SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5y9h'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DF7_A_MTXA501_2 (DIHYDROFOLATE REDUCTASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	TRP A 259 ARG A 246 THR A 221	None	0.98A	1df7A-5y9hA: undetectable	1df7A-5y9hA: 17.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2W3A_B_TOPB1189_1 (DIHYDROFOLATE REDUCTASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	5 / 10	GLU A 355 PHE A 356 PHE A 410 THR A 369 LEU A 388	None	1.10A	2w3aB-5y9hA: undetectable	2w3aB-5y9hA: 16.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WD9_C_IBPC1570_1 (ACYL-COENZYME A SYNTHETASE ACSM2A, MITOCHONDRIAL)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	5 / 10	THR A 273 ILE A 270 LEU A 198 VAL A 210 GLY A 212	None	1.17A	2wd9C-5y9hA: undetectable	2wd9C-5y9hA: 24.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2WD9_C_IBPC1570_1 (ACYL-COENZYME A SYNTHETASE ACSM2A, MITOCHONDRIAL)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	5 / 10	THR A 273 ILE A 270 LEU A 268 VAL A 210 GLY A 212	None	1.03A	2wd9C-5y9hA: undetectable	2wd9C-5y9hA: 24.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X91_A_LPRA1615_2 (ANGIOTENSIN CONVERTING ENZYME)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	SER A 390 THR A 371 PHE A 356	None	0.57A	2x91A-5y9hA: undetectable	2x91A-5y9hA: 19.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DL9_A_V2HA602_1 (CYTOCHROME P450 2R1)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 5	ASN A 115 ALA A 139 LEU A 142 GLY A  59	None	0.84A	3dl9A-5y9hA: undetectable	3dl9A-5y9hA: 21.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM0_B_CHDB151_0 (ILEAL BILE ACID-BINDING PROTEIN)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	5 / 12	ILE A  88 ILE A 166 VAL A  31 PHE A 118 LEU A  92	None	1.10A	3em0B-5y9hA: undetectable	3em0B-5y9hA: 16.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N62_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	GLY A 222 TRP A 259 VAL A 257	None	0.66A	3n62B-5y9hA: undetectable	3n62B-5y9hA: 20.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N65_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	GLY A 222 TRP A 259 VAL A 257	None	0.69A	3n65B-5y9hA: undetectable	3n65B-5y9hA: 20.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N66_B_ACTB860_0 (NITRIC OXIDE SYNTHASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	GLY A 222 TRP A 259 VAL A 257	None	0.68A	3n66B-5y9hA: undetectable	3n66B-5y9hA: 20.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LV9_B_20JB602_1 (NICOTINAMIDE PHOSPHORIBOSYLTRANSF ERASE)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 7	VAL A 227 ILE A 314 ILE A 195 ALA A 196	None	0.75A	4lv9B-5y9hA: undetectable	4lv9B-5y9hA: 22.58
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZPH_A_PRLA501_0 (ARYL HYDROCARBON RECEPTOR NUCLEAR TRANSLOCATOR ENDOTHELIAL PAS DOMAIN-CONTAINING PROTEIN 1)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 7	VAL A 167 GLN A 294 LEU A 303 SER A 306	None	1.08A	4zphA-5y9hA: undetectable 4zphB-5y9hA: undetectable	4zphA-5y9hA: 24.06 4zphB-5y9hA: 23.83
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5B1A_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 1 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 6	ILE A 462 LEU A 332 PHE A 464 THR A 421	None	1.06A	5b1aN-5y9hA: undetectable 5b1aW-5y9hA: undetectable	5b1aN-5y9hA: 22.02 5b1aW-5y9hA: 8.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 5	SER A 163 GLY A 300 THR A 261 GLU A 252	None	1.11A	5btiA-5y9hA: undetectable 5btiB-5y9hA: undetectable	5btiA-5y9hA: 22.12 5btiB-5y9hA: 21.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	4 / 5	SER A 163 GLY A 300 THR A 261 GLU A 252	None	1.10A	5btiC-5y9hA: undetectable 5btiD-5y9hA: undetectable	5btiC-5y9hA: 22.12 5btiD-5y9hA: 21.26
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VUO_B_ACTB804_0 (NITRIC OXIDE SYNTHASE, BRAIN)	5y9h	SAFD,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN,PUTATIVE OUTER MEMBRANE PROTEIN (Salmonella enterica)	3 / 3	GLY A 222 TRP A 259 VAL A 257	None	0.68A	5vuoB-5y9hA: undetectable	5vuoB-5y9hA: 20.87