SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5xxo'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DF7_A_MTXA501_2 (DIHYDROFOLATE REDUCTASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	TRP A 564 ARG A 558 THR A 563	None	1.00A	1df7A-5xxoA: 1.2	1df7A-5xxoA: 20.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GMK_A_DVAA8_0 (GRAMICIDIN A)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 4	VAL A 169 TRP A 435 TRP A 166	None	1.28A	1gmkA-5xxoA: undetectable 1gmkB-5xxoA: undetectable	1gmkA-5xxoA: undetectable 1gmkB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GMK_C_DVAC8_0 (GRAMICIDIN A)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 4	VAL A 169 TRP A 435 TRP A 166	None	1.25A	1gmkC-5xxoA: undetectable 1gmkD-5xxoA: undetectable	1gmkC-5xxoA: undetectable 1gmkD-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HRK_B_CHDB2501_0 (FERROCHELATASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 ILE A 461 VAL A 398	None	1.42A	1hrkB-5xxoA: 3.1	1hrkB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MJL_A_SAMA200_0 (METHIONINE REPRESSOR PROTEIN METJ)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 11	ALA A 425 ARG A 491 LEU A 496 GLU A 499 ALA A 500	None	1.20A	1mjlA-5xxoA: undetectable 1mjlB-5xxoA: undetectable	1mjlA-5xxoA: undetectable 1mjlB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_G_AG2G7003_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 6	LEU A 49 ASP A 314 GLY A 281 ARG A 274	None	0.87A	1mt1G-5xxoA: undetectable 1mt1J-5xxoA: undetectable	1mt1G-5xxoA: 27.38 1mt1J-5xxoA: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_H_AG2H7012_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 6	ARG A 274 LEU A 49 ASP A 314 GLY A 281	None	0.89A	1n13H-5xxoA: undetectable 1n13K-5xxoA: undetectable	1n13H-5xxoA: 19.83 1n13K-5xxoA: 27.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1N13_J_AG2J7013_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 7	LEU A 49 ASP A 314 GLY A 281 ARG A 274	None	0.90A	1n13G-5xxoA: undetectable 1n13J-5xxoA: undetectable	1n13G-5xxoA: 27.38 1n13J-5xxoA: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P62_B_GEOB302_1 (DEOXYCYTIDINE KINASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 11	VAL A 692 TRP A 129 MET A 131 ASP A 176 PHE A 178	None	1.48A	1p62B-5xxoA: 2.8	1p62B-5xxoA: 13.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S19_A_MC9A500_0 (VITAMIN D3 RECEPTOR)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 392 LEU A 552 VAL A 551 VAL A 575 LEU A 447	None	1.14A	1s19A-5xxoA: undetectable	1s19A-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AKE_A_TRPA479_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	THR A 556 GLY A 557 GLY A 522 THR A 434 GLU A 519	None	1.34A	2akeA-5xxoA: 2.4	2akeA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXE_B_1FLB2002_1 (SERUM ALBUMIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 11	ALA A 513 ALA A 464 SER A 446 LEU A 447 VAL A 448	None	0.86A	2bxeB-5xxoA: undetectable	2bxeB-5xxoA: 8.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXG_B_IBPB2002_1 (SERUM ALBUMIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 10	ALA A 513 ALA A 464 SER A 446 LEU A 447 VAL A 448	None	0.81A	2bxgB-5xxoA: 2.3	2bxgB-5xxoA: 8.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BXQ_A_IMNA2003_1 (SERUM ALBUMIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 10	ARG A 737 LEU A 736 ILE A 697 PHE A 729 GLY A 713	None	1.42A	2bxqA-5xxoA: undetectable	2bxqA-5xxoA: 8.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2KUH_A_HLTA150_1 (CALMODULIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 6	LEU A 770 MET A 671 LEU A 772 GLU A 748	None	0.82A	2kuhA-5xxoA: undetectable	2kuhA-5xxoA: 22.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OKC_A_SAMA500_0 (TYPE I RESTRICTION ENZYME STYSJI M PROTEIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	6 / 12	ILE A 150 GLY A 78 GLY A 108 VAL A 76 PRO A 104 PHE A 357	None	1.37A	2okcA-5xxoA: undetectable	2okcA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OZ7_A_CA4A1_2 (ANDROGEN RECEPTOR)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 6	LEU A 105 MET A 40 MET A 37 LEU A 101	None None None PG4 A 804 (-4.6A)	1.44A	2oz7A-5xxoA: undetectable	2oz7A-5xxoA: 13.65
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PNJ_B_CHDB501_0 (FERROCHELATASE, MITOCHONDRIAL)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 ILE A 461 VAL A 398	None	1.33A	2pnjB-5xxoA: 3.7	2pnjB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PO7_A_CHDA501_0 (FERROCHELATASE, MITOCHONDRIAL)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 PRO A 549 VAL A 398	None	1.16A	2po7A-5xxoA: 3.9	2po7A-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2PO7_B_CHDB501_0 (FERROCHELATASE, MITOCHONDRIAL)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 PRO A 549 VAL A 398	None	1.17A	2po7B-5xxoA: 3.5	2po7B-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QD4_B_CHDB928_0 (FERROCHELATASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 PRO A 549 VAL A 398	None	1.11A	2qd4B-5xxoA: 3.3	2qd4B-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QHF_A_ACTA509_0 (CHORISMATE SYNTHASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	ARG A 527 GLN A 536 PRO A 533	None	0.84A	2qhfA-5xxoA: undetectable	2qhfA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WA2_A_SAMA1248_0 (NON-STRUCTURAL PROTEIN 5)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	GLY A 289 GLY A 321 SER A 291 VAL A 335 ILE A 309	None	1.00A	2wa2A-5xxoA: undetectable	2wa2A-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XF3_A_J01A500_1 (ORF12)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 10	ILE A 418 LEU A 573 LEU A 451 GLY A 587 ALA A 589	None	1.24A	2xf3A-5xxoA: undetectable	2xf3A-5xxoA: 11.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A50_A_VD3A2001_1 (VITAMIN D HYDROXYLASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ILE A 586 ASN A 413 LEU A 447 ILE A 511 ALA A 513	None	1.21A	3a50A-5xxoA: undetectable	3a50A-5xxoA: 10.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3AQI_B_CHDB6_0 (FERROCHELATASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 ILE A 461 VAL A 398	None	1.31A	3aqiB-5xxoA: 2.5	3aqiB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_G_SVRG506_3 (PHOSPHOLIPASE A2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	PRO A 707 PHE A 648 LYS A 709	None	1.25A	3bjwG-5xxoA: undetectable	3bjwG-5xxoA: 20.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_C_SAMC300_0 (PUTATIVE RRNA METHYLASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ASN A 468 ASP A 534 ILE A 421 LEU A 496 THR A 546	None	1.16A	3eeyC-5xxoA: 2.9	3eeyC-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EEY_E_SAME300_0 (PUTATIVE RRNA METHYLASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ASN A 468 ASP A 534 ILE A 421 LEU A 496 THR A 546	None	1.11A	3eeyE-5xxoA: undetectable	3eeyE-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HBB_B_TMQB612_1 (DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 9	VAL A 111 ALA A 138 ILE A 134 SER A 173 ILE A 112	None	1.45A	3hbbB-5xxoA: undetectable	3hbbB-5xxoA: 11.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3L2W_A_ELVA397_1 (INTEGRASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 5	ASP A 641 TYR A 646 PRO A 644 GLU A 643	None	1.46A	3l2wA-5xxoA: undetectable	3l2wA-5xxoA: 14.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_A_PZIA802_0 (GLUTAMATE RECEPTOR 2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	ASP A 316 ASN A 50 SER A 291	None	0.78A	3lslA-5xxoA: undetectable 3lslD-5xxoA: undetectable	3lslA-5xxoA: undetectable 3lslD-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_D_PZID802_0 (GLUTAMATE RECEPTOR 2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	SER A 291 ASP A 316 ASN A 50	None	0.86A	3lslA-5xxoA: undetectable 3lslD-5xxoA: undetectable	3lslA-5xxoA: undetectable 3lslD-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P6H_A_IBPA133_1 (FATTY ACID-BINDING PROTEIN, ADIPOCYTE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 7	PHE A 729 ILE A 717 VAL A 681 TYR A 659	None	1.06A	3p6hA-5xxoA: undetectable	3p6hA-5xxoA: 22.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_E_ACTE503_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	GLN A 610 THR A 561 ASN A 607	None	0.89A	3v4tE-5xxoA: undetectable	3v4tE-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W1W_A_CHDA1502_0 (FERROCHELATASE, MITOCHONDRIAL)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 590 PHE A 591 LEU A 410 ILE A 461 VAL A 398	None	1.35A	3w1wA-5xxoA: 3.7	3w1wA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IOM_A_FOLA608_0 (FORMATE--TETRAHYDROF OLATE LIGASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 7	ALA A 571 LEU A 392 TYR A 654 LEU A 410	None	1.05A	4iomA-5xxoA: 3.8	4iomA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K0B_B_SAMB504_1 (S-ADENOSYLMETHIONINE SYNTHASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 8	HIS A 113 PRO A 122 ALA A 141 TYR A 191	None	0.94A	4k0bB-5xxoA: undetectable	4k0bB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L7I_B_SAMB501_1 (S-ADENOSYLMETHIONINE SYNTHASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 8	HIS A 113 PRO A 122 ALA A 141 TYR A 191	None	0.89A	4l7iB-5xxoA: undetectable	4l7iB-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LUH_A_ACTA610_0 (SERUM ALBUMIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	VAL A 335 SER A 336 THR A 339	None	0.45A	4luhA-5xxoA: 2.6	4luhA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MMC_A_29JA604_1 (TRANSPORTER)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 7	ARG A 767 ILE A 731 PHE A 768 LEU A 736	None	1.07A	4mmcA-5xxoA: undetectable	4mmcA-5xxoA: 8.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OK1_A_198A1001_1 (ANDROGEN RECEPTOR)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 496 GLY A 466 LEU A 514 ILE A 510 VAL A 550	None	1.13A	4ok1A-5xxoA: undetectable	4ok1A-5xxoA: 13.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PEV_B_ADNB501_1 (MEMBRANE LIPOPROTEIN FAMILY PROTEIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ASP A 588 VAL A 594 GLY A 587 PHE A 555 PHE A 390	None	1.34A	4pevB-5xxoA: 4.0	4pevB-5xxoA: 12.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QOI_A_ML1A303_1 (RIBOSYLDIHYDRONICOTI NAMIDE DEHYDROGENASE [QUINONE])	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 8	PHE A 357 PHE A 282 GLY A 77 ILE A 71	None	0.95A	4qoiA-5xxoA: 5.6 4qoiB-5xxoA: 5.7	4qoiA-5xxoA: 15.64 4qoiB-5xxoA: 15.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R3A_B_RBFB402_2 (BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	LEU A 410 ALA A 419 ILE A 418 LEU A 447 GLY A 587	None	0.83A	4r3aB-5xxoA: undetectable	4r3aB-5xxoA: 18.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RS0_A_IBPA706_1 (PROSTAGLANDIN G/H SYNTHASE 2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 9	VAL A 553 LEU A 552 LEU A 590 GLY A 422 LEU A 447	None	0.90A	4rs0A-5xxoA: undetectable	4rs0A-5xxoA: 9.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UHX_A_RTZA3009_1 (ALDEHYDE OXIDASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 8	GLU A 519 SER A 525 ARG A 527 ARG A 478	None	1.21A	4uhxA-5xxoA: undetectable	4uhxA-5xxoA: 5.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZBQ_A_DIFA601_1 (SERUM ALBUMIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 11	VAL A 535 LEU A 543 GLY A 422 SER A 467 LEU A 497	None	1.19A	4zbqA-5xxoA: undetectable	4zbqA-5xxoA: 9.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTA_G_MFXG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 7	ASP A 220 ARG A 168 GLY A 522 GLU A 171	None BGC A 802 (-3.0A) None None	0.86A	5btaA-5xxoA: undetectable 5btaC-5xxoA: undetectable 5btaD-5xxoA: undetectable	5btaA-5xxoA: 9.96 5btaC-5xxoA: 9.96 5btaD-5xxoA: 17.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GWX_A_SAMA301_1 (GLYCINE SARCOSINE N-METHYLTRANSFERASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	3 / 3	ARG A 706 ASN A 233 ASP A 176	None	0.85A	5gwxA-5xxoA: 2.4	5gwxA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HS1_A_VORA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 8	PHE A 412 ILE A 509 PHE A 591 LEU A 447	None	0.85A	5hs1A-5xxoA: undetectable	5hs1A-5xxoA: 9.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IKR_B_ID8B602_1 (PROSTAGLANDIN G/H SYNTHASE 2)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	VAL A 553 LEU A 552 LEU A 590 GLY A 422 LEU A 447	None	1.04A	5ikrB-5xxoA: undetectable	5ikrB-5xxoA: 10.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_A_ACTA803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 4	GLU A 516 PRO A 533 ILE A 532 LEU A 560	None	1.31A	5m45A-5xxoA: undetectable	5m45A-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_D_ACTD803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 4	GLU A 516 PRO A 533 ILE A 532 LEU A 560	None	1.35A	5m45D-5xxoA: undetectable	5m45D-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M45_G_ACTG803_0 (ACETONE CARBOXYLASE ALPHA SUBUNIT)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 4	GLU A 516 PRO A 533 ILE A 532 LEU A 560	None	1.32A	5m45G-5xxoA: undetectable	5m45G-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5M6G_A_SORA711_0 (BETA-GLUCOSIDASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	10 / 12	ASP A 110 PHE A 154 ARG A 168 LYS A 207 HIS A 208 MET A 251 TYR A 287 MET A 317 TRP A 435 GLU A 523	BGC A 802 (-3.0A) BGC A 802 (-4.4A) BGC A 802 (-3.0A) BGC A 802 (-2.9A) BGC A 802 (-4.1A) BGC A 802 (-3.7A) None BGC A 802 ( 3.8A) None BGC A 802 (-2.6A)	0.43A	5m6gA-5xxoA: 43.5	5m6gA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5O96_A_SAMA501_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE E)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 11	LEU A 573 GLU A 388 GLY A 598 LEU A 590 VAL A 594	None	1.12A	5o96A-5xxoA: 2.0 5o96B-5xxoA: undetectable	5o96A-5xxoA: undetectable 5o96B-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OG9_A_TESA503_1 (-)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 9	LEU A 552 LEU A 514 ILE A 586 LEU A 410 ALA A 425	None	1.33A	5og9A-5xxoA: undetectable	5og9A-5xxoA: 11.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X80_B_SALB203_1 (UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 6	PRO A 647 GLY A 649 TYR A 650 ARG A 761	None	0.84A	5x80A-5xxoA: undetectable 5x80B-5xxoA: undetectable	5x80A-5xxoA: 18.87 5x80B-5xxoA: 18.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AYC_A_1YNA502_1 (PROTEIN CYP51)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ALA A 500 PHE A 555 PHE A 390 ALA A 387 LEU A 451	None	1.31A	6aycA-5xxoA: undetectable	6aycA-5xxoA: 22.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6E8Q_A_X2NA602_0 (LANOSTEROL 14-ALPHA DEMETHYLASE)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	GLY A 433 ILE A 88 GLY A 108 HIS A 113 THR A 434	None	1.11A	6e8qA-5xxoA: undetectable	6e8qA-5xxoA: 24.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA824_0 (GEPHYRIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	4 / 4	LEU A 530 ASP A 163 PRO A 164 ARG A 165	None	0.95A	6fgdA-5xxoA: 3.1	6fgdA-5xxoA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6J20_A_GBQA1201_0 (SUBSTANCE-P RECEPTOR,ENDOLYSIN)	5xxo	PERIPLASMIC BETA-GLUCOSIDASE (Bacteroides thetaiotaomicron)	5 / 12	ASN A 81 ILE A 57 TYR A 115 ILE A 202 MET A 251	BGC A 802 ( 4.0A) None None None BGC A 802 (-3.7A)	1.32A	6j20A-5xxoA: undetectable	6j20A-5xxoA: undetectable

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1DF7_A_MTXA501_2","DIHYDROFOLATE REDUCTASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"TRP A 564;ARG A 558;THR A 563","None","1.00A","1df7A-5xxoA:1.2","1df7A-5xxoA:20.13"],["1GMK_A_DVAA8_0","GRAMICIDIN A","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"VAL A 169;TRP A 435;TRP A 166","None","1.28A","1gmkA-5xxoA:undetectable;1gmkB-5xxoA:undetectable","1gmkA-5xxoA:undetectable;1gmkB-5xxoA:undetectable"],["1GMK_C_DVAC8_0","GRAMICIDIN A","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"VAL A 169;TRP A 435;TRP A 166","None","1.25A","1gmkC-5xxoA:undetectable;1gmkD-5xxoA:undetectable","1gmkC-5xxoA:undetectable;1gmkD-5xxoA:undetectable"],["1HRK_B_CHDB2501_0","FERROCHELATASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;ILE A 461;VAL A 398","None","1.42A","1hrkB-5xxoA:3.1","1hrkB-5xxoA:undetectable"],["1MJL_A_SAMA200_0","METHIONINE REPRESSOR PROTEIN METJ","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ALA A 425;ARG A 491;LEU A 496;GLU A 499;ALA A 500","None","1.20A","1mjlA-5xxoA:undetectable;1mjlB-5xxoA:undetectable","1mjlA-5xxoA:undetectable;1mjlB-5xxoA:undetectable"],["1MT1_G_AG2G7003_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"LEU A  49;ASP A 314;GLY A 281;ARG A 274","None","0.87A","1mt1G-5xxoA:undetectable;1mt1J-5xxoA:undetectable","1mt1G-5xxoA:27.38;1mt1J-5xxoA:19.83"],["1N13_H_AG2H7012_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"ARG A 274;LEU A  49;ASP A 314;GLY A 281","None","0.89A","1n13H-5xxoA:undetectable;1n13K-5xxoA:undetectable","1n13H-5xxoA:19.83;1n13K-5xxoA:27.38"],["1N13_J_AG2J7013_1","PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN;PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"LEU A  49;ASP A 314;GLY A 281;ARG A 274","None","0.90A","1n13G-5xxoA:undetectable;1n13J-5xxoA:undetectable","1n13G-5xxoA:27.38;1n13J-5xxoA:19.83"],["1P62_B_GEOB302_1","DEOXYCYTIDINE KINASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"VAL A 692;TRP A 129;MET A 131;ASP A 176;PHE A 178","None","1.48A","1p62B-5xxoA:2.8","1p62B-5xxoA:13.95"],["1S19_A_MC9A500_0","VITAMIN D3 RECEPTOR","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 392;LEU A 552;VAL A 551;VAL A 575;LEU A 447","None","1.14A","1s19A-5xxoA:undetectable","1s19A-5xxoA:undetectable"],["2AKE_A_TRPA479_0","TRYPTOPHANYL-TRNA SYNTHETASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"THR A 556;GLY A 557;GLY A 522;THR A 434;GLU A 519","None","1.34A","2akeA-5xxoA:2.4","2akeA-5xxoA:undetectable"],["2BXE_B_1FLB2002_1","SERUM ALBUMIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ALA A 513;ALA A 464;SER A 446;LEU A 447;VAL A 448","None","0.86A","2bxeB-5xxoA:undetectable","2bxeB-5xxoA:8.29"],["2BXG_B_IBPB2002_1","SERUM ALBUMIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ALA A 513;ALA A 464;SER A 446;LEU A 447;VAL A 448","None","0.81A","2bxgB-5xxoA:2.3","2bxgB-5xxoA:8.29"],["2BXQ_A_IMNA2003_1","SERUM ALBUMIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ARG A 737;LEU A 736;ILE A 697;PHE A 729;GLY A 713","None","1.42A","2bxqA-5xxoA:undetectable","2bxqA-5xxoA:8.29"],["2KUH_A_HLTA150_1","CALMODULIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"LEU A 770;MET A 671;LEU A 772;GLU A 748","None","0.82A","2kuhA-5xxoA:undetectable","2kuhA-5xxoA:22.35"],["2OKC_A_SAMA500_0","TYPE I RESTRICTION ENZYME STYSJI M PROTEIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",6,"ILE A 150;GLY A  78;GLY A 108;VAL A  76;PRO A 104;PHE A 357","None","1.37A","2okcA-5xxoA:undetectable","2okcA-5xxoA:undetectable"],["2OZ7_A_CA4A1_2","ANDROGEN RECEPTOR","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"LEU A 105;MET A  40;MET A  37;LEU A 101","None;None;None;PG4 A 804 (-4.6A)","1.44A","2oz7A-5xxoA:undetectable","2oz7A-5xxoA:13.65"],["2PNJ_B_CHDB501_0","FERROCHELATASE, MITOCHONDRIAL","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;ILE A 461;VAL A 398","None","1.33A","2pnjB-5xxoA:3.7","2pnjB-5xxoA:undetectable"],["2PO7_A_CHDA501_0","FERROCHELATASE, MITOCHONDRIAL","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;PRO A 549;VAL A 398","None","1.16A","2po7A-5xxoA:3.9","2po7A-5xxoA:undetectable"],["2PO7_B_CHDB501_0","FERROCHELATASE, MITOCHONDRIAL","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;PRO A 549;VAL A 398","None","1.17A","2po7B-5xxoA:3.5","2po7B-5xxoA:undetectable"],["2QD4_B_CHDB928_0","FERROCHELATASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;PRO A 549;VAL A 398","None","1.11A","2qd4B-5xxoA:3.3","2qd4B-5xxoA:undetectable"],["2QHF_A_ACTA509_0","CHORISMATE SYNTHASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"ARG A 527;GLN A 536;PRO A 533","None","0.84A","2qhfA-5xxoA:undetectable","2qhfA-5xxoA:undetectable"],["2WA2_A_SAMA1248_0","NON-STRUCTURAL PROTEIN 5","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"GLY A 289;GLY A 321;SER A 291;VAL A 335;ILE A 309","None","1.00A","2wa2A-5xxoA:undetectable","2wa2A-5xxoA:undetectable"],["2XF3_A_J01A500_1","ORF12","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ILE A 418;LEU A 573;LEU A 451;GLY A 587;ALA A 589","None","1.24A","2xf3A-5xxoA:undetectable","2xf3A-5xxoA:11.32"],["3A50_A_VD3A2001_1","VITAMIN D HYDROXYLASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ILE A 586;ASN A 413;LEU A 447;ILE A 511;ALA A 513","None","1.21A","3a50A-5xxoA:undetectable","3a50A-5xxoA:10.45"],["3AQI_B_CHDB6_0","FERROCHELATASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;ILE A 461;VAL A 398","None","1.31A","3aqiB-5xxoA:2.5","3aqiB-5xxoA:undetectable"],["3BJW_G_SVRG506_3","PHOSPHOLIPASE A2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"PRO A 707;PHE A 648;LYS A 709","None","1.25A","3bjwG-5xxoA:undetectable","3bjwG-5xxoA:20.51"],["3EEY_C_SAMC300_0","PUTATIVE RRNA METHYLASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ASN A 468;ASP A 534;ILE A 421;LEU A 496;THR A 546","None","1.16A","3eeyC-5xxoA:2.9","3eeyC-5xxoA:undetectable"],["3EEY_E_SAME300_0","PUTATIVE RRNA METHYLASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ASN A 468;ASP A 534;ILE A 421;LEU A 496;THR A 546","None","1.11A","3eeyE-5xxoA:undetectable","3eeyE-5xxoA:undetectable"],["3HBB_B_TMQB612_1","DIHYDROFOLATE REDUCTASE-THYMIDYLATE SYNTHASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"VAL A 111;ALA A 138;ILE A 134;SER A 173;ILE A 112","None","1.45A","3hbbB-5xxoA:undetectable","3hbbB-5xxoA:11.89"],["3L2W_A_ELVA397_1","INTEGRASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"ASP A 641;TYR A 646;PRO A 644;GLU A 643","None","1.46A","3l2wA-5xxoA:undetectable","3l2wA-5xxoA:14.03"],["3LSL_A_PZIA802_0","GLUTAMATE RECEPTOR 2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"ASP A 316;ASN A  50;SER A 291","None","0.78A","3lslA-5xxoA:undetectable;3lslD-5xxoA:undetectable","3lslA-5xxoA:undetectable;3lslD-5xxoA:undetectable"],["3LSL_D_PZID802_0","GLUTAMATE RECEPTOR 2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"SER A 291;ASP A 316;ASN A  50","None","0.86A","3lslA-5xxoA:undetectable;3lslD-5xxoA:undetectable","3lslA-5xxoA:undetectable;3lslD-5xxoA:undetectable"],["3P6H_A_IBPA133_1","FATTY ACID-BINDING PROTEIN, ADIPOCYTE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"PHE A 729;ILE A 717;VAL A 681;TYR A 659","None","1.06A","3p6hA-5xxoA:undetectable","3p6hA-5xxoA:22.07"],["3V4T_E_ACTE503_0","UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"GLN A 610;THR A 561;ASN A 607","None","0.89A","3v4tE-5xxoA:undetectable","3v4tE-5xxoA:undetectable"],["3W1W_A_CHDA1502_0","FERROCHELATASE, MITOCHONDRIAL","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 590;PHE A 591;LEU A 410;ILE A 461;VAL A 398","None","1.35A","3w1wA-5xxoA:3.7","3w1wA-5xxoA:undetectable"],["4IOM_A_FOLA608_0","FORMATE--TETRAHYDROFOLATE LIGASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"ALA A 571;LEU A 392;TYR A 654;LEU A 410","None","1.05A","4iomA-5xxoA:3.8","4iomA-5xxoA:undetectable"],["4K0B_B_SAMB504_1","S-ADENOSYLMETHIONINE SYNTHASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"HIS A 113;PRO A 122;ALA A 141;TYR A 191","None","0.94A","4k0bB-5xxoA:undetectable","4k0bB-5xxoA:undetectable"],["4L7I_B_SAMB501_1","S-ADENOSYLMETHIONINE SYNTHASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"HIS A 113;PRO A 122;ALA A 141;TYR A 191","None","0.89A","4l7iB-5xxoA:undetectable","4l7iB-5xxoA:undetectable"],["4LUH_A_ACTA610_0","SERUM ALBUMIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"VAL A 335;SER A 336;THR A 339","None","0.45A","4luhA-5xxoA:2.6","4luhA-5xxoA:undetectable"],["4MMC_A_29JA604_1","TRANSPORTER","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"ARG A 767;ILE A 731;PHE A 768;LEU A 736","None","1.07A","4mmcA-5xxoA:undetectable","4mmcA-5xxoA:8.54"],["4OK1_A_198A1001_1","ANDROGEN RECEPTOR","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 496;GLY A 466;LEU A 514;ILE A 510;VAL A 550","None","1.13A","4ok1A-5xxoA:undetectable","4ok1A-5xxoA:13.60"],["4PEV_B_ADNB501_1","MEMBRANE LIPOPROTEIN FAMILY PROTEIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ASP A 588;VAL A 594;GLY A 587;PHE A 555;PHE A 390","None","1.34A","4pevB-5xxoA:4.0","4pevB-5xxoA:12.56"],["4QOI_A_ML1A303_1","RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE];RIBOSYLDIHYDRONICOTINAMIDE DEHYDROGENASE [QUINONE]","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"PHE A 357;PHE A 282;GLY A  77;ILE A  71","None","0.95A","4qoiA-5xxoA:5.6;4qoiB-5xxoA:5.7","4qoiA-5xxoA:15.64;4qoiB-5xxoA:15.64"],["4R3A_B_RBFB402_2","BLUE-LIGHT-ACTIVATED HISTIDINE KINASE 2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 410;ALA A 419;ILE A 418;LEU A 447;GLY A 587","None","0.83A","4r3aB-5xxoA:undetectable","4r3aB-5xxoA:18.29"],["4RS0_A_IBPA706_1","PROSTAGLANDIN G\/H SYNTHASE 2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"VAL A 553;LEU A 552;LEU A 590;GLY A 422;LEU A 447","None","0.90A","4rs0A-5xxoA:undetectable","4rs0A-5xxoA:9.31"],["4UHX_A_RTZA3009_1","ALDEHYDE OXIDASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"GLU A 519;SER A 525;ARG A 527;ARG A 478","None","1.21A","4uhxA-5xxoA:undetectable","4uhxA-5xxoA:5.04"],["4ZBQ_A_DIFA601_1","SERUM ALBUMIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"VAL A 535;LEU A 543;GLY A 422;SER A 467;LEU A 497","None","1.19A","4zbqA-5xxoA:undetectable","4zbqA-5xxoA:9.13"],["5BTA_G_MFXG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"ASP A 220;ARG A 168;GLY A 522;GLU A 171","None;BGC A 802 (-3.0A);None;None","0.86A","5btaA-5xxoA:undetectable;5btaC-5xxoA:undetectable;5btaD-5xxoA:undetectable","5btaA-5xxoA:9.96;5btaC-5xxoA:9.96;5btaD-5xxoA:17.15"],["5GWX_A_SAMA301_1","GLYCINE SARCOSINE N-METHYLTRANSFERASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",3,"ARG A 706;ASN A 233;ASP A 176","None","0.85A","5gwxA-5xxoA:2.4","5gwxA-5xxoA:undetectable"],["5HS1_A_VORA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"PHE A 412;ILE A 509;PHE A 591;LEU A 447","None","0.85A","5hs1A-5xxoA:undetectable","5hs1A-5xxoA:9.94"],["5IKR_B_ID8B602_1","PROSTAGLANDIN G\/H SYNTHASE 2","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"VAL A 553;LEU A 552;LEU A 590;GLY A 422;LEU A 447","None","1.04A","5ikrB-5xxoA:undetectable","5ikrB-5xxoA:10.00"],["5M45_A_ACTA803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"GLU A 516;PRO A 533;ILE A 532;LEU A 560","None","1.31A","5m45A-5xxoA:undetectable","5m45A-5xxoA:undetectable"],["5M45_D_ACTD803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"GLU A 516;PRO A 533;ILE A 532;LEU A 560","None","1.35A","5m45D-5xxoA:undetectable","5m45D-5xxoA:undetectable"],["5M45_G_ACTG803_0","ACETONE CARBOXYLASE ALPHA SUBUNIT","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"GLU A 516;PRO A 533;ILE A 532;LEU A 560","None","1.32A","5m45G-5xxoA:undetectable","5m45G-5xxoA:undetectable"],["5M6G_A_SORA711_0","BETA-GLUCOSIDASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",10,"ASP A 110;PHE A 154;ARG A 168;LYS A 207;HIS A 208;MET A 251;TYR A 287;MET A 317;TRP A 435;GLU A 523","BGC A 802 (-3.0A);BGC A 802 (-4.4A);BGC A 802 (-3.0A);BGC A 802 (-2.9A);BGC A 802 (-4.1A);BGC A 802 (-3.7A);None;BGC A 802 ( 3.8A);None;BGC A 802 (-2.6A)","0.43A","5m6gA-5xxoA:43.5","5m6gA-5xxoA:undetectable"],["5O96_A_SAMA501_0","RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE E","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 573;GLU A 388;GLY A 598;LEU A 590;VAL A 594","None","1.12A","5o96A-5xxoA:2.0;5o96B-5xxoA:undetectable","5o96A-5xxoA:undetectable;5o96B-5xxoA:undetectable"],["5OG9_A_TESA503_1","-","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"LEU A 552;LEU A 514;ILE A 586;LEU A 410;ALA A 425","None","1.33A","5og9A-5xxoA:undetectable","5og9A-5xxoA:11.90"],["5X80_B_SALB203_1","UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887;UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"PRO A 647;GLY A 649;TYR A 650;ARG A 761","None","0.84A","5x80A-5xxoA:undetectable;5x80B-5xxoA:undetectable","5x80A-5xxoA:18.87;5x80B-5xxoA:18.87"],["6AYC_A_1YNA502_1","PROTEIN CYP51","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ALA A 500;PHE A 555;PHE A 390;ALA A 387;LEU A 451","None","1.31A","6aycA-5xxoA:undetectable","6aycA-5xxoA:22.99"],["6E8Q_A_X2NA602_0","LANOSTEROL 14-ALPHA DEMETHYLASE","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"GLY A 433;ILE A  88;GLY A 108;HIS A 113;THR A 434","None","1.11A","6e8qA-5xxoA:undetectable","6e8qA-5xxoA:24.49"],["6FGD_A_ACTA824_0","GEPHYRIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",4,"LEU A 530;ASP A 163;PRO A 164;ARG A 165","None","0.95A","6fgdA-5xxoA:3.1","6fgdA-5xxoA:undetectable"],["6J20_A_GBQA1201_0","SUBSTANCE-P RECEPTOR,ENDOLYSIN","5xxo","PERIPLASMIC BETA-GLUCOSIDASE","Bacteroides thetaiotaomicron",5,"ASN A  81;ILE A  57;TYR A 115;ILE A 202;MET A 251","BGC A 802 ( 4.0A);None;None;None;BGC A 802 (-3.7A)","1.32A","6j20A-5xxoA:undetectable","6j20A-5xxoA:undetectable"]]