-5x4jA:12.88"],["1CQP_A_803A311_1","ANTIGEN CD11A (P180);ANTIGEN CD11A (P180)","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"LEU A 104;VAL A 121;LEU A 147;LYS A  18;VAL A  17","None","1.12A","1cqpA-5x4jA:5.0;1cqpB-5x4jA:5.2","1cqpA-5x4jA:21.18;1cqpB-5x4jA:21.18"],["1E7B_A_HLTA4002_1","SERUM ALBUMIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ARG A 295;ALA A 298;ALA A 162;GLU A 168","None","0.93A","1e7bA-5x4jA:undetectable","1e7bA-5x4jA:9.75"],["1E7B_B_HLTB4002_1","SERUM ALBUMIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ARG A 295;ALA A 298;ALA A 162;GLU A 168","None","0.90A","1e7bB-5x4jA:undetectable","1e7bB-5x4jA:9.75"],["1NW5_A_SAMA401_1","MODIFICATION METHYLASE RSRI","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",3,"ASP A 105;HIS A 440;ASP A 165","None; ZN A 502 ( 4.8A); ZN A 501 (-2.3A)","0.89A","1nw5A-5x4jA:undetectable","1nw5A-5x4jA:undetectable"],["1Q6I_B_FK5B401_1","FKBP-TYPE PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKPA","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"TYR A 363;ARG A 450;LEU A 405;VAL A 373;ILE A 368","None","1.41A","1q6iB-5x4jA:undetectable","1q6iB-5x4jA:17.82"],["1RJD_A_SAMA801_1","CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ARG A  11;ASP A 183;ASN A 177;GLU A 146","None","1.09A","1rjdA-5x4jA:undetectable","1rjdA-5x4jA:undetectable"],["1RJD_B_SAMB802_1","CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ARG A  11;ASP A 183;ASN A 177;GLU A 146","None","1.08A","1rjdB-5x4jA:undetectable","1rjdB-5x4jA:undetectable"],["1RJD_C_SAMC803_1","CARBOXY METHYL TRANSFERASE FOR PROTEIN PHOSPHATASE 2A CATALYTIC SUBUNIT","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ARG A  11;ASP A 183;ASN A 177;GLU A 146","None","1.08A","1rjdC-5x4jA:2.9","1rjdC-5x4jA:undetectable"],["1Y4L_B_SVRB301_1","PHOSPHOLIPASE A2 HOMOLOG 2;PHOSPHOLIPASE A2 HOMOLOG 2","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 407;GLY A 445;LEU A 422;GLY A 423;ARG A 427","None; CL A 505 ( 3.7A);None;None;None","1.21A","1y4lA-5x4jA:undetectable","1y4lA-5x4jA:18.03"],["2BR4_A_SAMA301_1","CEPHALOSPORIN HYDROXYLASE CMCI","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",3,"LYS A  -1;ASP A 170;ASP A 273","None","1.00A","2br4A-5x4jA:undetectable","2br4A-5x4jA:undetectable"],["2CML_A_ZMRA1478_1","NEURAMINIDASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"SER A 135;ASP A  36;SER A 137;ASN A 177","None; ZN A 501 (-3.1A);None;None","1.15A","2cmlA-5x4jA:undetectable","2cmlA-5x4jA:11.63"],["2CML_B_ZMRB2478_1","NEURAMINIDASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"SER A 135;ASP A  36;SER A 137;ASN A 177","None; ZN A 501 (-3.1A);None;None","1.11A","2cmlB-5x4jA:undetectable","2cmlB-5x4jA:11.63"],["2I91_A_ACTA601_0","60 KDA SS-A\/RO RIBONUCLEOPROTEIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ALA A  83;SER A  82;SER A 137;THR A 140"," ZN A 501 ( 4.8A);None;None;None","1.01A","2i91A-5x4jA:4.8","2i91A-5x4jA:undetectable"],["2I91_B_ACTB602_0","60 KDA SS-A\/RO RIBONUCLEOPROTEIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ALA A  83;SER A  82;SER A 137;THR A 140"," ZN A 501 ( 4.8A);None;None;None","1.00A","2i91B-5x4jA:4.6","2i91B-5x4jA:undetectable"],["2IDW_B_017B401_1","PROTEASE;PROTEASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"LEU A 464;ILE A 448;GLY A 407;ALA A 425;ILE A 460","None","0.73A","2idwA-5x4jA:undetectable","2idwA-5x4jA:21.50"],["2V7B_A_BEZA1529_0","BENZOATE-COENZYME A LIGASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A  83;ALA A 162;GLY A 161;GLY A 138;HIS A 106"," ZN A 501 ( 4.8A);None;None;None; ZN A 501 (-3.3A)","1.27A","2v7bA-5x4jA:2.7","2v7bA-5x4jA:undetectable"],["2V7B_B_BEZB1529_0","BENZOATE-COENZYME A LIGASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A  83;ALA A 162;GLY A 161;GLY A 138;HIS A 106"," ZN A 501 ( 4.8A);None;None;None; ZN A 501 (-3.3A)","1.28A","2v7bB-5x4jA:undetectable","2v7bB-5x4jA:undetectable"],["2W9H_A_TOPA1160_1","DIHYDROFOLATE REDUCTASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A 409;LEU A 426;VAL A 361;ILE A 448;PHE A 395","None","1.08A","2w9hA-5x4jA:undetectable","2w9hA-5x4jA:22.15"],["2WA2_B_SAMB1267_0","NON-STRUCTURAL PROTEIN 5","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"SER A  88;GLY A  85;GLY A 445;GLY A 437;GLU A 436","None;None; CL A 505 ( 3.7A);None;None","0.99A","2wa2B-5x4jA:undetectable","2wa2B-5x4jA:undetectable"],["3EM4_A_DR7A100_2","PROTEASE;PROTEASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A 429;GLY A 423;PRO A 391;VAL A 359;ILE A 460","None","1.14A","3em4B-5x4jA:undetectable","3em4B-5x4jA:18.69"],["3FPJ_A_SAMA301_0","PUTATIVE UNCHARACTERIZED PROTEIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ILE A 103;GLY A  85;ILE A  30;LEU A  91;VAL A 101","None","0.99A","3fpjA-5x4jA:undetectable","3fpjA-5x4jA:undetectable"],["3IJX_H_HCZH800_1","GLUTAMATE RECEPTOR 2","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"PRO A 123;SER A 135;LEU A 120;SER A  86","None","1.43A","3ijxH-5x4jA:undetectable","3ijxH-5x4jA:14.73"],["3NUO_B_478B478_1","PROTEASE;PROTEASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A 429;GLY A 423;PRO A 391;VAL A 359;ILE A 460","None","1.13A","3nuoA-5x4jA:undetectable","3nuoA-5x4jA:19.63"],["3ZQE_B_DXCB1079_0","PROTEIN PRGI, CELL INVASION PROTEIN SIPD","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"LYS A 251;GLN A 208;LEU A 206;TYR A 212;ARG A 201","None","1.44A","3zqeA-5x4jA:undetectable;3zqeB-5x4jA:undetectable","3zqeA-5x4jA:undetectable;3zqeB-5x4jA:undetectable"],["4CTK_C_SAMC1263_0","POLYPROTEIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",6,"SER A  88;GLY A  85;GLY A 445;GLY A 437;GLY A  87;GLU A 436","None;None; CL A 505 ( 3.7A);None;None;None","1.12A","4ctkC-5x4jA:undetectable","4ctkC-5x4jA:undetectable"],["4E7C_D_ACTD504_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",3,"GLY A 365;SER A 367;TRP A 344","None","1.00A","4e7cD-5x4jA:undetectable","4e7cD-5x4jA:undetectable"],["4L8F_B_MTXB301_1","GAMMA-GLUTAMYL HYDROLASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 437;GLY A 438;GLY A 423;ALA A 430;LEU A 426","None","1.06A","4l8fB-5x4jA:2.3","4l8fB-5x4jA:12.18"],["4L8F_D_MTXD301_1","GAMMA-GLUTAMYL HYDROLASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 437;GLY A 438;GLY A 423;ALA A 430;LEU A 426","None","1.06A","4l8fD-5x4jA:2.3","4l8fD-5x4jA:12.18"],["4LG1_A_SAMA301_0","PROTEIN-LYSINE METHYLTRANSFERASE METTL21D","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A  41;GLY A 313;GLY A 310;ALA A  42;GLU A 322","None","1.06A","4lg1A-5x4jA:undetectable","4lg1A-5x4jA:undetectable"],["4LG1_B_SAMB301_0","PROTEIN-LYSINE METHYLTRANSFERASE METTL21D","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A  41;GLY A 313;GLY A 310;ALA A  42;GLU A 322","None","1.07A","4lg1B-5x4jA:undetectable","4lg1B-5x4jA:undetectable"],["4LL3_A_017A202_2","PROTEASE;PROTEASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A 429;GLY A 423;PRO A 391;VAL A 359;ILE A 460","None","1.21A","4ll3B-5x4jA:undetectable","4ll3B-5x4jA:18.69"],["4N09_B_ADNB401_1","ADENOSINE KINASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 138;GLY A 136;ALA A  41;GLY A 164;ASP A 165","None; ZN A 501 ( 4.8A);None;None; ZN A 501 (-2.3A)","0.97A","4n09B-5x4jA:3.5","4n09B-5x4jA:12.46"],["4N09_D_ADND401_1","ADENOSINE KINASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 138;GLY A 136;ALA A  41;GLY A 164;ASP A 165","None; ZN A 501 ( 4.8A);None;None; ZN A 501 (-2.3A)","0.96A","4n09D-5x4jA:3.1","4n09D-5x4jA:12.46"],["4P65_G_IPHG101_0","INSULIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"LEU A 459;VAL A 359;LEU A 464;LEU A 426;ALA A 429","None","1.07A","4p65B-5x4jA:undetectable;4p65D-5x4jA:undetectable;4p65G-5x4jA:undetectable;4p65H-5x4jA:undetectable","4p65B-5x4jA:undetectable;4p65D-5x4jA:undetectable;4p65G-5x4jA:undetectable;4p65H-5x4jA:undetectable"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"ALA A 228;ARG A 295;GLY A 200;GLU A 293","None","0.97A","5btgA-5x4jA:2.6;5btgB-5x4jA:undetectable;5btgC-5x4jA:3.3","5btgA-5x4jA:10.60;5btgB-5x4jA:17.11;5btgC-5x4jA:10.60"],["5C0O_H_SAMH301_0","TRNA (ADENINE(58)-N(1))-METHYLTRANSFERASE TRMI","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"ALA A 158;GLY A 138;SER A 137;GLY A 136;LEU A 104","None;None;None; ZN A 501 ( 4.8A);None","0.96A","5c0oH-5x4jA:2.8","5c0oH-5x4jA:undetectable"],["5DPD_B_SAMB601_0","PROTEIN LYSINE METHYLTRANSFERASE 1","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A  85;ASP A 105;SER A  82;VAL A  63;VAL A  60","None","0.98A","5dpdB-5x4jA:undetectable","5dpdB-5x4jA:undetectable"],["5YK2_A_ERYA501_0","PROBABLE CONSERVED ATP-BINDING PROTEIN ABC TRANSPORTER","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 161;ASP A  36;ALA A 162;ALA A 158;ILE A  43","None; ZN A 501 (-3.1A);None;None;None","1.16A","5yk2A-5x4jA:undetectable","5yk2A-5x4jA:undetectable"],["6FGD_A_ACTA824_0","GEPHYRIN","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",4,"LEU A 300;ASP A 289;PRO A 290;ARG A 291","None","1.15A","6fgdA-5x4jA:5.5","6fgdA-5x4jA:undetectable"],["6MD4_A_BRLA501_0","PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"GLY A 164;HIS A 107;LEU A 134;ILE A 159;HIS A 440","None; ZN A 502 (-3.4A);None;None; ZN A 502 ( 4.8A)","1.42A","6md4A-5x4jA:undetectable","6md4A-5x4jA:19.54"],["6N91_A_DCFA401_0","ADENOSINE DEAMINASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"HIS A 106;SER A  86;HIS A 440;ASP A 165;ASP A  36"," ZN A 501 (-3.3A);None; ZN A 502 ( 4.8A); ZN A 501 (-2.3A); ZN A 501 (-3.1A)","1.11A","6n91A-5x4jA:undetectable","6n91A-5x4jA:20.45"],["6N91_B_DCFB401_0","ADENOSINE DEAMINASE","5x4j","UNCHARACTERIZED PROTEIN","Pyrococcus furiosus",5,"HIS A 106;SER A  86;HIS A 440;ASP A 165;ASP A  36"," ZN A 501 (-3.3A);None; ZN A 502 ( 4.8A); ZN A 501 (-2.3A); ZN A 501 (-3.1A)","1.11A","6n91B-5x4jA:undetectable","6n91B-5x4jA:20.45"]]