SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5xyi'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AFS_A_TESA325_1 (3-ALPHA-HYDROXYSTERO ID DEHYDROGENASE)	5xyi	40S RIBOSOMAL PROTEIN SA UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	LEU C 149 TYR C 146 THR A 107 TYR A 109	None None G  21102 ( 3.2A) U  21101 ( 3.9A)	1.32A	1afsA-5xyiC: undetectable	1afsA-5xyiC: 20.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1AFS_B_TESB325_1 (3-ALPHA-HYDROXYSTERO ID DEHYDROGENASE)	5xyi	40S RIBOSOMAL PROTEIN SA UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	LEU C 149 TYR C 146 THR A 107 TYR A 109	None None G  21102 ( 3.2A) U  21101 ( 3.9A)	1.32A	1afsB-5xyiC: undetectable	1afsB-5xyiC: 20.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1BU5_A_RBFA301_1 (PROTEIN (FLAVODOXIN))	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 7	ASN E 127 THR E 146 GLY E 144 ASP E 143	None G  2 112 ( 3.6A) U  2 228 ( 4.7A) None	0.99A	1bu5A-5xyiE: undetectable	1bu5A-5xyiE: 19.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1BU5_B_RBFB302_1 (PROTEIN (FLAVODOXIN))	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 8	ASN E 127 THR E 146 GLY E 144 ASP E 143	None G  2 112 ( 3.6A) U  2 228 ( 4.7A) None	0.96A	1bu5B-5xyiE: undetectable	1bu5B-5xyiE: 19.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C6Y_B_MK1B524_1 (PROTEIN (PROTEASE))	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 11	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.89A	1c6yA-5xyiX: undetectable	1c6yA-5xyiX: 20.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1CBS_A_REAA200_1 (CELLULAR RETINOIC ACID BINDING PROTEIN TYPE II)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 12	LEU V  78 ILE V  71 ALA V  72 VAL V  52 LEU A 183	None	1.05A	1cbsA-5xyiV: undetectable	1cbsA-5xyiV: 19.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1V_A_H4BA700_1 (BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	1d1vA-5xyic: undetectable 1d1vB-5xyic: undetectable	1d1vA-5xyic: 12.80 1d1vB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1V_B_H4BB701_1 (BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	1d1vA-5xyiF: undetectable 1d1vB-5xyiF: undetectable	1d1vA-5xyiF: 18.04 1d1vB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1W_A_H4BA600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	1d1wA-5xyic: undetectable 1d1wB-5xyic: undetectable	1d1wA-5xyic: 12.80 1d1wB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1W_B_H4BB601_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	1d1wA-5xyiF: undetectable 1d1wB-5xyiF: undetectable	1d1wA-5xyiF: 18.04 1d1wB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1X_A_H4BA600_1 (BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME DOMAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	1d1xA-5xyic: undetectable 1d1xB-5xyic: undetectable	1d1xA-5xyic: 12.80 1d1xB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1X_B_H4BB601_1 (BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME DOMAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	1d1xA-5xyiF: undetectable 1d1xB-5xyiF: undetectable	1d1xA-5xyiF: 18.04 1d1xB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DM8_A_H4BA1600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	1dm8A-5xyic: undetectable 1dm8B-5xyic: undetectable	1dm8A-5xyic: 12.80 1dm8B-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DM8_B_H4BB2600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.92A	1dm8A-5xyiF: undetectable 1dm8B-5xyiF: undetectable	1dm8A-5xyiF: 18.04 1dm8B-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DMI_A_BHSA1610_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 8	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.96A	1dmiA-5xyic: undetectable 1dmiB-5xyic: undetectable	1dmiA-5xyic: 12.80 1dmiB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DMI_B_BHSB2610_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	1dmiA-5xyiF: undetectable 1dmiB-5xyiF: undetectable	1dmiA-5xyiF: 18.04 1dmiB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FBY_A_9CRA500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.96A	1fbyA-5xyiT: undetectable	1fbyA-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FBY_B_9CRB1500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.97A	1fbyB-5xyiT: undetectable	1fbyB-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FFY_A_MRCA1993_1 (ISOLEUCYL-TRNA SYNTHETASE)	5xyi	40S RIBOSOMAL PROTEIN SA UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ASN A  95 SER C 259 GLY A  93 PHE A  88 VAL A  85	None	1.07A	1ffyA-5xyiA: undetectable	1ffyA-5xyiA: 14.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FM6_A_9CRA501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.92A	1fm6A-5xyiT: undetectable	1fm6A-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FM6_A_9CRA501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 LEU T 111	None	0.99A	1fm6A-5xyiT: undetectable	1fm6A-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FM9_A_9CRA201_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.96A	1fm9A-5xyiT: undetectable	1fm9A-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOH_A_IPHA802_0 (PHENOL HYDROXYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.29A	1fohA-5xyiC: undetectable	1fohA-5xyiC: 17.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOH_B_IPHB802_0 (PHENOL HYDROXYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.29A	1fohB-5xyiC: undetectable	1fohB-5xyiC: 17.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOH_C_IPHC802_0 (PHENOL HYDROXYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.27A	1fohC-5xyiC: undetectable	1fohC-5xyiC: 17.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOH_D_IPHD802_0 (PHENOL HYDROXYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.30A	1fohD-5xyiC: undetectable	1fohD-5xyiC: 17.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOP_B_H4BB2600_1 (NITRIC-OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.91A	1fopA-5xyiF: undetectable 1fopB-5xyiF: undetectable	1fopA-5xyiF: 18.04 1fopB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HK1_A_T44A3004_1 (SERUM ALBUMIN)	5xyi	40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	4 / 6	PHE A 101 GLU A 134 VAL A  72 MET A 120	None A  21131 ( 3.1A) None None	1.06A	1hk1A-5xyiA: undetectable	1hk1A-5xyiA: 19.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HK2_A_T44A3003_1 (SERUM ALBUMIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE C 225 ILE C 116 LYS C 201 ALA C 199	None	1.19A	1hk2A-5xyiC: undetectable	1hk2A-5xyiC: 18.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1HXB_A_ROCA100_3 (HIV-1 PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.92A	1hxbB-5xyiX: undetectable	1hxbB-5xyiX: 20.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I18_A_RBFA98_1 (RIBOFLAVIN SYNTHASE ALPHA CHAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	5 / 10	LEU F  61 LEU F 140 ILE F  28 PHE F   7 ILE F  98	None	1.35A	1i18A-5xyiF: undetectable 1i18B-5xyiF: undetectable	1i18A-5xyiF: 20.20 1i18B-5xyiF: 20.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1I18_B_RBFB99_1 (RIBOFLAVIN SYNTHASE ALPHA CHAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	5 / 10	PHE F   7 ILE F  98 LEU F  61 LEU F 140 ILE F  28	None	1.39A	1i18A-5xyiF: undetectable 1i18B-5xyiF: undetectable	1i18A-5xyiF: 20.20 1i18B-5xyiF: 20.20
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1K74_A_9CRA463_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.94A	1k74A-5xyiT: undetectable	1k74A-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NSE_A_H4BA600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	1nseA-5xyic: undetectable 1nseB-5xyic: undetectable	1nseA-5xyic: 12.80 1nseB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NSE_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	1nseA-5xyiF: undetectable 1nseB-5xyiF: undetectable	1nseA-5xyiF: 18.04 1nseB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6L_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	1p6lA-5xyic: undetectable 1p6lB-5xyic: undetectable	1p6lA-5xyic: 10.71 1p6lB-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6L_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	1p6lA-5xyiF: undetectable 1p6lB-5xyiF: undetectable	1p6lA-5xyiF: 18.78 1p6lB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6M_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	1p6mA-5xyiF: undetectable 1p6mB-5xyiF: undetectable	1p6mA-5xyiF: 18.78 1p6mB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6N_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	1p6nA-5xyiF: undetectable 1p6nB-5xyiF: undetectable	1p6nA-5xyiF: 18.78 1p6nB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P91_B_SAMB2401_0 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE A)	5xyi	RIBOSOMAL PROTEIN S3, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU D  67 GLY D  36 GLY D  34 ILE D  89 LEU D  85	None	0.94A	1p91B-5xyiD: undetectable	1p91B-5xyiD: 21.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P93_A_DEXA1999_1 (GLUCOCORTICOID RECEPTOR)	5xyi	40S RIBOSOMAL PROTEIN S29, PUTATIVE RIBOSOMAL PROTEIN S10P/S20E, PUTATIVE RIBOSOMAL PROTEIN S3, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU d  51 GLY D  16 ARG d  23 THR U  29 ILE U  88	None	1.45A	1p93A-5xyid: undetectable	1p93A-5xyid: 9.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P9G_A_ACTA42_0 (EAFP 2)	5xyi	40S RIBOSOMAL PROTEIN S29, PUTATIVE (Trichomonas vaginalis)	3 / 3	CYH d  43 ARG d  47 CYH d  22	G  21242 ( 3.9A) G  21242 ( 4.7A) None	1.32A	1p9gA-5xyid: undetectable	1p9gA-5xyid: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PN0_A_IPHA6012_0 (PHENOL 2-MONOOXYGENASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.27A	1pn0A-5xyiC: undetectable	1pn0A-5xyiC: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PN0_B_IPHB6022_0 (PHENOL 2-MONOOXYGENASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.27A	1pn0B-5xyiC: undetectable	1pn0B-5xyiC: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PN0_C_IPHC6032_0 (PHENOL 2-MONOOXYGENASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.31A	1pn0C-5xyiC: undetectable	1pn0C-5xyiC: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PN0_D_IPHD6042_0 (PHENOL 2-MONOOXYGENASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 10	GLY C 124 MET C 233 VAL C 154 ILE C 126 GLY C 122	None	1.30A	1pn0D-5xyiC: undetectable	1pn0D-5xyiC: 17.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q2O_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	1q2oA-5xyic: undetectable 1q2oB-5xyic: undetectable	1q2oA-5xyic: 10.71 1q2oB-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1Q2O_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	1q2oA-5xyiF: undetectable 1q2oB-5xyiF: undetectable	1q2oA-5xyiF: 18.78 1q2oB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QHS_A_CLMA999_0 (PROTEIN (CHLORAMPHENICOL PHOSPHOTRANSFERASE))	5xyi	RIBOSOMAL PROTEIN S24E, PUTATIVE (Trichomonas vaginalis)	5 / 12	VAL Y  54 ILE Y  56 ILE Y  24 ILE Y   8 PHE Y  22	None None None A  2 628 ( 4.5A) None	0.98A	1qhsA-5xyiY: undetectable	1qhsA-5xyiY: 22.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QW6_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	ARG g  75 VAL g  49 TRP g  60	None	1.26A	1qw6A-5xyig: undetectable	1qw6A-5xyig: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1QWC_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	ARG g  75 VAL g  49 TRP g  60	None	1.20A	1qwcA-5xyig: undetectable	1qwcA-5xyig: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RBP_A_RTLA183_0 (PLASMA RETINOL-BINDING PROTEIN PRECURSOR)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 12	ALA O  69 ALA O  81 ALA O  85 VAL O  52 LEU O 127	None	1.09A	1rbpA-5xyiO: undetectable	1rbpA-5xyiO: 21.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS8_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	1rs8A-5xyic: undetectable 1rs8B-5xyic: undetectable	1rs8A-5xyic: 10.71 1rs8B-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS8_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	1rs8A-5xyiF: undetectable 1rs8B-5xyiF: undetectable	1rs8A-5xyiF: 18.78 1rs8B-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS9_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	1rs9A-5xyic: undetectable 1rs9B-5xyic: undetectable	1rs9A-5xyic: 10.71 1rs9B-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS9_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.04A	1rs9A-5xyiF: undetectable 1rs9B-5xyiF: undetectable	1rs9A-5xyiF: 18.78 1rs9B-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S1X_A_NVPA999_1 (REVERSE TRANSCRIPTASE)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE 40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 8	LEU Q  41 TYR Q  76 GLY Q  70 LEU F  76	None None U  21414 ( 3.2A) C  21334 ( 3.7A)	1.00A	1s1xA-5xyiQ: undetectable	1s1xA-5xyiQ: 14.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TT6_B_DESB128_1 (TRANSTHYRETIN)	5xyi	RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis)	4 / 5	LEU W  93 ALA W  91 LEU W  94 SER W  96	None	1.02A	1tt6B-5xyiW: undetectable	1tt6B-5xyiW: 17.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1TYR_B_9CRB130_1 (TRANSTHYRETIN)	5xyi	40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	4 / 7	LYS A  14 LEU A 175 ALA A  18 SER A 168	None	0.90A	1tyrB-5xyiA: undetectable	1tyrB-5xyiA: 19.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1U18_B_HSMB402_1 (NITROPHORIN 1)	5xyi	40S RIBOSOMAL PROTEIN S8 (Trichomonas vaginalis)	4 / 5	GLU I  40 THR I  36 LEU I  58 LEU I  60	None None C  21483 ( 4.3A) None	1.10A	1u18B-5xyiI: undetectable	1u18B-5xyiI: 23.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VAG_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	ARG g  75 VAL g  49 TRP g  60	None	1.21A	1vagA-5xyig: undetectable	1vagA-5xyig: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XDK_A_9CRA500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 LEU T  25 ALA T  26 LEU T 111	None	0.98A	1xdkA-5xyiT: undetectable	1xdkA-5xyiT: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XDK_E_9CRE1500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.97A	1xdkE-5xyiT: undetectable	1xdkE-5xyiT: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XDK_E_9CRE1500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 LEU T  25 ALA T  26 LEU T 111	None	0.98A	1xdkE-5xyiT: undetectable	1xdkE-5xyiT: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XIU_A_9CRA201_1 (RXR-LIKE PROTEIN)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.96A	1xiuA-5xyiT: undetectable	1xiuA-5xyiT: 20.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XIU_A_9CRA201_1 (RXR-LIKE PROTEIN)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 LEU T  25 ALA T  26 LEU T 111	None	0.99A	1xiuA-5xyiT: undetectable	1xiuA-5xyiT: 20.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XL6_B_SPMB3001_1 (INWARD RECTIFIER POTASSIUM CHANNEL)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	4 / 5	ALA V  30 TYR A 137 ALA V  60 GLN A 130	None G  21104 ( 4.6A) G  2 891 ( 3.6A) A  21131 ( 3.6A)	1.00A	1xl6A-5xyiV: undetectable 1xl6B-5xyiV: undetectable	1xl6A-5xyiV: 13.95 1xl6B-5xyiV: 13.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZEA_A_DHIA6_0 (MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, H CHAIN MONOCLONAL ANTI-CHOLERA TOXIN IGG1 KAPPA ANTIBODY, L CHAIN SHORT SYNTHETIC D-AMINO ACID PEPTIDE D2)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	3 / 3	TRP J  41 ARG J  38 PHE J  10	None C  2 404 ( 4.2A) None	1.35A	1zeaH-5xyiJ: undetectable 1zeaL-5xyiJ: undetectable	1zeaH-5xyiJ: 21.21 1zeaL-5xyiJ: 20.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZLQ_A_ACTA1502_0 (NICKEL-BINDING PERIPLASMIC PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN S13, PUTATIVE (Trichomonas vaginalis)	4 / 5	TRP N  25 PRO N  23 GLY N  59 GLY N  61	None None None U  2 779 ( 3.1A)	0.99A	1zlqA-5xyiN: undetectable	1zlqA-5xyiN: 15.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZVI_A_H4BA901_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	ARG g  75 VAL g  49 TRP g  60	None	1.20A	1zviA-5xyig: undetectable	1zviA-5xyig: 20.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZR_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.05A	1zzrA-5xyic: undetectable 1zzrB-5xyic: undetectable	1zzrA-5xyic: 11.41 1zzrB-5xyic: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZS_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	1zzsA-5xyiF: undetectable 1zzsB-5xyiF: undetectable	1zzsA-5xyiF: 18.78 1zzsB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.05A	1zzuA-5xyic: undetectable 1zzuB-5xyic: undetectable	1zzuA-5xyic: 11.41 1zzuB-5xyic: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ZZU_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.03A	1zzuA-5xyiF: undetectable 1zzuB-5xyiF: undetectable	1zzuA-5xyiF: 17.42 1zzuB-5xyiF: 17.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ACL_E_REAE504_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 11	ALA O  86 ALA O  85 GLN O  87 LEU O  84 ALA O 126	None	0.99A	2aclE-5xyiO: undetectable	2aclE-5xyiO: 24.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ACL_G_REAG501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 12	ALA O  86 ALA O  85 GLN O  87 LEU O  84 ALA O 126	None	0.95A	2aclG-5xyiO: undetectable	2aclG-5xyiO: 24.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ACL_G_REAG501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.94A	2aclG-5xyiT: undetectable	2aclG-5xyiT: 19.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AOH_C_FRDC305_1 (POL POLYPROTEIN PEPTIDE INHIBITOR)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	4 / 5	LEU V  68 ASP A 156 GLY V  56 ALA V  67	None	0.70A	2aohA-5xyiV: undetectable	2aohA-5xyiV: 23.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2AZY_A_CHDA237_0 (PHOSPHOLIPASE A2, MAJOR ISOENZYME)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	5 / 11	ARG E 100 ILE E 101 GLY E  91 PHE E  47 TYR E  82	None	1.19A	2azyA-5xyiE: undetectable	2azyA-5xyiE: 16.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BM9_A_SAMA301_0 (CEPHALOSPORIN HYDROXYLASE CMCI)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	5 / 12	GLY F 146 ARG F 180 ASP F 164 CYH F 161 ALA F 150	None	1.03A	2bm9A-5xyiF: undetectable	2bm9A-5xyiF: 21.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BR4_A_SAMA301_1 (CEPHALOSPORIN HYDROXYLASE CMCI)	5xyi	40S RIBOSOMAL PROTEIN S17-B, PUTATIVE GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	LYS g 230 ASP R  30 ASP g 124	None	1.05A	2br4A-5xyig: undetectable	2br4A-5xyig: 21.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2EZ7_A_DHIA301_0 (CARBONIC ANHYDRASE 2)	5xyi	RIBOSOMAL PROTEIN S24E, PUTATIVE (Trichomonas vaginalis)	4 / 6	ASN Y  14 GLN Y  21 THR Y  84 PRO Y  86	None	1.36A	2ez7A-5xyiY: undetectable	2ez7A-5xyiY: 18.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FR3_A_REAA300_1 (CELLULAR RETINOIC ACID BINDING PROTEIN 2)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 12	LEU V  78 ILE V  71 ALA V  72 VAL V  52 LEU A 183	None	1.10A	2fr3A-5xyiV: undetectable	2fr3A-5xyiV: 19.57
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2G78_A_REAA200_1 (CELLULAR RETINOIC ACID-BINDING PROTEIN 2)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 12	LEU V  78 ILE V  71 ALA V  72 VAL V  52 LEU A 183	None	1.07A	2g78A-5xyiV: undetectable	2g78A-5xyiV: 18.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HX2_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	2hx2A-5xyic: undetectable 2hx2B-5xyic: undetectable	2hx2A-5xyic: 10.71 2hx2B-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2HX2_B_H4BB760_1 (NITRIC-OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	2hx2A-5xyiF: undetectable 2hx2B-5xyiF: undetectable	2hx2A-5xyiF: 18.78 2hx2B-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IGT_A_SAMA1001_0 (SAM DEPENDENT METHYLTRANSFERASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ALA C 147 ALA C  80 ALA C 117 GLY C 120 GLY C 127	None	0.98A	2igtA-5xyiC: undetectable	2igtA-5xyiC: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2IGT_B_SAMB1002_0 (SAM DEPENDENT METHYLTRANSFERASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ALA C 147 ALA C  80 ALA C 117 GLY C 120 GLY C 127	None	0.97A	2igtB-5xyiC: undetectable	2igtB-5xyiC: 21.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NNP_A_ROCA401_2 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 11	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.90A	2nnpB-5xyiX: undetectable	2nnpB-5xyiX: 20.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2NSE_A_H4BA600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	2nseA-5xyic: undetectable 2nseB-5xyic: undetectable	2nseA-5xyic: 12.80 2nseB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VAV_F_CSCF1383_2 (ACETYL-COA--DEACETYL CEPHALOSPORIN C ACETYLTRANSFERASE)	5xyi	40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	3 / 3	LEU A 145 MET A 169 MET A  15	None	1.05A	2vavF-5xyiA: undetectable	2vavF-5xyiA: 20.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WD9_A_IBPA1570_1 (ACYL-COENZYME A SYNTHETASE ACSM2A, MITOCHONDRIAL)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	4 / 7	ILE Q  26 LEU Q  25 GLY Q  22 GLY Q  58	None	0.61A	2wd9A-5xyiQ: undetectable	2wd9A-5xyiQ: 13.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WD9_B_IBPB1570_1 (ACYL-COENZYME A SYNTHETASE ACSM2A, MITOCHONDRIAL)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	4 / 8	ILE Q  26 LEU Q  25 GLY Q  22 GLY Q  58	None	0.60A	2wd9B-5xyiQ: undetectable	2wd9B-5xyiQ: 13.03
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2XH9_A_J01A1437_1 (ORF12)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 11	THR C 219 SER C 215 GLY C 196 ALA C 198 ARG J  15	U  2   3 ( 4.1A) U  2   3 ( 3.5A) U  2   3 ( 3.9A) U  2   4 ( 4.3A) U  2   3 ( 2.9A)	1.33A	2xh9A-5xyiC: undetectable	2xh9A-5xyiC: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZW9_B_SAMB801_0 (LEUCINE CARBOXYL METHYLTRANSFERASE 2)	5xyi	40S RIBOSOMAL PROTEIN S17-B, PUTATIVE GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis; Trichomonas vaginalis)	5 / 12	GLN R  23 GLY g 189 GLY g 211 ASP g 210 ASN g 144	None	1.08A	2zw9B-5xyiR: undetectable	2zw9B-5xyiR: 11.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3A2Q_A_ACAA601_1 (6-AMINOHEXANOATE-CYC LIC-DIMER HYDROLASE)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	4 / 7	ALA Q  15 ALA Q  13 VAL Q  64 ILE Q  45	None	0.79A	3a2qA-5xyiQ: undetectable	3a2qA-5xyiQ: 13.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_F_SVRF502_3 (PHOSPHOLIPASE A2)	5xyi	RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis)	5 / 12	VAL W  73 GLY W 127 ILE W 125 LYS W 124 PRO W  77	None None None U  2 650 ( 3.3A) G  2 911 ( 4.9A)	1.09A	3bjwF-5xyiW: undetectable	3bjwF-5xyiW: 19.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BJW_G_SVRG506_3 (PHOSPHOLIPASE A2)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	3 / 3	PRO Q 123 PHE Q 126 LYS Q 124	C  21412 ( 4.3A) None A  21411 ( 2.8A)	1.23A	3bjwG-5xyiQ: undetectable	3bjwG-5xyiQ: 19.74
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CL9_A_MTXA602_2 (BIFUNCTIONAL DIHYDROFOLATE REDUCTASE-THYMIDYLAT E SYNTHASE (DHFR-TS))	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	4 / 4	VAL O  50 ARG O 125 ILE O 137 THR O  48	None	0.89A	3cl9A-5xyiO: undetectable	3cl9A-5xyiO: 16.90
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CR5_X_PNTX94_0 (PROTEIN S100-B)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	3 / 3	PHE B  96 CYH B 181 PHE B 184	None	1.10A	3cr5X-5xyiB: undetectable	3cr5X-5xyiB: 13.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CYX_A_ROCA201_2 (HIV-1 PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	3 / 3	ARG E 245 VAL E 225 THR E 220	U  2 635 ( 4.7A) None A  2 601 ( 4.5A)	0.67A	3cyxA-5xyiE: undetectable	3cyxA-5xyiE: 19.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DFR_A_MTXA164_1 (DIHYDROFOLATE REDUCTASE)	5xyi	40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 12	LEU A  92 ASP A  71 LEU A  73 LEU A 145 ALA A  59	None	1.08A	3dfrA-5xyiA: undetectable	3dfrA-5xyiA: 22.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DH0_A_SAMA220_1 (SAM DEPENDENT METHYLTRANSFERASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE RIBOSOMAL PROTEIN S14 UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis; Trichomonas vaginalis)	4 / 8	ARG O 129 GLN c   7 GLU F 186 GLU c  59	None	1.37A	3dh0A-5xyiO: undetectable	3dh0A-5xyiO: 20.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DQR_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.09A	3dqrA-5xyic: undetectable 3dqrB-5xyic: undetectable	3dqrA-5xyic: 11.36 3dqrB-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DQS_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	3dqsA-5xyic: undetectable 3dqsB-5xyic: undetectable	3dqsA-5xyic: 10.71 3dqsB-5xyic: 10.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DQS_B_H4BB760_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	3dqsA-5xyiF: undetectable 3dqsB-5xyiF: undetectable	3dqsA-5xyiF: 18.78 3dqsB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DQT_B_H4BB760_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	3dqtA-5xyiF: undetectable 3dqtB-5xyiF: undetectable	3dqtA-5xyiF: 18.78 3dqtB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKP_B_478B200_2 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 10	LEU V  68 ASP A 156 ASP A 153 GLY V  56 ALA V  67	None None U  2 889 ( 2.7A) None None	0.92A	3ekpB-5xyiV: undetectable	3ekpB-5xyiV: 24.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EKP_C_478C200_1 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S21 40S RIBOSOMAL PROTEIN SA (Trichomonas vaginalis)	5 / 10	LEU V  68 ASP A 156 ASP A 153 GLY V  56 ALA V  67	None None U  2 889 ( 2.7A) None None	0.91A	3ekpC-5xyiV: undetectable	3ekpC-5xyiV: 24.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EL5_B_1UNB201_1 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 10	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.95A	3el5A-5xyiX: undetectable	3el5A-5xyiX: 18.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM0_B_CHDB152_0 (ILEAL BILE ACID-BINDING PROTEIN)	5xyi	RIBOSOMAL PROTEIN S13P/S18E, PUTATIVE (Trichomonas vaginalis)	5 / 8	ILE S  35 PRO S  76 ASN S  75 HIS S  79 VAL S  46	None	0.94A	3em0B-5xyiS: undetectable	3em0B-5xyiS: 23.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_A_DR7A100_2 (PROTEASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	ASP g  42 ALA g  92 ASP g  91 LEU g  96 VAL g  59	None	1.20A	3em4B-5xyig: undetectable	3em4B-5xyig: 15.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3F8W_A_ADNA300_1 (PURINE-NUCLEOSIDE PHOSPHORYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ALA C 206 GLY C 127 VAL C 119 GLY C 120 VAL C 154	None	1.00A	3f8wA-5xyiC: undetectable	3f8wA-5xyiC: 21.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3F8W_C_ADNC302_1 (PURINE-NUCLEOSIDE PHOSPHORYLASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ALA C 206 GLY C 127 VAL C 119 GLY C 120 VAL C 154	None	1.02A	3f8wC-5xyiC: undetectable	3f8wC-5xyiC: 21.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FAL_C_REAC501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 10	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.89A	3falC-5xyiT: undetectable	3falC-5xyiT: 19.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FC6_A_REAA501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 11	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.87A	3fc6A-5xyiT: undetectable	3fc6A-5xyiT: 19.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_A_TRPA1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 10	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fhjA-5xyig: undetectable	3fhjA-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_B_TRPB1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 10	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.34A	3fhjB-5xyig: undetectable	3fhjB-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_C_TRPC1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 10	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fhjC-5xyig: undetectable	3fhjC-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_D_TRPD1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fhjD-5xyig: undetectable	3fhjD-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_E_TRPE1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 10	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fhjE-5xyig: undetectable	3fhjE-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FHJ_F_TRPF1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fhjF-5xyig: undetectable	3fhjF-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_A_TRPA1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.37A	3fi0A-5xyig: undetectable	3fi0A-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_C_TRPC1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.37A	3fi0C-5xyig: undetectable	3fi0C-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_D_TRPD1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.35A	3fi0D-5xyig: undetectable	3fi0D-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_F_TRPF1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.37A	3fi0F-5xyig: undetectable	3fi0F-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_J_TRPJ1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.39A	3fi0J-5xyig: undetectable	3fi0J-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_L_TRPL1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.39A	3fi0L-5xyig: undetectable	3fi0L-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_M_TRPM1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.37A	3fi0M-5xyig: undetectable	3fi0M-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FI0_R_TRPR1001_0 (TRYPTOPHANYL-TRNA SYNTHETASE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 9	GLY g 127 VAL g 125 HIS g 121 ILE g 138 VAL g 184	None	1.37A	3fi0R-5xyig: undetectable	3fi0R-5xyig: 22.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FPJ_B_SAMB301_0 (PUTATIVE UNCHARACTERIZED PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN S7, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE H  24 VAL H   5 ILE H  69 GLU H  62 VAL H  42	None	1.16A	3fpjB-5xyiH: undetectable	3fpjB-5xyiH: 21.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HGX_A_SALA102_1 (SALICYLATE BIOSYNTHESIS PROTEIN PCHB)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 7	VAL F  53 ILE F 136 TYR F  27 ILE F  28	None	1.05A	3hgxA-5xyiF: undetectable	3hgxA-5xyiF: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HGX_B_SALB104_1 (SALICYLATE BIOSYNTHESIS PROTEIN PCHB)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	5 / 9	VAL F  53 VAL F 105 ILE F 136 TYR F  27 ILE F  28	None	1.38A	3hgxB-5xyiF: undetectable	3hgxB-5xyiF: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3HJO_A_EAAA211_1 (GLUTATHIONE S-TRANSFERASE P)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 8	TYR F  10 PHE F   7 VAL F  38 ILE Z  77	None	0.74A	3hjoA-5xyiF: undetectable	3hjoA-5xyiF: 19.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ILT_H_TRUH800_1 (GLUTAMATE RECEPTOR 2)	5xyi	RIBOSOMAL PROTEIN S3, PUTATIVE (Trichomonas vaginalis)	3 / 3	ILE D 183 SER D 151 SER D 149	None	0.59A	3iltH-5xyiD: undetectable	3iltH-5xyiD: 22.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWX_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	3jwxA-5xyiF: undetectable 3jwxB-5xyiF: undetectable	3jwxA-5xyiF: 18.04 3jwxB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWY_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	3jwyA-5xyic: undetectable 3jwyB-5xyic: undetectable	3jwyA-5xyic: 12.80 3jwyB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWY_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.01A	3jwyA-5xyiF: undetectable 3jwyB-5xyiF: undetectable	3jwyA-5xyiF: 18.04 3jwyB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWZ_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	3jwzA-5xyic: undetectable 3jwzB-5xyic: undetectable	3jwzA-5xyic: 12.80 3jwzB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWZ_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	3jwzA-5xyiF: undetectable 3jwzB-5xyiF: undetectable	3jwzA-5xyiF: 18.04 3jwzB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JX2_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.05A	3jx2A-5xyic: undetectable 3jx2B-5xyic: undetectable	3jx2A-5xyic: 11.36 3jx2B-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JX3_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.06A	3jx3A-5xyic: undetectable 3jx3B-5xyic: undetectable	3jx3A-5xyic: 11.36 3jx3B-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JX6_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.10A	3jx6A-5xyic: undetectable 3jx6B-5xyic: undetectable	3jx6A-5xyic: 11.36 3jx6B-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K4V_D_ROCD201_1 (HIV-1 PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.92A	3k4vC-5xyiX: undetectable	3k4vC-5xyiX: 19.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP3_B_AICB2002_1 (TRANSCRIPTIONAL REGULATOR TCAR)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	3 / 3	ALA X  12 ARG X  16 LYS X  20	None None C  2 242 ( 4.4A)	0.66A	3kp3B-5xyiX: undetectable	3kp3B-5xyiX: 20.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP5_B_KANB2002_1 (TRANSCRIPTIONAL REGULATOR TCAR)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	3 / 3	ALA X  12 ARG X  16 LYS X  20	None None C  2 242 ( 4.4A)	0.87A	3kp5B-5xyiX: undetectable	3kp5B-5xyiX: 20.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP6_B_SALB3001_1 (TRANSCRIPTIONAL REGULATOR TCAR)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 8	GLU B  24 LYS B  23 ASN B  46 ILE B  21	None C  2 716 ( 2.7A) None None	1.13A	3kp6A-5xyiB: undetectable 3kp6B-5xyiB: undetectable	3kp6A-5xyiB: 20.49 3kp6B-5xyiB: 20.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_A_PZIA800_0 (GLUTAMATE RECEPTOR 2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 7	ASN B 175 LEU B 180 ASP B 183 LYS B 182	None	1.34A	3lslA-5xyiB: undetectable 3lslD-5xyiB: undetectable	3lslA-5xyiB: 25.00 3lslD-5xyiB: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_G_PZIG800_0 (GLUTAMATE RECEPTOR 2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 6	ASN B 175 LEU B 180 ASP B 183 LYS B 182	None	1.38A	3lslG-5xyiB: undetectable	3lslG-5xyiB: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N5R_A_H4BA600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	3n5rA-5xyic: undetectable 3n5rB-5xyic: undetectable	3n5rA-5xyic: 12.80 3n5rB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N5R_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	3n5rA-5xyiF: undetectable 3n5rB-5xyiF: undetectable	3n5rA-5xyiF: 18.04 3n5rB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N5S_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	3n5sA-5xyiF: undetectable 3n5sB-5xyiF: undetectable	3n5sA-5xyiF: 18.04 3n5sB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N5T_A_H4BA600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	3n5tA-5xyic: undetectable 3n5tB-5xyic: undetectable	3n5tA-5xyic: 12.80 3n5tB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N5T_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	3n5tA-5xyiF: undetectable 3n5tB-5xyiF: undetectable	3n5tA-5xyiF: 18.04 3n5tB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N6E_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	3n6eA-5xyiF: undetectable 3n6eB-5xyiF: undetectable	3n6eA-5xyiF: 18.04 3n6eB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NAI_A_URFA521_1 (RNA DEPENDENT RNA POLYMERASE)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 5	ASP E 143 ASP E  73 ASP E  88 ARG E 100	None	1.12A	3naiA-5xyiE: undetectable	3naiA-5xyiE: 20.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NLG_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	3nlgA-5xyic: undetectable 3nlgB-5xyic: undetectable	3nlgA-5xyic: 12.80 3nlgB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NLG_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	3nlgA-5xyiF: undetectable 3nlgB-5xyiF: undetectable	3nlgA-5xyiF: 18.04 3nlgB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NLJ_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.09A	3nljA-5xyic: undetectable 3nljB-5xyic: undetectable	3nljA-5xyic: 11.36 3nljB-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NLR_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.10A	3nlrA-5xyic: undetectable 3nlrB-5xyic: undetectable	3nlrA-5xyic: 11.36 3nlrB-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NMU_F_SAMF228_0 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE NOP5/NOP56 RELATED PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	5 / 12	TYR Q  76 GLY Q   8 ALA Q  15 ASP Q 117 ALA Q 116	None	1.15A	3nmuA-5xyiQ: undetectable 3nmuF-5xyiQ: undetectable	3nmuA-5xyiQ: 16.36 3nmuF-5xyiQ: 22.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NOS_A_H4BA511_1 (ENDOTHELIAL NITRIC-OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.06A	3nosA-5xyic: undetectable 3nosB-5xyic: undetectable	3nosA-5xyic: 10.28 3nosB-5xyic: 10.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NU4_B_478B401_1 (PROTEASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 9	ALA L 124 ILE L  36 ILE L 109 VAL L  62 ILE L  64	None None None None G  2 188 ( 4.9A)	1.08A	3nu4A-5xyiL: undetectable	3nu4A-5xyiL: 21.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NVK_J_SAMJ228_0 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE NOP5/NOP56 RELATED PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE (Trichomonas vaginalis)	5 / 12	TYR Q  76 GLY Q   8 ALA Q  15 ASP Q 117 ALA Q 116	None	1.20A	3nvkF-5xyiQ: undetectable 3nvkJ-5xyiQ: undetectable	3nvkF-5xyiQ: 16.49 3nvkJ-5xyiQ: 22.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PNH_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.01A	3pnhA-5xyiF: undetectable 3pnhB-5xyiF: 1.7	3pnhA-5xyiF: 18.78 3pnhB-5xyiF: 18.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3REM_B_SALB301_1 (SALICYLATE BIOSYNTHESIS PROTEIN PCHB)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 8	VAL F  53 VAL F 105 TYR F  27 ILE F  28	None	1.05A	3remB-5xyiF: undetectable	3remB-5xyiF: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ROD_D_NCAD302_0 (NICOTINAMIDE N-METHYLTRANSFERASE)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE 40S RIBOSOMAL PROTEIN S26 (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 7	LEU B  74 ASP B  73 ALA B  68 TYR a  59	None	1.09A	3rodD-5xyiB: undetectable	3rodD-5xyiB: 20.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RQO_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	3rqoA-5xyic: undetectable 3rqoB-5xyic: undetectable	3rqoA-5xyic: 12.84 3rqoB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RQO_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.02A	3rqoA-5xyiF: undetectable 3rqoB-5xyiF: undetectable	3rqoA-5xyiF: 18.08 3rqoB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3S56_A_ROCA201_1 (PROTEASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	GLY C 175 ALA C 232 VAL C 154 PRO C 186 ILE C 185	None None None None A  2   1 ( 4.5A)	0.82A	3s56A-5xyiC: undetectable	3s56A-5xyiC: 20.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SPK_B_TPVB100_2 (HIV-1 PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.91A	3spkB-5xyiX: undetectable	3spkB-5xyiX: 18.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TBG_A_RTZA2_1 (CYTOCHROME P450 2D6)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 11	THR C 172 VAL C 169 SER C 215 LEU C 203 VAL C 194	U  2 907 ( 3.7A) None U  2   3 ( 3.5A) None C  2   2 ( 4.7A)	1.34A	3tbgA-5xyiC: undetectable	3tbgA-5xyiC: 20.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TJ7_A_ACTA609_0 (GBAA_1210 PROTEIN)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	3 / 3	LYS O 104 VAL O  38 HIS O 102	None	1.09A	3tj7A-5xyiO: undetectable	3tj7A-5xyiO: 18.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TPX_C_ACTC207_0 (E3 UBIQUITIN-PROTEIN LIGASE MDM2)	5xyi	40S RIBOSOMAL PROTEIN S26 (Trichomonas vaginalis)	4 / 4	LYS a  66 PRO a  65 LEU a  64 ASN a  43	None	1.49A	3tpxC-5xyia: undetectable	3tpxC-5xyia: 20.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TWP_A_SALA404_1 (ANTHRANILATE PHOSPHORIBOSYLTRANSF ERASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 7	ASN F 157 ALA F 159 ARG F 148 ALA F 151	U  21283 ( 3.6A) None U  21283 ( 4.9A) U  21283 ( 4.2A)	1.10A	3twpA-5xyiF: undetectable	3twpA-5xyiF: 19.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TX2_A_BEZA251_0 (PROBABLE 6-PHOSPHOGLUCONOLACT ONASE)	5xyi	40S RIBOSOMAL PROTEIN SA 40S RIBOSOMAL PROTEIN S17-B, PUTATIVE (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 7	ARG R  81 ALA A 212 TRP R  84 ALA A 209	None	1.19A	3tx2A-5xyiR: undetectable	3tx2A-5xyiR: 20.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TZF_B_08DB280_1 (7,8-DIHYDROPTEROATE SYNTHASE)	5xyi	RIBOSOMAL PROTEIN S15A UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 8	THR J  59 ARG J  67 PRO J  61 GLY W  84	None	0.89A	3tzfB-5xyiJ: undetectable	3tzfB-5xyiJ: 20.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U5J_A_08HA1_1 (BROMODOMAIN-CONTAINI NG PROTEIN 4)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 7	LEU V  77 LEU V  78 ILE V  71 MET V  18	None	0.99A	3u5jA-5xyiV: undetectable	3u5jA-5xyiV: 20.31
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3U6T_A_KANA4699_1 (RIBOSOME INACTIVATING PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	5 / 10	GLU E  97 SER E  95 ILE E  64 ALA E  55 GLU E  60	None	1.40A	3u6tA-5xyiE: undetectable	3u6tA-5xyiE: 20.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UT5_B_LOCB502_1 (TUBULIN BETA CHAIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	ALA C 198 LEU C 202 MET C 205 ALA C 118 ILE C 116	U  2   4 ( 4.3A) None None None None	1.13A	3ut5B-5xyiC: undetectable	3ut5B-5xyiC: 19.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_E_ACTE502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	5xyi	RIBOSOMAL PROTEIN S3, PUTATIVE (Trichomonas vaginalis)	3 / 3	LYS D 201 ARG D  94 LEU D 191	None	1.29A	3v4tE-5xyiD: undetectable	3v4tE-5xyiD: 19.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_D_W9TD507_1 (HEMOLYTIC LECTIN CEL-III)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 5	ASP E 143 GLU E  40 GLY E  85 ASP E  73	None	1.34A	3w9tD-5xyiE: undetectable	3w9tD-5xyiE: 19.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WIP_G_ACHG301_0 (ACETYLCHOLINE-BINDIN G PROTEIN)	5xyi	RIBOSOMAL PROTEIN S3, PUTATIVE PLECTIN/S10 DOMAIN CONTAINING PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 8	TYR K  42 TYR K  65 ARG D  28 LEU D  25	None None A  21245 ( 3.9A) None	1.08A	3wipG-5xyiK: undetectable 3wipH-5xyiK: undetectable	3wipG-5xyiK: 21.98 3wipH-5xyiK: 21.98
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3WIP_J_ACHJ301_0 (ACETYLCHOLINE-BINDIN G PROTEIN)	5xyi	RIBOSOMAL PROTEIN S3, PUTATIVE PLECTIN/S10 DOMAIN CONTAINING PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 8	ARG D  28 LEU D  25 TYR K  42 TYR K  65	A  21245 ( 3.9A) None None None	1.09A	3wipF-5xyiD: undetectable 3wipJ-5xyiD: undetectable	3wipF-5xyiD: 20.66 3wipJ-5xyiD: 20.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4BLV_A_SAMA1281_1 (RIBOSOMAL RNA LARGE SUBUNIT METHYLTRANSFERASE J)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 6	HIS g 255 SER g 215 GLU g  37 ASP g 124	None	1.29A	4blvA-5xyig: undetectable	4blvA-5xyig: 19.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C3A_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	4c3aA-5xyic: undetectable 4c3aB-5xyic: undetectable	4c3aA-5xyic: 12.84 4c3aB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4C3A_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4c3aA-5xyiF: undetectable 4c3aB-5xyiF: undetectable	4c3aA-5xyiF: 18.08 4c3aB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CAR_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	4carA-5xyic: undetectable 4carB-5xyic: undetectable	4carA-5xyic: 12.84 4carB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CAR_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.01A	4carA-5xyiF: undetectable 4carB-5xyiF: undetectable	4carA-5xyiF: 18.08 4carB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CFT_A_H4BA600_1 (ENDOTHELIAL NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	4cftA-5xyic: undetectable 4cftB-5xyic: undetectable	4cftA-5xyic: 12.84 4cftB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CFT_B_H4BB600_1 (ENDOTHELIAL NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4cftA-5xyiF: undetectable 4cftB-5xyiF: 0.9	4cftA-5xyiF: 18.08 4cftB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CTY_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	4ctyA-5xyic: undetectable 4ctyB-5xyic: undetectable	4ctyA-5xyic: 12.84 4ctyB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CU0_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	4cu0A-5xyic: undetectable 4cu0B-5xyic: undetectable	4cu0A-5xyic: 12.84 4cu0B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CU0_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4cu0A-5xyiF: undetectable 4cu0B-5xyiF: undetectable	4cu0A-5xyiF: 18.08 4cu0B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CU1_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	4cu1A-5xyic: undetectable 4cu1B-5xyic: undetectable	4cu1A-5xyic: 12.84 4cu1B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CU1_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4cu1A-5xyiF: undetectable 4cu1B-5xyiF: undetectable	4cu1A-5xyiF: 18.08 4cu1B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWV_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	4cwvA-5xyic: undetectable 4cwvB-5xyic: undetectable	4cwvA-5xyic: 12.84 4cwvB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWV_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	4cwvA-5xyiF: undetectable 4cwvB-5xyiF: undetectable	4cwvA-5xyiF: 18.08 4cwvB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWW_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	4cwwA-5xyic: undetectable 4cwwB-5xyic: undetectable	4cwwA-5xyic: 12.84 4cwwB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWW_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	4cwwA-5xyiF: undetectable 4cwwB-5xyiF: undetectable	4cwwA-5xyiF: 18.08 4cwwB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWX_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4cwxA-5xyiF: undetectable 4cwxB-5xyiF: undetectable	4cwxA-5xyiF: 18.08 4cwxB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWY_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4cwyA-5xyiF: undetectable 4cwyB-5xyiF: undetectable	4cwyA-5xyiF: 18.08 4cwyB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWZ_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	4cwzA-5xyic: undetectable 4cwzB-5xyic: undetectable	4cwzA-5xyic: 12.84 4cwzB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CX0_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	4cx0A-5xyic: undetectable 4cx0B-5xyic: undetectable	4cx0A-5xyic: 12.84 4cx0B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CX0_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.01A	4cx0A-5xyiF: undetectable 4cx0B-5xyiF: undetectable	4cx0A-5xyiF: 18.08 4cx0B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CX3_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	4cx3A-5xyic: undetectable 4cx3B-5xyic: undetectable	4cx3A-5xyic: 11.36 4cx3B-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CX4_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.05A	4cx4A-5xyic: undetectable 4cx4B-5xyic: undetectable	4cx4A-5xyic: 11.36 4cx4B-5xyic: 11.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D1O_A_H4BA1481_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	4d1oA-5xyic: undetectable 4d1oB-5xyic: undetectable	4d1oA-5xyic: 10.11 4d1oB-5xyic: 10.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D1O_B_H4BB1481_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	4d1oA-5xyiF: undetectable 4d1oB-5xyiF: undetectable	4d1oA-5xyiF: 18.69 4d1oB-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D1P_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	4d1pA-5xyiF: undetectable 4d1pB-5xyiF: undetectable	4d1pA-5xyiF: 18.69 4d1pB-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D34_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.95A	4d34A-5xyic: undetectable 4d34B-5xyic: undetectable	4d34A-5xyic: 12.84 4d34B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D34_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	4d34A-5xyiF: undetectable 4d34B-5xyiF: undetectable	4d34A-5xyiF: 18.08 4d34B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D35_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4d35A-5xyiF: undetectable 4d35B-5xyiF: undetectable	4d35A-5xyiF: 18.08 4d35B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D36_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4d36A-5xyiF: undetectable 4d36B-5xyiF: undetectable	4d36A-5xyiF: 18.08 4d36B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D37_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4d37A-5xyiF: undetectable 4d37B-5xyiF: undetectable	4d37A-5xyiF: 18.08 4d37B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D38_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	4d38A-5xyic: undetectable 4d38B-5xyic: undetectable	4d38A-5xyic: 12.84 4d38B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D38_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4d38A-5xyiF: undetectable 4d38B-5xyiF: undetectable	4d38A-5xyiF: 18.08 4d38B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D39_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	4d39A-5xyiF: undetectable 4d39B-5xyiF: undetectable	4d39A-5xyiF: 18.08 4d39B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D3A_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	4d3aA-5xyic: undetectable 4d3aB-5xyic: undetectable	4d3aA-5xyic: 12.84 4d3aB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D3A_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	4d3aA-5xyiF: undetectable 4d3aB-5xyiF: undetectable	4d3aA-5xyiF: 18.08 4d3aB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DF3_A_SAMA301_1 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	3 / 3	TYR L  88 THR L 103 GLU L  99	G  2 239 ( 4.4A) U  2 238 ( 2.8A) None	0.66A	4df3A-5xyiL: undetectable	4df3A-5xyiL: 24.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4DF3_B_SAMB301_1 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	3 / 3	TYR L  88 THR L 103 GLU L  99	G  2 239 ( 4.4A) U  2 238 ( 2.8A) None	0.66A	4df3B-5xyiL: undetectable	4df3B-5xyiL: 24.15
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EAT_A_BEZA1000_0 (BENZOATE-COENZYME A LIGASE)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 7	ALA E 119 GLY E  74 GLY E  91 ILE E  90	None	0.55A	4eatA-5xyiE: undetectable	4eatA-5xyiE: 19.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EQ4_A_SALA601_1 (4-SUBSTITUTED BENZOATES-GLUTAMATE LIGASE GH3.12)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 7	LEU V  61 TYR V  57 ARG V  22 THR V  20	U  2 890 ( 4.3A) None None None	0.89A	4eq4A-5xyiV: undetectable	4eq4A-5xyiV: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EQL_A_SALA602_1 (4-SUBSTITUTED BENZOATES-GLUTAMATE LIGASE GH3.12)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 7	LEU V  61 TYR V  57 ARG V  22 THR V  20	U  2 890 ( 4.3A) None None None	0.86A	4eqlA-5xyiV: undetectable	4eqlA-5xyiV: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4EQL_B_SALB602_1 (4-SUBSTITUTED BENZOATES-GLUTAMATE LIGASE GH3.12)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 7	LEU V  61 TYR V  57 ARG V  22 THR V  20	U  2 890 ( 4.3A) None None None	0.91A	4eqlB-5xyiV: undetectable	4eqlB-5xyiV: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4HBF_A_DXCA75_0 (PPCA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	4 / 7	ILE T 107 LEU T 111 LYS T 125 GLY T 126	None None G  21177 ( 4.2A) G  21306 ( 4.3A)	0.94A	4hbfA-5xyiT: undetectable	4hbfA-5xyiT: 21.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4I41_A_MIXA501_1 (SERINE/THREONINE-PRO TEIN KINASE PIM-1)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	5 / 12	ILE E 228 THR E 220 VAL E 208 ASP E 179 ILE E 195	None A  2 601 ( 4.5A) None None None	1.36A	4i41A-5xyiE: undetectable	4i41A-5xyiE: 23.61
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IAQ_A_2GMA2001_2 (CHIMERA PROTEIN OF HUMAN 5-HYDROXYTRYPTAMINE RECEPTOR 1B AND E. COLI SOLUBLE CYTOCHROME B562)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	ILE L 105 THR L 103 VAL L 137 ASP L 119	None U  2 238 ( 2.8A) None None	1.13A	4iaqA-5xyiL: undetectable	4iaqA-5xyiL: 16.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IMX_A_H4BA502_1 (SUBUNIT A)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	4imxA-5xyic: undetectable 4imxB-5xyic: undetectable	4imxA-5xyic: 12.87 4imxB-5xyic: 12.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IMX_B_H4BB502_1 (SUBUNIT A)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	4imxA-5xyiF: undetectable 4imxB-5xyiF: undetectable	4imxA-5xyiF: 18.12 4imxB-5xyiF: 18.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JKS_A_ADNA401_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.18A	4jksA-5xyiJ: undetectable	4jksA-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JKS_B_ADNB401_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.18A	4jksB-5xyiJ: undetectable	4jksB-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JKU_A_ADNA500_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.18A	4jkuA-5xyiJ: undetectable	4jkuA-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JSL_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	4jslA-5xyic: undetectable 4jslB-5xyic: undetectable	4jslA-5xyic: 12.84 4jslB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JSM_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.95A	4jsmA-5xyic: undetectable 4jsmB-5xyic: undetectable	4jsmA-5xyic: 12.84 4jsmB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4JSM_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	4jsmA-5xyiF: undetectable 4jsmB-5xyiF: undetectable	4jsmA-5xyiF: 18.08 4jsmB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K4Y_A_ACTA502_0 (RNA-DEPENDENT RNA POLYMERASE)	5xyi	40S RIBOSOMAL PROTEIN SA 40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 5	LYS A  57 LEU A  58 GLU A  54 LEU V  78	None	1.12A	4k4yA-5xyiA: undetectable	4k4yA-5xyiA: 19.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K4Y_E_ACTE503_0 (RNA-DEPENDENT RNA POLYMERASE)	5xyi	40S RIBOSOMAL PROTEIN SA 40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 4	LYS A  57 LEU A  58 GLU A  54 LEU V  78	None	1.14A	4k4yE-5xyiA: undetectable	4k4yE-5xyiA: 19.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K4Y_I_ACTI503_0 (RNA-DEPENDENT RNA POLYMERASE)	5xyi	40S RIBOSOMAL PROTEIN SA 40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 5	LYS A  57 LEU A  58 GLU A  54 LEU V  78	None	1.14A	4k4yI-5xyiA: undetectable	4k4yI-5xyiA: 19.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5H_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	4k5hA-5xyic: undetectable 4k5hB-5xyic: undetectable	4k5hA-5xyic: 12.84 4k5hB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5H_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	4k5hA-5xyiF: undetectable 4k5hB-5xyiF: undetectable	4k5hA-5xyiF: 18.08 4k5hB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5I_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	4k5iA-5xyic: undetectable 4k5iB-5xyic: undetectable	4k5iA-5xyic: 12.84 4k5iB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5I_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	4k5iA-5xyiF: undetectable 4k5iB-5xyiF: undetectable	4k5iA-5xyiF: 18.08 4k5iB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5J_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	4k5jA-5xyic: undetectable 4k5jB-5xyic: undetectable	4k5jA-5xyic: 12.84 4k5jB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5J_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	4k5jA-5xyiF: undetectable 4k5jB-5xyiF: undetectable	4k5jA-5xyiF: 18.08 4k5jB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K5K_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	4k5kA-5xyic: undetectable 4k5kB-5xyic: undetectable	4k5kA-5xyic: 12.84 4k5kB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K8K_B_ADNB403_2 (SUGAR KINASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.20A	4k8kB-5xyiJ: undetectable	4k8kB-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KAL_A_ADNA401_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.17A	4kalA-5xyiJ: undetectable	4kalA-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KAL_B_ADNB401_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.18A	4kalB-5xyiJ: undetectable	4kalB-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KCP_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4kcpA-5xyiF: undetectable 4kcpB-5xyiF: undetectable	4kcpA-5xyiF: 18.08 4kcpB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KCQ_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4kcqA-5xyiF: undetectable 4kcqB-5xyiF: undetectable	4kcqA-5xyiF: 18.08 4kcqB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KCR_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	4kcrA-5xyiF: undetectable 4kcrB-5xyiF: undetectable	4kcrA-5xyiF: 18.08 4kcrB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KCS_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.00A	4kcsA-5xyiF: undetectable 4kcsB-5xyiF: undetectable	4kcsA-5xyiF: 18.08 4kcsB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L39_A_SALA602_1 (4-SUBSTITUTED BENZOATES-GLUTAMATE LIGASE GH3.12)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 6	LEU V  61 TYR V  57 ARG V  22 THR V  20	U  2 890 ( 4.3A) None None None	0.87A	4l39A-5xyiV: undetectable	4l39A-5xyiV: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L39_B_SALB601_1 (4-SUBSTITUTED BENZOATES-GLUTAMATE LIGASE GH3.12)	5xyi	40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis)	4 / 7	LEU V  61 TYR V  57 ARG V  22 THR V  20	U  2 890 ( 4.3A) None None None	0.89A	4l39B-5xyiV: undetectable	4l39B-5xyiV: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LCA_A_ADNA401_2 (PROBABLE SUGAR KINASE PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	SER J  96 LEU J  75 TYR J  93 PRO C 188	None	1.20A	4lcaA-5xyiJ: undetectable	4lcaA-5xyiJ: 19.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LMN_A_EUIA503_1 (DUAL SPECIFICITY MITOGEN-ACTIVATED PROTEIN KINASE KINASE 1)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	5 / 12	LEU J  97 LEU J 102 ILE J  50 GLY J  82 LEU J  84	None	0.98A	4lmnA-5xyiJ: undetectable	4lmnA-5xyiJ: 22.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LRH_B_FOLB301_1 (FOLATE RECEPTOR ALPHA)	5xyi	UNCHARACTERIZED PROTEIN RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	ASP W 112 TRP C 245 SER W  43	None	0.97A	4lrhB-5xyiW: undetectable	4lrhB-5xyiW: 20.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LRH_F_FOLF301_1 (FOLATE RECEPTOR ALPHA)	5xyi	UNCHARACTERIZED PROTEIN RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	ASP W 112 TRP C 245 SER W  43	None	0.98A	4lrhF-5xyiW: undetectable	4lrhF-5xyiW: 20.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LUW_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	4luwA-5xyic: undetectable 4luwB-5xyic: undetectable	4luwA-5xyic: 12.87 4luwB-5xyic: 12.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LUW_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	4luwA-5xyiF: undetectable 4luwB-5xyiF: undetectable	4luwA-5xyiF: 18.12 4luwB-5xyiF: 18.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4M93_B_ACTB304_0 (S25-26 FAB (IGG1K) HEAVY CHAIN S25-26 FAB (IGG1K) LIGHT CHAIN)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 4	GLY B  89 SER B  90 ARG B  26 PRO B  54	None	1.23A	4m93B-5xyiB: 0.0 4m93C-5xyiB: 0.0	4m93B-5xyiB: 22.71 4m93C-5xyiB: 18.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4MWZ_B_CQAB303_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE, PUTATIVE)	5xyi	40S RIBOSOMAL PROTEIN S7, PUTATIVE (Trichomonas vaginalis)	4 / 8	ILE H  71 LEU H  58 LEU H  61 GLU H  62	None	0.83A	4mwzB-5xyiH: undetectable	4mwzB-5xyiH: 21.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NJU_A_TPVA500_1 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.91A	4njuA-5xyiX: undetectable	4njuA-5xyiX: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NJU_C_TPVC500_1 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.92A	4njuC-5xyiX: undetectable	4njuC-5xyiX: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NQA_A_9CRA501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 11	ILE T  68 ALA T  64 LEU T  25 ALA T  26 LEU T 111	None	1.08A	4nqaA-5xyiT: undetectable	4nqaA-5xyiT: 16.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OK1_A_198A1001_2 (ANDROGEN RECEPTOR)	5xyi	RIBOSOMAL PROTEIN S15A UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 8	LEU C 240 ASN W  70 LEU W  66 ILE W  14	None	0.96A	4ok1A-5xyiC: undetectable	4ok1A-5xyiC: 18.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4PCL_A_SAMA301_0 (O-METHYLTRANSFERASE FAMILY PROTEIN)	5xyi	40S RIBOSOMAL PROTEIN SA UNCHARACTERIZED PROTEIN 40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis; Trichomonas vaginalis; Trichomonas vaginalis)	5 / 12	ALA C  74 GLY V  56 ALA V  60 ALA V  30 TYR A 154	None None G  2 891 ( 3.6A) None None	1.20A	4pclA-5xyiC: undetectable	4pclA-5xyiC: 20.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R29_D_SAMD301_1 (UNCHARACTERIZED PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN 40S RIBOSOMAL PROTEIN S21 (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	ARG V  15 GLU C 252 TYR C  72	None	0.97A	4r29D-5xyiV: undetectable	4r29D-5xyiV: 17.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4S0V_A_SUVA2001_2 (HUMAN OREXIN RECEPTOR TYPE 2 FUSION PROTEIN TO P. ABYSII GLYCOGEN SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 5	ILE F  89 PRO F  97 HIS F  35 VAL F 105	None	1.27A	4s0vA-5xyiF: undetectable	4s0vA-5xyiF: 15.28
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UH7_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.01A	4uh7A-5xyiF: 0.8 4uh7B-5xyiF: undetectable	4uh7A-5xyiF: 18.08 4uh7B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UH8_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4uh8A-5xyiF: undetectable 4uh8B-5xyiF: undetectable	4uh8A-5xyiF: 18.08 4uh8B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UHA_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	4uhaA-5xyiF: undetectable 4uhaB-5xyiF: undetectable	4uhaA-5xyiF: 18.08 4uhaB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UPQ_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	4upqA-5xyic: undetectable 4upqB-5xyic: undetectable	4upqA-5xyic: 12.84 4upqB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UPQ_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	4upqA-5xyiF: undetectable 4upqB-5xyiF: undetectable	4upqA-5xyiF: 18.08 4upqB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4W5Q_A_IPHA902_0 (PROTEIN ARGONAUTE-2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 6	CYH B 197 ILE B 200 GLN B 159 ILE B 117	None	1.15A	4w5qA-5xyiB: undetectable	4w5qA-5xyiB: 14.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4W5T_A_IPHA902_0 (PROTEIN ARGONAUTE-2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 6	CYH B 197 ILE B 200 GLN B 159 ILE B 117	None	1.14A	4w5tA-5xyiB: undetectable	4w5tA-5xyiB: 14.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X1Y_D_LOCD502_2 (TUBULIN BETA CHAIN)	5xyi	RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis)	5 / 12	LEU W  11 LEU W  69 LEU W  38 VAL W  25 ILE W  61	None	1.06A	4x1yD-5xyiW: undetectable	4x1yD-5xyiW: 15.33
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X3M_B_ADNB301_1 (RNA 2'-O RIBOSE METHYLTRANSFERASE)	5xyi	RIBOSOMAL PROTEIN S13P/S18E, PUTATIVE (Trichomonas vaginalis)	5 / 9	LEU S 105 GLY S 106 ILE S  35 SER S  19 LEU S  18	None	1.21A	4x3mB-5xyiS: undetectable	4x3mB-5xyiS: 23.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XV2_B_P06B801_2 (SERINE/THREONINE-PRO TEIN KINASE B-RAF)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 4	GLY B 205 VAL B 136 PHE B 184 ILE B 208	None	1.14A	4xv2B-5xyiB: undetectable	4xv2B-5xyiB: 23.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YBN_A_ACTA303_0 (FLAVIN-NUCLEOTIDE-BI NDING PROTEIN)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	3 / 3	VAL T  35 TYR T  61 ALA T  64	None	0.44A	4ybnA-5xyiT: undetectable	4ybnA-5xyiT: 21.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4C_A_IPHA903_0 (PROTEIN ARGONAUTE-2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 6	CYH B 197 ILE B 200 GLN B 159 ILE B 117	None	1.05A	4z4cA-5xyiB: undetectable	4z4cA-5xyiB: 14.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4C_A_IPHA906_0 (PROTEIN ARGONAUTE-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 6	ASP g 324 ALA g  35 THR g 307 TYR g 322	None	1.35A	4z4cA-5xyig: undetectable	4z4cA-5xyig: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4D_A_IPHA902_0 (PROTEIN ARGONAUTE-2)	5xyi	RIBOSOMAL PROTEIN S3AE, PUTATIVE (Trichomonas vaginalis)	4 / 6	CYH B 197 ILE B 200 GLN B 159 ILE B 117	None	1.15A	4z4dA-5xyiB: undetectable	4z4dA-5xyiB: 14.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4F_A_IPHA904_0 (PROTEIN ARGONAUTE-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 6	ASP g 324 ALA g  35 THR g 307 TYR g 322	None	1.31A	4z4fA-5xyig: undetectable	4z4fA-5xyig: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4G_A_IPHA905_0 (PROTEIN ARGONAUTE-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 5	ASP g 324 ALA g  35 THR g 307 TYR g 322	None	1.36A	4z4gA-5xyig: undetectable	4z4gA-5xyig: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4H_A_IPHA905_0 (PROTEIN ARGONAUTE-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 5	ASP g 324 ALA g  35 THR g 307 TYR g 322	None	1.36A	4z4hA-5xyig: undetectable	4z4hA-5xyig: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Z4I_A_IPHA904_0 (PROTEIN ARGONAUTE-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 6	ASP g 324 ALA g  35 THR g 307 TYR g 322	None	1.31A	4z4iA-5xyig: undetectable	4z4iA-5xyig: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_D_SORD1343_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	4 / 5	ALA T  47 ARG T  63 HIS T  99 ALA T  88	None G  21289 ( 4.0A) A  21331 ( 4.2A) A  21332 ( 4.9A)	1.18A	5a06C-5xyiT: undetectable 5a06D-5xyiT: undetectable	5a06C-5xyiT: 18.08 5a06D-5xyiT: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADJ_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.96A	5adjA-5xyic: undetectable 5adjB-5xyic: undetectable	5adjA-5xyic: 12.84 5adjB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADJ_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	5adjA-5xyiF: undetectable 5adjB-5xyiF: undetectable	5adjA-5xyiF: 18.08 5adjB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADK_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.99A	5adkA-5xyic: undetectable 5adkB-5xyic: undetectable	5adkA-5xyic: 12.84 5adkB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADK_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	5adkA-5xyiF: undetectable 5adkB-5xyiF: undetectable	5adkA-5xyiF: 18.08 5adkB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADL_B_H4BB600_1 (ENDOTHELIAL NITRIC OXIDE SYNTHASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	5adlA-5xyiF: undetectable 5adlB-5xyiF: undetectable	5adlA-5xyiF: 18.08 5adlB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADM_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	5admA-5xyic: undetectable 5admB-5xyic: undetectable	5admA-5xyic: 12.84 5admB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADM_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	5admA-5xyiF: undetectable 5admB-5xyiF: undetectable	5admA-5xyiF: 18.08 5admB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADN_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	5adnA-5xyic: undetectable 5adnB-5xyic: undetectable	5adnA-5xyic: 12.84 5adnB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADN_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	5adnA-5xyiF: undetectable 5adnB-5xyiF: undetectable	5adnA-5xyiF: 18.08 5adnB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B8I_C_FK5C201_2 (CALCINEURIN SUBUNIT B, VARIANT PEPTIDYL-PROLYL CIS-TRANS ISOMERASE)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 4	LEU Z  67 MET Z  34 VAL Z  38 ASN Z  41	None	1.36A	5b8iB-5xyiZ: undetectable	5b8iB-5xyiZ: 16.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5xyi	40S RIBOSOMAL PROTEIN S16, PUTATIVE RIBOSOMAL PROTEIN S10P/S20E, PUTATIVE (Trichomonas vaginalis)	4 / 5	ARG Q 135 GLY Q 128 THR U  78 GLU U  79	U  21275 ( 3.5A) None U  21090 ( 3.6A) C  21005 ( 3.5A)	1.09A	5btiC-5xyiQ: undetectable 5btiD-5xyiQ: undetectable	5btiC-5xyiQ: 15.50 5btiD-5xyiQ: 20.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5CSY_B_ACRB601_2 (4-ALPHA-GLUCANOTRANS FERASE DPE1, CHLOROPLASTIC/AMYLOP LASTIC)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 5	PHE F  86 HIS F  35 LEU F  57 PRO F  97	None	1.42A	5csyB-5xyiF: undetectable	5csyB-5xyiF: 16.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DQY_A_BEZA401_0 (THIOREDOXIN)	5xyi	40S RIBOSOMAL PROTEIN S17-B, PUTATIVE (Trichomonas vaginalis)	4 / 8	ILE R  17 VAL R  54 GLN R  23 CYH R  35	None	1.19A	5dqyA-5xyiR: undetectable	5dqyA-5xyiR: 23.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5DZK_S_BEZS801_0 (ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT 2 BEZ-LEU-LEU)	5xyi	40S RIBOSOMAL PROTEIN S4 (Trichomonas vaginalis)	4 / 6	PHE E 162 SER E 171 LEU E 123 LEU E 124	None	1.33A	5dzke-5xyiE: undetectable 5dzks-5xyiE: undetectable	5dzke-5xyiE: 21.40 5dzks-5xyiE: 10.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FHZ_A_REAA602_1 (ALDEHYDE DEHYDROGENASE FAMILY 1 MEMBER A3)	5xyi	40S RIBOSOMAL PROTEIN S8 (Trichomonas vaginalis)	5 / 12	ILE I 166 GLY I  63 THR I  76 ASN I  94 THR I  82	None	1.46A	5fhzA-5xyiI: undetectable	5fhzA-5xyiI: 19.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FJ2_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	5fj2A-5xyic: undetectable 5fj2B-5xyic: undetectable	5fj2A-5xyic: 12.84 5fj2B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FJ2_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	5fj2A-5xyiF: undetectable 5fj2B-5xyiF: undetectable	5fj2A-5xyiF: 18.08 5fj2B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FJ3_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	5fj3A-5xyic: undetectable 5fj3B-5xyic: undetectable	5fj3A-5xyic: 12.84 5fj3B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FJ3_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	5fj3A-5xyiF: undetectable 5fj3B-5xyiF: undetectable	5fj3A-5xyiF: 18.08 5fj3B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FVO_A_H4BA760_1 (NITRIC OXIDE SYNTHASE, BRAIN)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	ARG g  75 VAL g  49 TRP g  60	None	1.16A	5fvoA-5xyig: undetectable	5fvoA-5xyig: 21.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FVY_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	5fvyA-5xyic: undetectable 5fvyB-5xyic: undetectable	5fvyA-5xyic: 12.84 5fvyB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FVY_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.92A	5fvyA-5xyiF: undetectable 5fvyB-5xyiF: undetectable	5fvyA-5xyiF: 18.08 5fvyB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5G48_A_1FLA1375_1 (DNA POLYMERASE III SUBUNIT BETA)	5xyi	40S RIBOSOMAL PROTEIN S17-B, PUTATIVE (Trichomonas vaginalis)	4 / 8	THR R  55 LEU R  57 ILE R  17 LEU R  61	C  21198 ( 3.9A) None None None	0.93A	5g48A-5xyiR: undetectable	5g48A-5xyiR: 18.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HFJ_E_SAME301_0 (ADENINE SPECIFIC DNA METHYLTRANSFERASE (DPNA))	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	5 / 12	ASP g  54 ALA g  34 GLY g 321 SER g 320 SER g  52	G  21218 ( 4.9A) None None None None	1.27A	5hfjE-5xyig: undetectable	5hfjE-5xyig: 20.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ICX_F_SC2F1_1 (CETUXIMAB FAB LIGHT CHAIN MEDITOPE)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	3 / 3	VAL g 184 GLN g 145 CYH g 161	None	0.84A	5icxC-5xyig: undetectable 5icxF-5xyig: undetectable	5icxC-5xyig: 19.94 5icxF-5xyig: 6.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5IGI_A_ZITA402_2 (MACROLIDE 2'-PHOSPHOTRANSFERAS E)	5xyi	40S RIBOSOMAL PROTEIN S13, PUTATIVE (Trichomonas vaginalis)	4 / 6	HIS N  90 GLU N  87 ALA N  81 LEU N  75	G  2 689 ( 3.5A) G  2 687 ( 3.9A) U  2 658 ( 3.7A) None	1.02A	5igiA-5xyiN: 2.3	5igiA-5xyiN: 18.39
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5INZ_D_DVAD15_0 (THETA DEFENSIN-2, D-PEPTIDE THETA DEFENSIN-2, L-PEPTIDE)	5xyi	40S RIBOSOMAL PROTEIN S27 (Trichomonas vaginalis)	3 / 3	GLY b  43 CYH b  41 CYH b  38	None	0.95A	5inzB-5xyib: undetectable	5inzB-5xyib: 11.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JMN_A_FUAA1101_1 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	5xyi	RIBOSOMAL PROTEIN S24E, PUTATIVE (Trichomonas vaginalis)	4 / 5	ILE Y  56 ILE Y   8 HIS Y   7 VAL Y   6	None A  2 628 ( 4.5A) C  2 626 ( 4.1A) None	0.97A	5jmnA-5xyiY: undetectable	5jmnA-5xyiY: 8.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JMN_C_FUAC1101_1 (MULTIDRUG EFFLUX PUMP SUBUNIT ACRB)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	3 / 3	VAL O 140 HIS O 102 VAL O  38	None	0.58A	5jmnC-5xyiO: undetectable	5jmnC-5xyiO: 10.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JO9_A_SORA302_0 (RIBITOL 2-DEHYDROGENASE)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 12	THR O  60 GLY O  26 PRO O  27 VAL O  28 LEU O  96	None	1.05A	5jo9A-5xyiO: undetectable	5jo9A-5xyiO: 20.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF3_H_BO2H306_1 (PROTEASOME SUBUNIT BETA TYPE-7 PROTEASOME SUBUNIT BETA TYPE-3)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 10	ALA O 126 ALA O 120 GLY O 119 ALA O  82 THR O  48	None	1.09A	5lf3H-5xyiO: undetectable 5lf3I-5xyiO: undetectable	5lf3H-5xyiO: 24.78 5lf3I-5xyiO: 22.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF3_V_BO2V303_1 (PROTEASOME SUBUNIT BETA TYPE-7 PROTEASOME SUBUNIT BETA TYPE-3)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 10	ALA O 126 ALA O 120 GLY O 119 ALA O  82 THR O  48	None	1.09A	5lf3V-5xyiO: undetectable 5lf3W-5xyiO: undetectable	5lf3V-5xyiO: 24.78 5lf3W-5xyiO: 22.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF7_H_6V8H305_0 (PROTEASOME SUBUNIT BETA TYPE-3 PROTEASOME SUBUNIT BETA TYPE-7)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 11	ALA O 126 ALA O 120 GLY O 119 ALA O  82 THR O  48	None	1.08A	5lf7H-5xyiO: undetectable 5lf7I-5xyiO: undetectable	5lf7H-5xyiO: 24.78 5lf7I-5xyiO: 22.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LF7_V_6V8V303_0 (PROTEASOME SUBUNIT BETA TYPE-3 PROTEASOME SUBUNIT BETA TYPE-7)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	5 / 11	ALA O 126 ALA O 120 GLY O 119 ALA O  82 THR O  48	None	1.06A	5lf7V-5xyiO: undetectable 5lf7W-5xyiO: undetectable	5lf7V-5xyiO: 24.78 5lf7W-5xyiO: 22.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N4T_B_BEZB306_0 (BETA-LACTAMASE VIM-2)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	3 / 3	HIS X  19 ASN X  22 ALA X  25	G  2 532 ( 3.9A) G  2 917 ( 3.6A) G  2 917 ( 3.1A)	0.80A	5n4tB-5xyiX: undetectable	5n4tB-5xyiX: 19.50
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NZX_A_9F2A1102_1 (DNA CROSS-LINK REPAIR 1A PROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 8	ASN J  63 ARG J  67 ILE J  68 GLY J  71	None	0.92A	5nzxA-5xyiJ: undetectable	5nzxA-5xyiJ: 14.79
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UAN_A_9CRA503_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.91A	5uanA-5xyiT: undetectable	5uanA-5xyiT: 16.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UAN_A_9CRA503_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 LEU T  25 ALA T  26 LEU T 111	None	0.91A	5uanA-5xyiT: undetectable	5uanA-5xyiT: 16.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UO8_D_H4BD502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.05A	5uo8C-5xyiF: undetectable 5uo8D-5xyiF: undetectable	5uo8C-5xyiF: 18.69 5uo8D-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UO9_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.02A	5uo9A-5xyic: undetectable 5uo9B-5xyic: undetectable	5uo9A-5xyic: 10.11 5uo9B-5xyic: 10.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UO9_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	5uo9A-5xyiF: undetectable 5uo9B-5xyiF: undetectable	5uo9A-5xyiF: 18.69 5uo9B-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UO9_C_H4BC502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	5uo9C-5xyic: undetectable 5uo9D-5xyic: undetectable	5uo9C-5xyic: 10.11 5uo9D-5xyic: 10.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UOD_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.03A	5uodA-5xyic: undetectable 5uodB-5xyic: undetectable	5uodA-5xyic: 12.84 5uodB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UOD_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.03A	5uodA-5xyiF: undetectable 5uodB-5xyiF: undetectable	5uodA-5xyiF: 18.08 5uodB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VV6_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	5vv6A-5xyiF: undetectable 5vv6B-5xyiF: undetectable	5vv6A-5xyiF: 18.08 5vv6B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VV7_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.02A	5vv7A-5xyiF: undetectable 5vv7B-5xyiF: undetectable	5vv7A-5xyiF: 18.08 5vv7B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VV8_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	5vv8A-5xyiF: undetectable 5vv8B-5xyiF: undetectable	5vv8A-5xyiF: 18.08 5vv8B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VV9_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	5vv9A-5xyic: undetectable 5vv9B-5xyic: undetectable	5vv9A-5xyic: 12.84 5vv9B-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VV9_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	5vv9A-5xyiF: undetectable 5vv9B-5xyiF: 1.7	5vv9A-5xyiF: 18.08 5vv9B-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVA_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.93A	5vvaA-5xyic: undetectable 5vvaB-5xyic: undetectable	5vvaA-5xyic: 12.84 5vvaB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVA_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.02A	5vvaA-5xyiF: undetectable 5vvaB-5xyiF: undetectable	5vvaA-5xyiF: 18.08 5vvaB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVB_D_H4BD502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.04A	5vvbC-5xyiF: undetectable 5vvbD-5xyiF: 0.0	5vvbC-5xyiF: 18.69 5vvbD-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVD_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	5vvdA-5xyiF: undetectable 5vvdB-5xyiF: undetectable	5vvdA-5xyiF: 18.69 5vvdB-5xyiF: 18.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVG_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.00A	5vvgA-5xyic: undetectable 5vvgB-5xyic: undetectable	5vvgA-5xyic: 12.84 5vvgB-5xyic: 12.84
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVG_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	5vvgA-5xyiF: undetectable 5vvgB-5xyiF: undetectable	5vvgA-5xyiF: 18.08 5vvgB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VVN_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	5vvnA-5xyiF: undetectable 5vvnB-5xyiF: undetectable	5vvnA-5xyiF: 18.08 5vvnB-5xyiF: 18.08
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Y9Y_A_ACTA412_0 (UNCHARACTERIZED PROTEIN KDOO)	5xyi	UNCHARACTERIZED PROTEIN UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	ARG J  51 PHE C 212 ARG J  55	None A  2   1 ( 3.3A) None	0.81A	5y9yA-5xyiJ: undetectable	5y9yA-5xyiJ: 20.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z12_B_9CRB501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.98A	5z12B-5xyiT: undetectable	5z12B-5xyiT: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z12_C_9CRC501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.99A	5z12C-5xyiT: undetectable	5z12C-5xyiT: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5Z12_C_9CRC501_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 LEU T  25 ALA T  26 LEU T 111	None	1.03A	5z12C-5xyiT: undetectable	5z12C-5xyiT: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6A4I_A_TRPA403_0 (TRYPTOPHAN 2,3-DIOXYGENASE)	5xyi	40S RIBOSOMAL PROTEIN SA UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 8	ARG A 118 GLU A 116 PRO C  76 ILE C  82	None	1.13A	6a4iA-5xyiA: undetectable	6a4iA-5xyiA: 19.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6A5Y_D_9CRD501_0 (RETINOIC ACID RECEPTOR RXR-ALPHA)	5xyi	RIBOSOMAL PROTEIN S19E, PUTATIVE (Trichomonas vaginalis)	5 / 12	ILE T  68 ALA T  65 ALA T  64 LEU T  25 ALA T  26	None	0.98A	6a5yD-5xyiT: undetectable	6a5yD-5xyiT: 20.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AN0_A_HISA520_0 (HISTIDINOL DEHYDROGENASE)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE (Trichomonas vaginalis)	4 / 6	LYS F 182 ARG F 187 GLU F 186 ALA F 189	None	1.04A	6an0A-5xyiF: undetectable	6an0A-5xyiF: 20.51
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV6_B_H4BB501_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.97A	6av6A-5xyic: undetectable 6av6B-5xyic: undetectable	6av6A-5xyic: 22.47 6av6B-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV6_C_H4BC502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.92A	6av6C-5xyic: undetectable 6av6D-5xyic: undetectable	6av6C-5xyic: 22.47 6av6D-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV7_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 7	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.96A	6av7A-5xyic: undetectable 6av7B-5xyic: undetectable	6av7A-5xyic: 22.47 6av7B-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV7_B_H4BB502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.98A	6av7A-5xyiF: undetectable 6av7B-5xyiF: undetectable	6av7A-5xyiF: 16.32 6av7B-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV7_C_H4BC502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.92A	6av7C-5xyic: undetectable 6av7D-5xyic: undetectable	6av7C-5xyic: 22.47 6av7D-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV7_D_H4BD502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.03A	6av7C-5xyiF: undetectable 6av7D-5xyiF: undetectable	6av7C-5xyiF: 16.32 6av7D-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6C06_D_FI8D1404_1 (DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA')	5xyi	40S RIBOSOMAL PROTEIN S4 RIBOSOMAL PROTEIN S24E, PUTATIVE (Trichomonas vaginalis; Trichomonas vaginalis)	3 / 3	ARG E  51 LYS E  53 ARG Y  89	None	1.25A	6c06D-5xyiE: undetectable	6c06D-5xyiE: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CB4_A_BEZA501_0 (CANAVALIN)	5xyi	40S RIBOSOMAL PROTEIN S7, PUTATIVE 40S RIBOSOMAL PROTEIN S13, PUTATIVE RIBOSOMAL PROTEIN S15A (Trichomonas vaginalis; Trichomonas vaginalis; Trichomonas vaginalis)	4 / 8	HIS W  56 LEU H 106 ILE H 115 ARG N  20	None	0.94A	6cb4A-5xyiW: undetectable	6cb4A-5xyiW: 15.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIE_A_H4BA502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.98A	6cieA-5xyic: undetectable 6cieB-5xyic: undetectable	6cieA-5xyic: 22.47 6cieB-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIE_B_H4BB502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 7	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.97A	6cieA-5xyiF: undetectable 6cieB-5xyiF: undetectable	6cieA-5xyiF: 16.32 6cieB-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIE_C_H4BC502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.93A	6cieC-5xyic: undetectable 6cieD-5xyic: undetectable	6cieC-5xyic: 22.47 6cieD-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIE_D_H4BD502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.02A	6cieC-5xyiF: undetectable 6cieD-5xyiF: undetectable	6cieC-5xyiF: 16.32 6cieD-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_A_H4BA502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	0.90A	6cifA-5xyic: undetectable 6cifB-5xyic: undetectable	6cifA-5xyic: 22.47 6cifB-5xyic: 22.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_B_H4BB502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	1.02A	6cifA-5xyiF: undetectable 6cifB-5xyiF: undetectable	6cifA-5xyiF: 16.32 6cifB-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_D_H4BD502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis; Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.96A	6cifC-5xyiF: undetectable 6cifD-5xyiF: undetectable	6cifC-5xyiF: 16.32 6cifD-5xyiF: 16.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CNJ_A_NCTA402_1 (NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT ALPHA-4 NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT BETA-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 7	TYR g 322 TRP g 330 CYH g 267 LEU g 318	None	1.35A	6cnjA-5xyig: undetectable 6cnjB-5xyig: undetectable	6cnjA-5xyig: 15.36 6cnjB-5xyig: 10.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CNK_B_NCTB402_1 (NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT ALPHA-4 NEURONAL ACETYLCHOLINE RECEPTOR SUBUNIT BETA-2)	5xyi	GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT, PUTATIVE (Trichomonas vaginalis)	4 / 7	TYR g 322 TRP g 330 CYH g 267 LEU g 318	None	1.31A	6cnkB-5xyig: undetectable 6cnkC-5xyig: undetectable	6cnkB-5xyig: 15.36 6cnkC-5xyig: 10.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DH0_A_017A101_0 (PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.97A	6dh0A-5xyiX: undetectable	6dh0A-5xyiX: 18.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DIL_B_TPVB201_0 (HIV-1 PROTEASE)	5xyi	40S RIBOSOMAL PROTEIN S23, PUTATIVE (Trichomonas vaginalis)	5 / 12	LEU X  75 ALA X  84 VAL X  52 ILE X  95 ILE X 124	None None None None C  2  27 ( 4.6A)	0.91A	6dilA-5xyiX: undetectable	6dilA-5xyiX: 16.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EW0_F_TA1F502_2 (TUBULIN BETA CHAIN)	5xyi	40S RIBOSOMAL PROTEIN S21 UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 5	LEU V  23 LEU V  12 THR C 236 PRO C 166	None	1.07A	6ew0F-5xyiV: undetectable	6ew0F-5xyiV: 25.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6F6N_A_SREA508_1 (ENVELOPE GLYCOPROTEIN,ENVELOP E GLYCOPROTEIN,GP1 ENVELOPE GLYCOPROTEIN)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	6 / 10	ARG J  51 VAL J  94 ALA J  54 LEU J  97 LEU J  47 LEU J  78	None	1.40A	6f6nA-5xyiJ: undetectable 6f6nB-5xyiJ: undetectable	6f6nA-5xyiJ: 18.87 6f6nB-5xyiJ: 18.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FI4_B_DVAB8_0 (14-3-3 PROTEIN SIGMA PRO-SEP-LEU-PRO-DVA)	5xyi	UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 5	SER L  63 VAL L  62 ASN L 136 PRO L 128	A  2 104 ( 2.6A) None None U  2 265 ( 3.4A)	1.26A	6fi4A-5xyiL: undetectable 6fi4B-5xyiL: undetectable	6fi4A-5xyiL: 21.79 6fi4B-5xyiL: 6.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MA7_A_TPFA602_0 (CYTOCHROME P450 3A4)	5xyi	RIBOSOMAL PROTEIN S14 (Trichomonas vaginalis)	4 / 7	SER O 122 ALA O  86 ILE O  68 ALA O  69	None	0.96A	6ma7A-5xyiO: undetectable	6ma7A-5xyiO: 16.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6NKN_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 3 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5xyi	PLECTIN/S10 DOMAIN CONTAINING PROTEIN (Trichomonas vaginalis)	3 / 3	ARG K   8 LEU K  12 PHE K  16	U  21065 ( 4.1A) None None	0.59A	6nknP-5xyiK: undetectable	6nknP-5xyiK: 18.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	8NSE_A_H4BA600_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	VAL c  16 ARG F  49 PHE F  50 GLU c  51	None C  21421 ( 4.4A) None None	1.01A	8nseA-5xyic: undetectable 8nseB-5xyic: undetectable	8nseA-5xyic: 12.80 8nseB-5xyic: 12.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	8NSE_B_H4BB601_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.95A	8nseA-5xyiF: undetectable 8nseB-5xyiF: undetectable	8nseA-5xyiF: 18.04 8nseB-5xyiF: 18.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	9NSE_B_H4BB601_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	5xyi	40S RIBOSOMAL PROTEIN S5-B, PUTATIVE UNCHARACTERIZED PROTEIN (Trichomonas vaginalis)	4 / 6	PHE F  50 GLU c  51 VAL c  16 ARG F  49	None None None C  21421 ( 4.4A)	0.99A	9nseA-5xyiF: undetectable 9nseB-5xyiF: undetectable	9nseA-5xyiF: 18.04 9nseB-5xyiF: 18.04