SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '5yap'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_N_TRPN81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.07A	1c9sN-5yapA: undetectable 1c9sO-5yapA: undetectable	1c9sN-5yapA: undetectable 1c9sO-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_P_TRPP81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.07A	1c9sP-5yapA: undetectable 1c9sQ-5yapA: undetectable	1c9sP-5yapA: undetectable 1c9sQ-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_Q_TRPQ81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 9	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.08A	1c9sQ-5yapA: undetectable 1c9sR-5yapA: undetectable	1c9sQ-5yapA: undetectable 1c9sR-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1C9S_V_TRPV81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.03A	1c9sL-5yapA: undetectable 1c9sV-5yapA: undetectable	1c9sL-5yapA: undetectable 1c9sV-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_E_TRPE81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 9	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.10A	1gtfD-5yapA: undetectable 1gtfE-5yapA: undetectable	1gtfD-5yapA: undetectable 1gtfE-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_K_TRPK81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.08A	1gtfJ-5yapA: undetectable 1gtfK-5yapA: undetectable	1gtfJ-5yapA: undetectable 1gtfK-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_Q_TRPQ81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.03A	1gtfQ-5yapA: undetectable 1gtfR-5yapA: undetectable	1gtfQ-5yapA: undetectable 1gtfR-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_R_TRPR81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 9	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.03A	1gtfR-5yapA: undetectable 1gtfS-5yapA: undetectable	1gtfR-5yapA: undetectable 1gtfS-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTF_S_TRPS81_0 (TRP RNA-BINDING ATTENUATION PROTEIN (TRAP))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.03A	1gtfS-5yapA: undetectable 1gtfT-5yapA: undetectable	1gtfS-5yapA: undetectable 1gtfT-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GTN_T_TRPT81_0 (TRP RNA-BINDING ATTENUATION PROTEIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.02A	1gtnT-5yapA: undetectable 1gtnU-5yapA: undetectable	1gtnT-5yapA: undetectable 1gtnU-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_E_TRPE81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.10A	1utdE-5yapA: undetectable 1utdF-5yapA: undetectable	1utdE-5yapA: undetectable 1utdF-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_H_TRPH81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.10A	1utdH-5yapA: undetectable 1utdI-5yapA: undetectable	1utdH-5yapA: undetectable 1utdI-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_L_TRPL81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 12	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.03A	1utdL-5yapA: undetectable 1utdM-5yapA: undetectable	1utdL-5yapA: undetectable 1utdM-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_S_TRPS81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.06A	1utdS-5yapA: undetectable 1utdT-5yapA: undetectable	1utdS-5yapA: undetectable 1utdT-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_U_TRPU81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 269 HIS A 158 ILE A 153 GLY A 248 THR A 246	None	1.07A	1utdU-5yapA: undetectable 1utdV-5yapA: undetectable	1utdU-5yapA: undetectable 1utdV-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1UTD_V_TRPV81_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 11	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.01A	1utdL-5yapA: undetectable 1utdV-5yapA: undetectable	1utdL-5yapA: undetectable 1utdV-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2JST_A_HLTA101_1 (FOUR-ALPHA-HELIX BUNDLE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 5	TRP A 67 ALA A 95 LEU A 87 ALA A 94	None None NAI A 401 (-4.8A) None	1.08A	2jstA-5yapA: undetectable 2jstB-5yapA: undetectable	2jstA-5yapA: 22.22 2jstB-5yapA: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X2I_A_QPSA1060_1 (ALPHA-1,4-GLUCAN LYASE ISOZYME 1)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 12	VAL A 10 THR A 31 ASN A 28 VAL A 327 ALA A 330	None	1.11A	2x2iA-5yapA: undetectable	2x2iA-5yapA: 5.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2X2I_C_QPSC1060_1 (ALPHA-1,4-GLUCAN LYASE ISOZYME 1)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 12	VAL A 10 THR A 31 ASN A 28 VAL A 327 ALA A 330	None	1.18A	2x2iC-5yapA: undetectable	2x2iC-5yapA: 5.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DL9_A_V2HA602_0 (CYTOCHROME P450 2R1)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 12	VAL A 71 ALA A 70 GLU A 90 VAL A 102 ILE A 81	None	1.20A	3dl9A-5yapA: undetectable	3dl9A-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CEV_A_GAIA407_0 (PROTEIN (ARGINASE))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 6	ARG A 262 LEU A 196 MET A 162 ASP A 164	None	1.32A	4cevA-5yapA: 3.2 4cevB-5yapA: 3.2	4cevA-5yapA: undetectable 4cevB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CEV_D_GAID410_0 (PROTEIN (ARGINASE))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 6	ARG A 262 LEU A 196 MET A 162 ASP A 164	None	1.30A	4cevD-5yapA: 3.2 4cevE-5yapA: 3.2	4cevD-5yapA: undetectable 4cevE-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CEV_F_GAIF411_0 (PROTEIN (ARGINASE))	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 6	ARG A 262 LEU A 196 MET A 162 ASP A 164	None	1.32A	4cevE-5yapA: undetectable 4cevF-5yapA: undetectable	4cevE-5yapA: undetectable 4cevF-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KIC_B_SAMB401_1 (METHYLTRANSFERASE MPPJ)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	3 / 3	ARG A 334 ASP A 77 ASP A 73	None	0.57A	4kicB-5yapA: undetectable	4kicB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KRH_B_SAMB900_0 (PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE 2)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	6 / 12	PHE A 250 GLY A 187 SER A 253 ALA A 361 ARG A 178 ILE A 357	None None None None NAI A 401 (-2.7A) None	1.41A	4krhB-5yapA: 3.9	4krhB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OAD_A_CLMA206_0 (GNAT SUPERFAMILY ACETYLTRANSFERASE PA4794)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 4	ALA A 117 ALA A 120 ALA A 121 ALA A 124	None	0.13A	4oadA-5yapA: undetectable	4oadA-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_A_SORA1343_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 6	ASP A 77 LYS A 100 HIS A 101 ARG A 127 ILE A 337	None	0.51A	5a06A-5yapA: 19.4	5a06A-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_B_SORB1343_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 5	ASP A 77 LYS A 100 HIS A 101 ARG A 127 ILE A 337	None	0.52A	5a06B-5yapA: 19.5	5a06B-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_D_SORD1344_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 5	ASP A 77 LYS A 100 HIS A 101 ARG A 127 ILE A 337	None	0.48A	5a06D-5yapA: 35.6	5a06D-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5A06_F_SORF1344_0 (ALDOSE-ALDOSE OXIDOREDUCTASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 5	ASP A 77 LYS A 100 HIS A 101 ARG A 127 ILE A 337	None	0.48A	5a06F-5yapA: 19.4	5a06F-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BS8_H_MFXH101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 7	ALA A 144 ARG A 160 GLY A 161 GLU A 249	None	0.99A	5bs8A-5yapA: undetectable 5bs8B-5yapA: undetectable 5bs8C-5yapA: undetectable	5bs8A-5yapA: 11.86 5bs8B-5yapA: 17.99 5bs8C-5yapA: 11.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_E_GFNE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 7	ALA A 144 ARG A 160 GLY A 161 GLU A 249	None	0.96A	5btdA-5yapA: undetectable 5btdB-5yapA: undetectable 5btdC-5yapA: undetectable	5btdA-5yapA: 11.86 5btdB-5yapA: 17.99 5btdC-5yapA: 11.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTD_G_GFNG101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 7	ALA A 144 ARG A 160 GLY A 161 GLU A 249	None	0.92A	5btdA-5yapA: undetectable 5btdC-5yapA: undetectable 5btdD-5yapA: undetectable	5btdA-5yapA: 11.86 5btdC-5yapA: 11.86 5btdD-5yapA: 17.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEV_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5eevA-5yapA: undetectable 5eevB-5yapA: undetectable	5eevA-5yapA: undetectable 5eevB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEW_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5eewA-5yapA: undetectable 5eewB-5yapA: undetectable	5eewA-5yapA: undetectable 5eewB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEX_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5eexA-5yapA: undetectable 5eexB-5yapA: undetectable	5eexA-5yapA: undetectable 5eexB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEY_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5eeyA-5yapA: undetectable 5eeyB-5yapA: undetectable	5eeyA-5yapA: undetectable 5eeyB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EEZ_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5eezA-5yapA: undetectable 5eezB-5yapA: undetectable	5eezA-5yapA: undetectable 5eezB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF0_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.05A	5ef0A-5yapA: undetectable 5ef0B-5yapA: undetectable	5ef0A-5yapA: undetectable 5ef0B-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF1_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5ef1A-5yapA: undetectable 5ef1B-5yapA: undetectable	5ef1A-5yapA: undetectable 5ef1B-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF2_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.06A	5ef2A-5yapA: undetectable 5ef2B-5yapA: undetectable	5ef2A-5yapA: undetectable 5ef2B-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5EF3_A_TRPA101_0 (TRANSCRIPTION ATTENUATION PROTEIN MTRB)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 10	GLY A 248 THR A 246 GLY A 269 HIS A 158 ILE A 153	None	1.05A	5ef3A-5yapA: undetectable 5ef3B-5yapA: undetectable	5ef3A-5yapA: undetectable 5ef3B-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5HQA_A_ACRA705_2 (ALPHA-GLUCOSIDASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 8	ASN A 323 GLU A 165 HIS A 195 THR A 15	None 8S0 A 402 (-2.8A) 8S0 A 402 ( 3.9A) NAI A 401 (-4.0A)	1.36A	5hqaA-5yapA: undetectable	5hqaA-5yapA: 8.14
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X7P_B_ACRB1431_1 (GLYCOSIDE HYDROLASE FAMILY 31 ALPHA-GLUCOSIDASE)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 5	HIS A 88 ASP A 191 GLY A 190 ASN A 85	NAI A 401 (-3.8A) 8S0 A 402 (-4.3A) None NAI A 401 (-3.7A)	1.23A	5x7pB-5yapA: undetectable	5x7pB-5yapA: 5.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DJZ_A_GMJA301_0 (SIGMA NON-OPIOID INTRACELLULAR RECEPTOR 1)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	5 / 12	ILE A 357 PHE A 372 VAL A 210 LEU A 263 TYR A 135	None None None None 8S0 A 402 (-4.5A)	0.95A	6djzA-5yapA: undetectable	6djzA-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GNR_A_6J3A201_0 (TRANSTHYRETIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 4	LYS A 20 LEU A 54 ALA A 23 LEU A 43	None	1.42A	6gnrA-5yapA: undetectable	6gnrA-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6GNR_B_6J3B201_0 (TRANSTHYRETIN)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	4 / 4	LYS A 20 LEU A 54 ALA A 23 LEU A 43	None	1.40A	6gnrB-5yapA: undetectable	6gnrB-5yapA: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6NKN_W_CHDW101_0 (CYTOCHROME C OXIDASE SUBUNIT 3 CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL)	5yap	SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY (Paracoccus laeviglucosivora ns)	3 / 3	ARG A 355 LEU A 351 PHE A 347	None	0.53A	6nknP-5yapA: undetectable	6nknP-5yapA: undetectable

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1C9S_N_TRPN81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.07A","1c9sN-5yapA:undetectable;1c9sO-5yapA:undetectable","1c9sN-5yapA:undetectable;1c9sO-5yapA:undetectable"],["1C9S_P_TRPP81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.07A","1c9sP-5yapA:undetectable;1c9sQ-5yapA:undetectable","1c9sP-5yapA:undetectable;1c9sQ-5yapA:undetectable"],["1C9S_Q_TRPQ81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.08A","1c9sQ-5yapA:undetectable;1c9sR-5yapA:undetectable","1c9sQ-5yapA:undetectable;1c9sR-5yapA:undetectable"],["1C9S_V_TRPV81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.03A","1c9sL-5yapA:undetectable;1c9sV-5yapA:undetectable","1c9sL-5yapA:undetectable;1c9sV-5yapA:undetectable"],["1GTF_E_TRPE81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.10A","1gtfD-5yapA:undetectable;1gtfE-5yapA:undetectable","1gtfD-5yapA:undetectable;1gtfE-5yapA:undetectable"],["1GTF_K_TRPK81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.08A","1gtfJ-5yapA:undetectable;1gtfK-5yapA:undetectable","1gtfJ-5yapA:undetectable;1gtfK-5yapA:undetectable"],["1GTF_Q_TRPQ81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.03A","1gtfQ-5yapA:undetectable;1gtfR-5yapA:undetectable","1gtfQ-5yapA:undetectable;1gtfR-5yapA:undetectable"],["1GTF_R_TRPR81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.03A","1gtfR-5yapA:undetectable;1gtfS-5yapA:undetectable","1gtfR-5yapA:undetectable;1gtfS-5yapA:undetectable"],["1GTF_S_TRPS81_0","TRP RNA-BINDING ATTENUATION PROTEIN (TRAP)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.03A","1gtfS-5yapA:undetectable;1gtfT-5yapA:undetectable","1gtfS-5yapA:undetectable;1gtfT-5yapA:undetectable"],["1GTN_T_TRPT81_0","TRP RNA-BINDING ATTENUATION PROTEIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.02A","1gtnT-5yapA:undetectable;1gtnU-5yapA:undetectable","1gtnT-5yapA:undetectable;1gtnU-5yapA:undetectable"],["1UTD_E_TRPE81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.10A","1utdE-5yapA:undetectable;1utdF-5yapA:undetectable","1utdE-5yapA:undetectable;1utdF-5yapA:undetectable"],["1UTD_H_TRPH81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.10A","1utdH-5yapA:undetectable;1utdI-5yapA:undetectable","1utdH-5yapA:undetectable;1utdI-5yapA:undetectable"],["1UTD_L_TRPL81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.03A","1utdL-5yapA:undetectable;1utdM-5yapA:undetectable","1utdL-5yapA:undetectable;1utdM-5yapA:undetectable"],["1UTD_S_TRPS81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.06A","1utdS-5yapA:undetectable;1utdT-5yapA:undetectable","1utdS-5yapA:undetectable;1utdT-5yapA:undetectable"],["1UTD_U_TRPU81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 269;HIS A 158;ILE A 153;GLY A 248;THR A 246","None","1.07A","1utdU-5yapA:undetectable;1utdV-5yapA:undetectable","1utdU-5yapA:undetectable;1utdV-5yapA:undetectable"],["1UTD_V_TRPV81_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.01A","1utdL-5yapA:undetectable;1utdV-5yapA:undetectable","1utdL-5yapA:undetectable;1utdV-5yapA:undetectable"],["2JST_A_HLTA101_1","FOUR-ALPHA-HELIX BUNDLE;FOUR-ALPHA-HELIX BUNDLE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"TRP A  67;ALA A  95;LEU A  87;ALA A  94","None;None;NAI A 401 (-4.8A);None","1.08A","2jstA-5yapA:undetectable;2jstB-5yapA:undetectable","2jstA-5yapA:22.22;2jstB-5yapA:22.22"],["2X2I_A_QPSA1060_1","ALPHA-1,4-GLUCAN LYASE ISOZYME 1","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"VAL A  10;THR A  31;ASN A  28;VAL A 327;ALA A 330","None","1.11A","2x2iA-5yapA:undetectable","2x2iA-5yapA:5.69"],["2X2I_C_QPSC1060_1","ALPHA-1,4-GLUCAN LYASE ISOZYME 1","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"VAL A  10;THR A  31;ASN A  28;VAL A 327;ALA A 330","None","1.18A","2x2iC-5yapA:undetectable","2x2iC-5yapA:5.69"],["3DL9_A_V2HA602_0","CYTOCHROME P450 2R1","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"VAL A  71;ALA A  70;GLU A  90;VAL A 102;ILE A  81","None","1.20A","3dl9A-5yapA:undetectable","3dl9A-5yapA:undetectable"],["4CEV_A_GAIA407_0","PROTEIN (ARGINASE)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ARG A 262;LEU A 196;MET A 162;ASP A 164","None","1.32A","4cevA-5yapA:3.2;4cevB-5yapA:3.2","4cevA-5yapA:undetectable;4cevB-5yapA:undetectable"],["4CEV_D_GAID410_0","PROTEIN (ARGINASE)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ARG A 262;LEU A 196;MET A 162;ASP A 164","None","1.30A","4cevD-5yapA:3.2;4cevE-5yapA:3.2","4cevD-5yapA:undetectable;4cevE-5yapA:undetectable"],["4CEV_F_GAIF411_0","PROTEIN (ARGINASE)","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ARG A 262;LEU A 196;MET A 162;ASP A 164","None","1.32A","4cevE-5yapA:undetectable;4cevF-5yapA:undetectable","4cevE-5yapA:undetectable;4cevF-5yapA:undetectable"],["4KIC_B_SAMB401_1","METHYLTRANSFERASE MPPJ","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",3,"ARG A 334;ASP A  77;ASP A  73","None","0.57A","4kicB-5yapA:undetectable","4kicB-5yapA:undetectable"],["4KRH_B_SAMB900_0","PHOSPHOETHANOLAMINE N-METHYLTRANSFERASE 2","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",6,"PHE A 250;GLY A 187;SER A 253;ALA A 361;ARG A 178;ILE A 357","None;None;None;None;NAI A 401 (-2.7A);None","1.41A","4krhB-5yapA:3.9","4krhB-5yapA:undetectable"],["4OAD_A_CLMA206_0","GNAT SUPERFAMILY ACETYLTRANSFERASE PA4794","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ALA A 117;ALA A 120;ALA A 121;ALA A 124","None","0.13A","4oadA-5yapA:undetectable","4oadA-5yapA:undetectable"],["5A06_A_SORA1343_0","ALDOSE-ALDOSE OXIDOREDUCTASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"ASP A  77;LYS A 100;HIS A 101;ARG A 127;ILE A 337","None","0.51A","5a06A-5yapA:19.4","5a06A-5yapA:undetectable"],["5A06_B_SORB1343_0","ALDOSE-ALDOSE OXIDOREDUCTASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"ASP A  77;LYS A 100;HIS A 101;ARG A 127;ILE A 337","None","0.52A","5a06B-5yapA:19.5","5a06B-5yapA:undetectable"],["5A06_D_SORD1344_0","ALDOSE-ALDOSE OXIDOREDUCTASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"ASP A  77;LYS A 100;HIS A 101;ARG A 127;ILE A 337","None","0.48A","5a06D-5yapA:35.6","5a06D-5yapA:undetectable"],["5A06_F_SORF1344_0","ALDOSE-ALDOSE OXIDOREDUCTASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"ASP A  77;LYS A 100;HIS A 101;ARG A 127;ILE A 337","None","0.48A","5a06F-5yapA:19.4","5a06F-5yapA:undetectable"],["5BS8_H_MFXH101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ALA A 144;ARG A 160;GLY A 161;GLU A 249","None","0.99A","5bs8A-5yapA:undetectable;5bs8B-5yapA:undetectable;5bs8C-5yapA:undetectable","5bs8A-5yapA:11.86;5bs8B-5yapA:17.99;5bs8C-5yapA:11.86"],["5BTD_E_GFNE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ALA A 144;ARG A 160;GLY A 161;GLU A 249","None","0.96A","5btdA-5yapA:undetectable;5btdB-5yapA:undetectable;5btdC-5yapA:undetectable","5btdA-5yapA:11.86;5btdB-5yapA:17.99;5btdC-5yapA:11.86"],["5BTD_G_GFNG101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ALA A 144;ARG A 160;GLY A 161;GLU A 249","None","0.92A","5btdA-5yapA:undetectable;5btdC-5yapA:undetectable;5btdD-5yapA:undetectable","5btdA-5yapA:11.86;5btdC-5yapA:11.86;5btdD-5yapA:17.99"],["5EEV_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5eevA-5yapA:undetectable;5eevB-5yapA:undetectable","5eevA-5yapA:undetectable;5eevB-5yapA:undetectable"],["5EEW_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5eewA-5yapA:undetectable;5eewB-5yapA:undetectable","5eewA-5yapA:undetectable;5eewB-5yapA:undetectable"],["5EEX_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5eexA-5yapA:undetectable;5eexB-5yapA:undetectable","5eexA-5yapA:undetectable;5eexB-5yapA:undetectable"],["5EEY_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5eeyA-5yapA:undetectable;5eeyB-5yapA:undetectable","5eeyA-5yapA:undetectable;5eeyB-5yapA:undetectable"],["5EEZ_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5eezA-5yapA:undetectable;5eezB-5yapA:undetectable","5eezA-5yapA:undetectable;5eezB-5yapA:undetectable"],["5EF0_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.05A","5ef0A-5yapA:undetectable;5ef0B-5yapA:undetectable","5ef0A-5yapA:undetectable;5ef0B-5yapA:undetectable"],["5EF1_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5ef1A-5yapA:undetectable;5ef1B-5yapA:undetectable","5ef1A-5yapA:undetectable;5ef1B-5yapA:undetectable"],["5EF2_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.06A","5ef2A-5yapA:undetectable;5ef2B-5yapA:undetectable","5ef2A-5yapA:undetectable;5ef2B-5yapA:undetectable"],["5EF3_A_TRPA101_0","TRANSCRIPTION ATTENUATION PROTEIN MTRB","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"GLY A 248;THR A 246;GLY A 269;HIS A 158;ILE A 153","None","1.05A","5ef3A-5yapA:undetectable;5ef3B-5yapA:undetectable","5ef3A-5yapA:undetectable;5ef3B-5yapA:undetectable"],["5HQA_A_ACRA705_2","ALPHA-GLUCOSIDASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"ASN A 323;GLU A 165;HIS A 195;THR A  15","None;8S0 A 402 (-2.8A);8S0 A 402 ( 3.9A);NAI A 401 (-4.0A)","1.36A","5hqaA-5yapA:undetectable","5hqaA-5yapA:8.14"],["5X7P_B_ACRB1431_1","GLYCOSIDE HYDROLASE FAMILY 31 ALPHA-GLUCOSIDASE","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"HIS A  88;ASP A 191;GLY A 190;ASN A  85","NAI A 401 (-3.8A);8S0 A 402 (-4.3A);None;NAI A 401 (-3.7A)","1.23A","5x7pB-5yapA:undetectable","5x7pB-5yapA:5.36"],["6DJZ_A_GMJA301_0","SIGMA NON-OPIOID INTRACELLULAR RECEPTOR 1","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",5,"ILE A 357;PHE A 372;VAL A 210;LEU A 263;TYR A 135","None;None;None;None;8S0 A 402 (-4.5A)","0.95A","6djzA-5yapA:undetectable","6djzA-5yapA:undetectable"],["6GNR_A_6J3A201_0","TRANSTHYRETIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"LYS A  20;LEU A  54;ALA A  23;LEU A  43","None","1.42A","6gnrA-5yapA:undetectable","6gnrA-5yapA:undetectable"],["6GNR_B_6J3B201_0","TRANSTHYRETIN","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",4,"LYS A  20;LEU A  54;ALA A  23;LEU A  43","None","1.40A","6gnrB-5yapA:undetectable","6gnrB-5yapA:undetectable"],["6NKN_W_CHDW101_0","CYTOCHROME C OXIDASE SUBUNIT 3;CYTOCHROME C OXIDASE SUBUNIT 7A1, MITOCHONDRIAL","5yap","SCYLLO-INOSITOL DEHYDROGENASE WITH L-GLUCOSE DEHYDROGENASE ACTIVITY","Paracoccus laeviglucosivorans",3,"ARG A 355;LEU A 351;PHE A 347","None","0.53A","6nknP-5yapA:undetectable","6nknP-5yapA:undetectable"]]