SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '6az1'

List of Similar Pattern of Amino Acids

Hit pattern: 3D amino acid arrangements similar to known drug binding site
Query pattern: Residues from known binding site for annotated drug that match the hit pattern

(Click on the DrReposER ID to view details on interfaces and similar patterns of amino acids)
(Click on the view link on the last column to view superposed patterns of amino acids)

Filter list by:

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1W_B_H4BB601_1 (NITRIC OXIDE SYNTHASE)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.24A	1d1wA-6az1H: undetectable 1d1wB-6az1H: undetectable	1d1wA-6az1H: 8.62 1d1wB-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D1X_B_H4BB601_1 (BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME DOMAIN)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.23A	1d1xA-6az1H: undetectable 1d1xB-6az1H: undetectable	1d1xA-6az1H: 8.62 1d1xB-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1DM8_B_H4BB2600_1 (NITRIC OXIDE SYNTHASE)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.19A	1dm8A-6az1H: undetectable 1dm8B-6az1H: undetectable	1dm8A-6az1H: 8.62 1dm8B-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1FOP_B_H4BB2600_1 (NITRIC-OXIDE SYNTHASE)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.18A	1fopA-6az1H: undetectable 1fopB-6az1H: undetectable	1fopA-6az1H: 8.62 1fopB-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1IG3_B_VIBB501_1 (THIAMIN PYROPHOSPHOKINASE)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 7	ASP H 180 SER H 170 SER H 173 ASN H 172	None	1.21A	1ig3A-6az1H: undetectable 1ig3B-6az1H: undetectable	1ig3A-6az1H: 14.89 1ig3B-6az1H: 14.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JB0_B_PQNB2002_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 11	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.94A	1jb0B-6az1H: 2.0	1jb0B-6az1H: 7.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L7F_A_BCZA801_1 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	3 / 3	ARG d 61 ARG H 108 ARG d 80	None	1.08A	1l7fA-6az1d: undetectable	1l7fA-6az1d: 14.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L7H_A_BCZA801_1 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	3 / 3	ARG d 61 ARG H 108 ARG d 80	None	1.06A	1l7hA-6az1d: undetectable	1l7hA-6az1d: 14.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LW0_A_NVPA999_1 (HIV-1 REVERSE TRANSCRIPTASE)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	5 / 10	LEU I 27 VAL I 94 VAL I 49 TYR I 66 LEU I 81	None	1.38A	1lw0A-6az1I: 2.4	1lw0A-6az1I: 9.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LWC_A_NVPA999_1 (HIV-1 REVERSE TRANSCRIPTASE)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	5 / 11	LEU I 27 VAL I 94 VAL I 49 TYR I 66 LEU I 81	None	1.40A	1lwcA-6az1I: undetectable	1lwcA-6az1I: 9.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1NSE_B_H4BB600_1 (NITRIC OXIDE SYNTHASE)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.26A	1nseA-6az1H: undetectable 1nseB-6az1H: undetectable	1nseA-6az1H: 8.62 1nseB-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1P6N_B_H4BB761_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.20A	1p6nA-6az1H: undetectable 1p6nB-6az1H: undetectable	1p6nA-6az1H: 9.35 1p6nB-6az1H: 9.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RS9_A_H4BA760_1 (NITRIC-OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.25A	1rs9A-6az1d: undetectable 1rs9B-6az1d: undetectable	1rs9A-6az1d: 11.92 1rs9B-6az1d: 11.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1S1X_A_NVPA999_1 (REVERSE TRANSCRIPTASE)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 8	LEU I 27 VAL I 64 TYR I 66 LEU I 81	None	0.95A	1s1xA-6az1I: undetectable	1s1xA-6az1I: 9.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1T9W_A_NFNA6001_1 (ACRIFLAVINE RESISTANCE PROTEIN B)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	3 / 3	SER E 211 GLY E 212 ARG E 188	None	0.61A	1t9wA-6az1E: undetectable	1t9wA-6az1E: 4.82
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1VPO_H_TESH1010_1 (ANTI-TESTOSTERONE (HEAVY CHAIN) ANTI-TESTOSTERONE (LIGHT CHAIN))	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	SER F 212 ALA F 178 GLY F 172 VAL F 195 PRO F 196	C 1 4 ( 3.7A) None None None None	1.31A	1vpoH-6az1F: undetectable 1vpoL-6az1F: undetectable	1vpoH-6az1F: 14.16 1vpoL-6az1F: 16.13
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2I30_A_SALA1100_1 (SERUM ALBUMIN)	6az1	RIBOSOMAL PROTEIN S4 RIBOSOMAL PROTEIN S5 (Leishmania donovani)	4 / 6	HIS F 164 TYR F 209 ARG D 56 GLY F 189	None A 1 2 ( 3.3A) G 1 1 ( 4.5A) None	1.19A	2i30A-6az1F: undetectable	2i30A-6az1F: 11.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QL8_A_BEZA143_0 (PUTATIVE REDOX PROTEIN)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	4 / 7	ALA F 225 THR F 226 ALA F 229 PRO F 196	None	0.76A	2ql8A-6az1F: undetectable 2ql8B-6az1F: undetectable	2ql8A-6az1F: 18.22 2ql8B-6az1F: 18.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2R2V_D_ACTD37_0 (GCN4 LEUCINE ZIPPER)	6az1	RIBOSOMAL PROTEIN S3 (Leishmania donovani)	3 / 3	LYS C 142 ARG C 115 VAL C 114	None	1.11A	2r2vC-6az1C: undetectable 2r2vD-6az1C: undetectable	2r2vC-6az1C: 15.17 2r2vD-6az1C: 15.17
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2UXO_B_TACB1211_1 (HTH-TYPE TRANSCRIPTIONAL REGULATOR TTGR)	6az1	RIBOSOMAL PROTEIN S25E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 11	LEU H 159 LEU H 89 LEU H 78 ILE a 64 VAL a 100	None None U 11874 ( 4.6A) None None	1.18A	2uxoB-6az1H: undetectable	2uxoB-6az1H: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VCT_B_ASDB1223_1 (GLUTATHIONE S-TRANSFERASE A2)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	4 / 8	ILE E 61 GLY E 58 ARG E 46 LEU E 42	None None G 1 491 ( 2.9A) None	0.88A	2vctB-6az1E: undetectable	2vctB-6az1E: 17.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2VUF_B_FUAB2002_1 (SERUM ALBUMIN)	6az1	RIBOSOMAL PROTEIN S3 (Leishmania donovani)	4 / 9	ILE C 121 ALA C 170 VAL C 185 CYH C 133	None	0.82A	2vufB-6az1C: undetectable	2vufB-6az1C: 8.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YVL_B_SAMB602_1 (HYPOTHETICAL PROTEIN)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	3 / 3	GLU E 88 ASP E 85 TYR E 79	None	0.67A	2yvlB-6az1E: undetectable	2yvlB-6az1E: 22.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2YVL_B_SAMB602_1 (HYPOTHETICAL PROTEIN)	6az1	RIBOSOMAL PROTEIN S2 RIBOSOMAL PROTEIN S21E (Leishmania donovani; Leishmania donovani)	3 / 3	GLU Y 68 ASP Y 70 TYR B 40	None	0.85A	2yvlB-6az1Y: undetectable	2yvlB-6az1Y: 20.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_A_PAUA248_0 (TYPE III PANTOTHENATE KINASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 11	GLY F 189 THR F 165 LYS F 197 LEU F 200 THR F 210	None None G 1 1 ( 3.1A) None None	1.25A	3bf1A-6az1F: undetectable 3bf1B-6az1F: undetectable	3bf1A-6az1F: 22.30 3bf1B-6az1F: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3BF1_F_PAUF248_0 (TYPE III PANTOTHENATE KINASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 11	LYS F 197 LEU F 200 THR F 210 GLY F 189 THR F 165	G 1 1 ( 3.1A) None None None None	1.33A	3bf1E-6az1F: undetectable 3bf1F-6az1F: undetectable	3bf1E-6az1F: 22.30 3bf1F-6az1F: 22.30
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3CD2_A_MTXA307_1 (DIHYDROFOLATE REDUCTASE)	6az1	RIBOSOMAL PROTEIN S17 (Leishmania donovani)	5 / 12	ILE U 17 PRO U 74 PHE U 75 ARG U 48 ILE U 69	None	1.06A	3cd2A-6az1U: undetectable	3cd2A-6az1U: 15.85
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3EM4_A_DR7A100_2 (PROTEASE)	6az1	RIBOSOMAL PROTEIN S2 RIBOSOMAL PROTEIN S21E (Leishmania donovani)	5 / 9	ALA Y 72 GLY Y 67 LEU B 157 VAL Y 37 ILE Y 59	None	1.01A	3em4B-6az1Y: undetectable	3em4B-6az1Y: 20.56
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3F8W_A_ADNA300_1 (PURINE-NUCLEOSIDE PHOSPHORYLASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	ALA F 203 GLY F 124 VAL F 116 GLY F 117 VAL F 151	None	1.04A	3f8wA-6az1F: undetectable	3f8wA-6az1F: 13.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3F8W_C_ADNC302_1 (PURINE-NUCLEOSIDE PHOSPHORYLASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	ALA F 203 GLY F 124 VAL F 116 GLY F 117 VAL F 151	None	1.05A	3f8wC-6az1F: undetectable	3f8wC-6az1F: 13.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JWQ_C_VIAC901_1 (CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE CATALYTIC DOMAIN, CONE CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE SUBUNIT ALPHA CHIMERA)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 7	HIS I 181 GLN I 99 PHE I 65 VAL I 63	G 1 758 ( 4.0A) U 1 759 ( 3.5A) G 1 760 ( 4.5A) None	1.14A	3jwqC-6az1I: undetectable	3jwqC-6az1I: 12.96
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP6_B_SALB3007_1 (TRANSCRIPTIONAL REGULATOR TCAR)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 9	THR F 226 ALA F 225 LEU F 222 ALA F 178 SER F 212	None None None None C 1 4 ( 3.7A)	1.33A	3kp6B-6az1F: undetectable	3kp6B-6az1F: 19.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LD6_A_KKKA602_1 (LANOSTEROL 14-ALPHA DEMETHYLASE)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	5 / 12	GLY E 190 ALA E 177 ILE E 170 ILE E 157 MET E 121	None None G 1 789 ( 4.6A) None None	1.42A	3ld6A-6az1E: undetectable	3ld6A-6az1E: 10.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NU5_B_478B401_2 (PROTEASE)	6az1	RIBOSOMAL PROTEIN S8E (Leishmania donovani)	5 / 12	ARG K 75 ASP K 61 GLY K 39 ALA K 40 VAL K 43	C 1 307 ( 2.7A) None None None None	1.12A	3nu5B-6az1K: undetectable	3nu5B-6az1K: 23.36
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P73_A_ACTA275_0 (MHC RFP-Y CLASS I ALPHA CHAIN)	6az1	RIBOSOMAL PROTEIN S2 (Leishmania donovani)	3 / 3	ILE B 68 VAL B 185 ARG B 189	None	0.61A	3p73A-6az1B: undetectable	3p73A-6az1B: 19.93
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3PCQ_B_PQNB842_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 11	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.94A	3pcqB-6az1H: undetectable	3pcqB-6az1H: 7.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RET_A_SALA201_1 (SALICYLATE BIOSYNTHESIS PROTEIN PCHB)	6az1	RIBOSOMAL PROTEIN S2 RIBOSOMAL PROTEIN S21E (Leishmania donovani)	5 / 10	ALA B 65 ARG B 66 VAL B 67 ILE B 162 ILE Y 82	None	1.37A	3retA-6az1B: undetectable 3retB-6az1B: undetectable	3retA-6az1B: 16.04 3retB-6az1B: 16.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RUK_A_AERA601_1 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	ALA F 192 ILE F 223 LEU F 222 VAL F 170 VAL F 179	U 1 3 ( 4.9A) None None None None	1.05A	3rukA-6az1F: undetectable	3rukA-6az1F: 10.25
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V3O_A_T1CA404_1 (TETX2 PROTEIN)	6az1	RIBOSOMAL PROTEIN S8E (Leishmania donovani)	5 / 12	THR K 95 ASN K 35 GLY K 193 ALA K 40 GLY K 39	None None G 1 375 ( 3.8A) None None	1.06A	3v3oA-6az1K: undetectable	3v3oA-6az1K: 14.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V81_C_NVPC901_1 (HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 8	LEU I 27 VAL I 64 TYR I 66 LEU I 81	None	0.98A	3v81C-6az1I: 2.4	3v81C-6az1I: 9.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VNS_A_DVAA602_0 (NRPS ADENYLATION PROTEIN CYTC1)	6az1	RIBOSOMAL PROTEIN S2 (Leishmania donovani)	4 / 7	ASP B 133 GLY B 103 THR B 132 PHE B 106	None	1.12A	3vnsA-6az1B: undetectable	3vnsA-6az1B: 19.12
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4B7N_A_ZMRA601_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.08A	4b7nA-6az1D: undetectable	4b7nA-6az1D: 9.59
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CPZ_C_ZMRC1470_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.13A	4cpzC-6az1D: undetectable	4cpzC-6az1D: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CPZ_E_ZMRE1471_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.14A	4cpzE-6az1D: undetectable	4cpzE-6az1D: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CPZ_F_ZMRF1470_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.10A	4cpzF-6az1D: undetectable	4cpzF-6az1D: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CPZ_G_ZMRG1471_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.10A	4cpzG-6az1D: undetectable	4cpzG-6az1D: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CPZ_H_ZMRH1470_2 (NEURAMINIDASE)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	3 / 3	ARG D 39 ARG D 43 TRP D 11	A 1 643 ( 3.2A) A 1 521 ( 3.7A) G 1 520 ( 4.4A)	1.10A	4cpzH-6az1D: undetectable	4cpzH-6az1D: 11.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4CWV_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.23A	4cwvA-6az1H: undetectable 4cwvB-6az1H: undetectable	4cwvA-6az1H: 8.64 4cwvB-6az1H: 8.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_A_H4BA600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.26A	4d33A-6az1d: undetectable 4d33B-6az1d: undetectable	4d33A-6az1d: 11.42 4d33B-6az1d: 11.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4D33_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.24A	4d33A-6az1H: undetectable 4d33B-6az1H: undetectable	4d33A-6az1H: 8.64 4d33B-6az1H: 8.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FE1_B_PQNB840_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 9	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.95A	4fe1B-6az1H: undetectable	4fe1B-6az1H: 7.04
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FU8_A_ACTA304_0 (UROKINASE-TYPE PLASMINOGEN ACTIVATOR)	6az1	RIBOSOMAL PROTEIN S5 RIBOSOMAL PROTEIN S21E (Leishmania donovani; Leishmania donovani)	3 / 3	ARG F 231 HIS Y 32 TYR F 228	None	1.26A	4fu8A-6az1F: undetectable	4fu8A-6az1F: 20.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FU9_A_ACTA312_0 (UROKINASE-TYPE PLASMINOGEN ACTIVATOR)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	3 / 3	ARG E 74 HIS E 72 TYR E 79	C 1 121 ( 3.0A) C 1 121 ( 4.5A) None	1.29A	4fu9A-6az1E: undetectable	4fu9A-6az1E: 20.46
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4FU9_A_ACTA312_0 (UROKINASE-TYPE PLASMINOGEN ACTIVATOR)	6az1	RIBOSOMAL PROTEIN S5 RIBOSOMAL PROTEIN S21E (Leishmania donovani; Leishmania donovani)	3 / 3	ARG F 231 HIS Y 32 TYR F 228	None	1.21A	4fu9A-6az1F: undetectable	4fu9A-6az1F: 20.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K6I_A_9RAA500_1 (RETINOIC ACID RECEPTOR RXR-ALPHA)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	5 / 12	ILE A 174 LEU A 189 LEU A 199 ALA A 198 VAL A 217	None	0.89A	4k6iA-6az1A: undetectable	4k6iA-6az1A: 19.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OAE_A_CLMA207_0 (GNAT SUPERFAMILY ACETYLTRANSFERASE PA4794)	6az1	RIBOSOMAL PROTEIN S8E RIBOSOMAL PROTEIN S17 (Leishmania donovani; Leishmania donovani)	5 / 12	ALA K 68 ARG K 187 ASN U 32 GLY K 205 LEU K 208	G 1 244 ( 3.5A) None None None None	0.97A	4oaeA-6az1K: undetectable	4oaeA-6az1K: 22.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q0B_A_NVPA901_1 (HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 8	LEU I 27 VAL I 64 TYR I 66 LEU I 81	None	1.00A	4q0bA-6az1I: 2.3	4q0bA-6az1I: 9.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q0B_A_NVPA901_1 (HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 8	LEU I 27 VAL I 94 VAL I 49 LEU I 81	None	0.96A	4q0bA-6az1I: 2.3	4q0bA-6az1I: 9.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Q0B_C_NVPC901_1 (HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	5 / 9	LEU I 27 VAL I 94 VAL I 49 TYR I 66 LEU I 81	None	1.45A	4q0bC-6az1I: 2.4	4q0bC-6az1I: 9.35
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4R29_D_SAMD301_1 (UNCHARACTERIZED PROTEIN)	6az1	RIBOSOMAL PROTEIN S8E RIBOSOMAL PROTEIN S17 (Leishmania donovani; Leishmania donovani)	3 / 3	ARG K 187 GLU U 31 TYR K 211	None	0.95A	4r29D-6az1K: undetectable	4r29D-6az1K: 19.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UYM_A_VORA590_1 (14-ALPHA STEROL DEMETHYLASE)	6az1	RIBOSOMAL PROTEIN S25E (Leishmania donovani)	4 / 7	PHE a 42 ALA a 76 ILE a 60 LEU a 83	None	0.71A	4uymA-6az1a: undetectable	4uymA-6az1a: 12.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4UYM_B_VORB590_1 (14-ALPHA STEROL DEMETHYLASE)	6az1	RIBOSOMAL PROTEIN S25E (Leishmania donovani)	4 / 7	PHE a 42 ALA a 76 ILE a 60 LEU a 83	None	0.74A	4uymB-6az1a: undetectable	4uymB-6az1a: 12.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WQ5_B_ACTB404_0 (TRNA N6-ADENOSINE THREONYLCARBAMOYLTRA NSFERASE)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	3 / 3	TYR H 138 ARG H 145 LYS H 142	A 11517 ( 4.5A) None None	1.35A	4wq5B-6az1H: undetectable	4wq5B-6az1H: 20.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X1I_B_LOCB502_2 (TUBULIN BETA CHAIN)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	5 / 12	LYS A 164 LEU A 166 THR A 121 ALA A 143 VAL A 141	U 11195 ( 3.7A) None None None None	1.23A	4x1iB-6az1A: undetectable	4x1iB-6az1A: 11.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X1I_B_LOCB502_2 (TUBULIN BETA CHAIN)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	5 / 12	LYS A 164 LEU A 166 THR A 145 ALA A 143 VAL A 141	U 11195 ( 3.7A) None None None None	1.27A	4x1iB-6az1A: undetectable	4x1iB-6az1A: 11.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XK8_B_PQNB842_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 10	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.95A	4xk8B-6az1H: undetectable	4xk8B-6az1H: 7.80
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_A_STRA604_1 (CYTOCHROME P450 21-HYDROXYLASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	VAL F 151 ILE F 123 GLY F 124 VAL F 79 LEU F 88	None	1.05A	4y8wA-6az1F: undetectable	4y8wA-6az1F: 10.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_B_STRB603_1 (CYTOCHROME P450 21-HYDROXYLASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	VAL F 151 ILE F 123 GLY F 124 VAL F 79 LEU F 88	None	1.06A	4y8wB-6az1F: undetectable	4y8wB-6az1F: 10.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4Y8W_C_STRC603_1 (CYTOCHROME P450 21-HYDROXYLASE)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	5 / 12	VAL F 151 ILE F 123 GLY F 124 VAL F 79 LEU F 88	None	1.00A	4y8wC-6az1F: undetectable	4y8wC-6az1F: 10.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE1_A_X2NA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	6az1	RIBOSOMAL PROTEIN S10E RIBOSOMAL PROTEIN S12E (Leishmania donovani)	4 / 5	VAL Q 44 TYR N 45 ILE N 54 PRO N 39	None	1.12A	4ze1A-6az1Q: undetectable	4ze1A-6az1Q: 12.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZE1_A_X2NA602_2 (LANOSTEROL 14-ALPHA DEMETHYLASE)	6az1	RIBOSOMAL PROTEIN S10E RIBOSOMAL PROTEIN S12E (Leishmania donovani)	4 / 5	VAL Q 44 TYR N 45 PRO N 39 THR N 34	None None None G 11569 ( 3.1A)	1.26A	4ze1A-6az1Q: undetectable	4ze1A-6az1Q: 12.05
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ADN_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.25A	5adnA-6az1H: undetectable 5adnB-6az1H: undetectable	5adnA-6az1H: 8.64 5adnB-6az1H: 8.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5AMI_B_EF2B151_1 (CEREBLON ISOFORM 4)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 8	ASN I 191 PRO I 192 SER I 198 TRP I 190	None None U 11361 ( 3.7A) U 11361 ( 3.6A)	1.36A	5amiB-6az1I: undetectable	5amiB-6az1I: 17.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTG_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	ALA H 23 GLY d 65 THR d 33 ARG H 132	None	0.97A	5btgA-6az1H: undetectable 5btgB-6az1H: undetectable 5btgC-6az1H: undetectable	5btgA-6az1H: 11.53 5btgB-6az1H: 15.81 5btgC-6az1H: 11.53
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FVY_B_H4BB600_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.21A	5fvyA-6az1H: undetectable 5fvyB-6az1H: undetectable	5fvyA-6az1H: 8.64 5fvyB-6az1H: 8.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5J2T_C_VLBC503_2 (TUBULIN ALPHA-1B CHAIN)	6az1	RIBOSOMAL PROTEIN S10E (Leishmania donovani)	6 / 12	PRO N 76 VAL N 80 ILE N 54 ALA N 55 PHE N 48 VAL N 44	None	1.48A	5j2tC-6az1N: undetectable	5j2tC-6az1N: 10.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JWA_H_ACTH612_0 (NADH DEHYDROGENASE, PUTATIVE)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	3 / 3	ARG A 41 PRO A 238 ASN A 97	None	1.02A	5jwaA-6az1A: undetectable 5jwaH-6az1A: undetectable	5jwaA-6az1A: 19.19 5jwaH-6az1A: 19.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5K9D_A_ACTA407_0 (DIHYDROOROTATE DEHYDROGENASE (QUINONE), MITOCHONDRIAL)	6az1	RIBOSOMAL PROTEIN S17 (Leishmania donovani)	4 / 5	ASP U 70 THR U 76 GLN U 26 ARG U 48	None	1.29A	5k9dA-6az1U: undetectable	5k9dA-6az1U: 18.68
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5LG3_I_Z80I401_1 (GAMMA-AMINOBUTYRIC-A CID RECEPTOR SUBUNIT BETA-1)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	4 / 9	ILE A 214 VAL A 127 THR A 125 ILE A 170	None	0.97A	5lg3I-6az1A: undetectable	5lg3I-6az1A: 13.07
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NWW_A_ACAA18_2 (SCRFP-TAG,GP41)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	3 / 3	LYS I 154 TRP I 143 SER I 185	None	1.28A	5nwwA-6az1I: undetectable	5nwwA-6az1I: 15.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ODH_G_ACTG710_0 (HETERODISULFIDE REDUCTASE, SUBUNIT A)	6az1	RIBOSOMAL PROTEIN S2 (Leishmania donovani)	4 / 4	ARG B 83 ILE B 174 TYR B 178 ILE B 90	None	1.14A	5odhG-6az1B: undetectable	5odhG-6az1B: 17.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OY0_2_PQN2843_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 12	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.92A	5oy02-6az1H: undetectable	5oy02-6az1H: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OY0_B_PQNB1844_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 10	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	0.97A	5oy0b-6az1H: 2.4	5oy0b-6az1H: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TUD_A_ERMA2001_1 (5-HYDROXYTRYPTAMINE RECEPTOR 2B,SOLUBLE CYTOCHROME B562 CHIMERA)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	5 / 12	VAL I 94 PHE I 44 LEU I 30 LEU I 27 VAL I 46	None	0.89A	5tudA-6az1I: undetectable	5tudA-6az1I: 9.77
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5VCE_A_RITA602_2 (CYTOCHROME P450 3A4)	6az1	RIBOSOMAL PROTEIN S4 (Leishmania donovani)	4 / 6	ARG D 131 PHE D 157 ILE D 128 THR D 141	U 1 577 ( 2.9A) None None C 1 868 ( 3.7A)	1.07A	5vceA-6az1D: undetectable	5vceA-6az1D: 10.47
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5WM2_A_ACTA605_0 (SALICYLATE-AMP LIGASE)	6az1	RIBOSOMAL PROTEIN S12E (Leishmania donovani)	3 / 3	THR Q 53 THR Q 58 ARG Q 124	None	1.04A	5wm2A-6az1Q: undetectable	5wm2A-6az1Q: 14.34
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X24_A_LSNA503_1 (CYTOCHROME P450 2C9)	6az1	RIBOSOMAL PROTEIN S2 (Leishmania donovani)	4 / 6	PHE B 111 GLY B 109 THR B 110 ASN B 113	None A 11673 ( 3.9A) None U 11645 ( 3.2A)	0.90A	5x24A-6az1B: undetectable	5x24A-6az1B: 9.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5ZNI_A_YMZA302_0 (PURINE NUCLEOSIDE PHOSPHORYLASE)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	5 / 9	VAL E 234 GLY E 187 VAL E 180 ASP E 101 GLY E 104	None	1.37A	5zniA-6az1E: undetectable	5zniA-6az1E: 20.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV6_C_H4BC502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.24A	6av6C-6az1d: undetectable 6av6D-6az1d: undetectable	6av6C-6az1d: 17.86 6av6D-6az1d: 17.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AV7_A_H4BA502_1 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S5 (Leishmania donovani)	4 / 7	SER F 62 VAL F 60 PHE F 67 GLU F 65	None	1.21A	6av7A-6az1F: undetectable 6av7B-6az1F: undetectable	6av7A-6az1F: 20.88 6av7B-6az1F: 20.88
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AYC_A_1YNA502_2 (PROTEIN CYP51)	6az1	RIBOSOMAL PROTEIN S7E (Leishmania donovani)	4 / 7	VAL I 77 LEU I 5 PHE I 28 PHE I 70	None None None G 1 991 ( 4.7A)	1.21A	6aycA-6az1I: undetectable	6aycA-6az1I: 19.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CDU_I_EY4I500_0 (CHIMERIC ALPHA1GABAA RECEPTOR)	6az1	RIBOSOMAL PROTEIN S1E (Leishmania donovani)	4 / 5	GLN A 42 VAL A 32 PRO A 238 THR A 89	None	1.27A	6cduI-6az1A: undetectable 6cduJ-6az1A: undetectable	6cduI-6az1A: 19.19 6cduJ-6az1A: 19.19
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIE_C_H4BC502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	4 / 6	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.22A	6cieC-6az1d: undetectable 6cieD-6az1d: undetectable	6cieC-6az1d: 17.86 6cieD-6az1d: 17.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_A_H4BA502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	4 / 6	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.20A	6cifA-6az1d: undetectable 6cifB-6az1d: undetectable	6cifA-6az1d: 17.86 6cifB-6az1d: 17.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_C_H4BC502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	4 / 7	VAL d 29 ARG H 46 PHE H 47 GLU d 69	None G 12036 ( 3.6A) None None	1.16A	6cifC-6az1d: undetectable 6cifD-6az1d: undetectable	6cifC-6az1d: 17.86 6cifD-6az1d: 17.86
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6CIF_D_H4BD502_0 (NITRIC OXIDE SYNTHASE, ENDOTHELIAL)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S28E (Leishmania donovani; Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.22A	6cifC-6az1H: undetectable 6cifD-6az1H: undetectable	6cifC-6az1H: 20.22 6cifD-6az1H: 20.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EXI_D_ADND502_1 (ADENOSYLHOMOCYSTEINA SE)	6az1	RIBOSOMAL PROTEIN S5 RIBOSOMAL PROTEIN S21E (Leishmania donovani; Leishmania donovani)	3 / 3	LEU F 68 ASN Y 13 LEU F 241	None	0.64A	6exiD-6az1F: undetectable	6exiD-6az1F: 20.24
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6F7L_B_ACTB505_0 (AMINE OXIDASE LKCE)	6az1	RIBOSOMAL PROTEIN S4E (Leishmania donovani)	3 / 3	HIS E 231 ASN E 230 LEU E 229	None	0.90A	6f7lB-6az1E: undetectable	6f7lB-6az1E: 20.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6F88_B_STRB502_1 (CYTOCHROME P450 CYP260A1)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	LEU H 8 ALA H 33 LEU H 79 ASN H 60	None None None A 12031 ( 3.3A)	0.93A	6f88B-6az1H: undetectable	6f88B-6az1H: 24.10
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HQB_B_PQNB2002_0 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2)	6az1	RIBOSOMAL PROTEIN S7 (Leishmania donovani)	5 / 9	SER H 173 ILE H 86 ALA H 160 LEU H 159 ALA H 144	None	1.00A	6hqbB-6az1H: undetectable	6hqbB-6az1H: 21.69
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MVX_A_K4DA1304_0 (ION TRANSPORT PROTEIN)	6az1	RIBOSOMAL PROTEIN S7 RIBOSOMAL PROTEIN S25E (Leishmania donovani; Leishmania donovani)	4 / 6	THR H 82 LEU H 83 THR a 98 LEU H 88	None	1.05A	6mvxA-6az1H: 2.7 6mvxB-6az1H: 2.2 6mvxC-6az1H: 2.9	6mvxA-6az1H: 21.72 6mvxB-6az1H: 21.72 6mvxC-6az1H: 21.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	8NSE_B_H4BB601_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.20A	8nseA-6az1H: undetectable 8nseB-6az1H: undetectable	8nseA-6az1H: 8.62 8nseB-6az1H: 8.62
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	9NSE_B_H4BB601_1 (PROTEIN (NITRIC OXIDE SYNTHASE))	6az1	RIBOSOMAL PROTEIN S28E RIBOSOMAL PROTEIN S7 (Leishmania donovani)	4 / 6	PHE H 47 GLU d 69 VAL d 29 ARG H 46	None None None G 12036 ( 3.6A)	1.27A	9nseA-6az1H: undetectable 9nseB-6az1H: undetectable	9nseA-6az1H: 8.62 9nseB-6az1H: 8.62

[["DrReposER ID","Desc.","Hit PDB","Hit molecule","Hit organism","Res. no.","Interface","HETATM","RMSD","Z-score","Seq ID"],["1D1W_B_H4BB601_1","NITRIC OXIDE SYNTHASE;NITRIC OXIDE SYNTHASE","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.24A","1d1wA-6az1H:undetectable;1d1wB-6az1H:undetectable","1d1wA-6az1H:8.62;1d1wB-6az1H:8.62"],["1D1X_B_H4BB601_1","BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME DOMAIN;BOVINE ENDOTHELIAL NITRIC OXIDE SYNTHASE HEME DOMAIN","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.23A","1d1xA-6az1H:undetectable;1d1xB-6az1H:undetectable","1d1xA-6az1H:8.62;1d1xB-6az1H:8.62"],["1DM8_B_H4BB2600_1","NITRIC OXIDE SYNTHASE;NITRIC OXIDE SYNTHASE","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.19A","1dm8A-6az1H:undetectable;1dm8B-6az1H:undetectable","1dm8A-6az1H:8.62;1dm8B-6az1H:8.62"],["1FOP_B_H4BB2600_1","NITRIC-OXIDE SYNTHASE;NITRIC-OXIDE SYNTHASE","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.18A","1fopA-6az1H:undetectable;1fopB-6az1H:undetectable","1fopA-6az1H:8.62;1fopB-6az1H:8.62"],["1IG3_B_VIBB501_1","THIAMIN PYROPHOSPHOKINASE;THIAMIN PYROPHOSPHOKINASE","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"ASP H 180;SER H 170;SER H 173;ASN H 172","None","1.21A","1ig3A-6az1H:undetectable;1ig3B-6az1H:undetectable","1ig3A-6az1H:14.89;1ig3B-6az1H:14.89"],["1JB0_B_PQNB2002_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.94A","1jb0B-6az1H:2.0","1jb0B-6az1H:7.04"],["1L7F_A_BCZA801_1","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",3,"ARG d  61;ARG H 108;ARG d  80","None","1.08A","1l7fA-6az1d:undetectable","1l7fA-6az1d:14.00"],["1L7H_A_BCZA801_1","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",3,"ARG d  61;ARG H 108;ARG d  80","None","1.06A","1l7hA-6az1d:undetectable","1l7hA-6az1d:14.00"],["1LW0_A_NVPA999_1","HIV-1 REVERSE TRANSCRIPTASE","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",5,"LEU I  27;VAL I  94;VAL I  49;TYR I  66;LEU I  81","None","1.38A","1lw0A-6az1I:2.4","1lw0A-6az1I:9.18"],["1LWC_A_NVPA999_1","HIV-1 REVERSE TRANSCRIPTASE","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",5,"LEU I  27;VAL I  94;VAL I  49;TYR I  66;LEU I  81","None","1.40A","1lwcA-6az1I:undetectable","1lwcA-6az1I:9.18"],["1NSE_B_H4BB600_1","NITRIC OXIDE SYNTHASE;NITRIC OXIDE SYNTHASE","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.26A","1nseA-6az1H:undetectable;1nseB-6az1H:undetectable","1nseA-6az1H:8.62;1nseB-6az1H:8.62"],["1P6N_B_H4BB761_1","NITRIC-OXIDE SYNTHASE, ENDOTHELIAL;NITRIC-OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.20A","1p6nA-6az1H:undetectable;1p6nB-6az1H:undetectable","1p6nA-6az1H:9.35;1p6nB-6az1H:9.35"],["1RS9_A_H4BA760_1","NITRIC-OXIDE SYNTHASE, ENDOTHELIAL;NITRIC-OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.25A","1rs9A-6az1d:undetectable;1rs9B-6az1d:undetectable","1rs9A-6az1d:11.92;1rs9B-6az1d:11.92"],["1S1X_A_NVPA999_1","REVERSE TRANSCRIPTASE","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"LEU I  27;VAL I  64;TYR I  66;LEU I  81","None","0.95A","1s1xA-6az1I:undetectable","1s1xA-6az1I:9.18"],["1T9W_A_NFNA6001_1","ACRIFLAVINE RESISTANCE PROTEIN B","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",3,"SER E 211;GLY E 212;ARG E 188","None","0.61A","1t9wA-6az1E:undetectable","1t9wA-6az1E:4.82"],["1VPO_H_TESH1010_1","ANTI-TESTOSTERONE (HEAVY CHAIN);ANTI-TESTOSTERONE (LIGHT CHAIN)","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"SER F 212;ALA F 178;GLY F 172;VAL F 195;PRO F 196","  C 1   4 ( 3.7A);None;None;None;None","1.31A","1vpoH-6az1F:undetectable;1vpoL-6az1F:undetectable","1vpoH-6az1F:14.16;1vpoL-6az1F:16.13"],["2I30_A_SALA1100_1","SERUM ALBUMIN","6az1","RIBOSOMAL PROTEIN S4;RIBOSOMAL PROTEIN S5","Leishmania donovani",4,"HIS F 164;TYR F 209;ARG D  56;GLY F 189","None;  A 1   2 ( 3.3A);  G 1   1 ( 4.5A);None","1.19A","2i30A-6az1F:undetectable","2i30A-6az1F:11.02"],["2QL8_A_BEZA143_0","PUTATIVE REDOX PROTEIN","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",4,"ALA F 225;THR F 226;ALA F 229;PRO F 196","None","0.76A","2ql8A-6az1F:undetectable;2ql8B-6az1F:undetectable","2ql8A-6az1F:18.22;2ql8B-6az1F:18.22"],["2R2V_D_ACTD37_0","GCN4 LEUCINE ZIPPER","6az1","RIBOSOMAL PROTEIN S3","Leishmania donovani",3,"LYS C 142;ARG C 115;VAL C 114","None","1.11A","2r2vC-6az1C:undetectable;2r2vD-6az1C:undetectable","2r2vC-6az1C:15.17;2r2vD-6az1C:15.17"],["2UXO_B_TACB1211_1","HTH-TYPE TRANSCRIPTIONAL REGULATOR TTGR","6az1","RIBOSOMAL PROTEIN S25E;RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"LEU H 159;LEU H  89;LEU H  78;ILE a  64;VAL a 100","None;None;  U 11874 ( 4.6A);None;None","1.18A","2uxoB-6az1H:undetectable","2uxoB-6az1H:16.67"],["2VCT_B_ASDB1223_1","GLUTATHIONE S-TRANSFERASE A2","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",4,"ILE E  61;GLY E  58;ARG E  46;LEU E  42","None;None;  G 1 491 ( 2.9A);None","0.88A","2vctB-6az1E:undetectable","2vctB-6az1E:17.37"],["2VUF_B_FUAB2002_1","SERUM ALBUMIN","6az1","RIBOSOMAL PROTEIN S3","Leishmania donovani",4,"ILE C 121;ALA C 170;VAL C 185;CYH C 133","None","0.82A","2vufB-6az1C:undetectable","2vufB-6az1C:8.85"],["2YVL_B_SAMB602_1","HYPOTHETICAL PROTEIN","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",3,"GLU E  88;ASP E  85;TYR E  79","None","0.67A","2yvlB-6az1E:undetectable","2yvlB-6az1E:22.18"],["2YVL_B_SAMB602_1","HYPOTHETICAL PROTEIN","6az1","RIBOSOMAL PROTEIN S2;RIBOSOMAL PROTEIN S21E","Leishmania donovani;Leishmania donovani",3,"GLU Y  68;ASP Y  70;TYR B  40","None","0.85A","2yvlB-6az1Y:undetectable","2yvlB-6az1Y:20.63"],["3BF1_A_PAUA248_0","TYPE III PANTOTHENATE KINASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"GLY F 189;THR F 165;LYS F 197;LEU F 200;THR F 210","None;None;  G 1   1 ( 3.1A);None;None","1.25A","3bf1A-6az1F:undetectable;3bf1B-6az1F:undetectable","3bf1A-6az1F:22.30;3bf1B-6az1F:22.30"],["3BF1_F_PAUF248_0","TYPE III PANTOTHENATE KINASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"LYS F 197;LEU F 200;THR F 210;GLY F 189;THR F 165","  G 1   1 ( 3.1A);None;None;None;None","1.33A","3bf1E-6az1F:undetectable;3bf1F-6az1F:undetectable","3bf1E-6az1F:22.30;3bf1F-6az1F:22.30"],["3CD2_A_MTXA307_1","DIHYDROFOLATE REDUCTASE","6az1","RIBOSOMAL PROTEIN S17","Leishmania donovani",5,"ILE U  17;PRO U  74;PHE U  75;ARG U  48;ILE U  69","None","1.06A","3cd2A-6az1U:undetectable","3cd2A-6az1U:15.85"],["3EM4_A_DR7A100_2","PROTEASE;PROTEASE","6az1","RIBOSOMAL PROTEIN S2;RIBOSOMAL PROTEIN S21E","Leishmania donovani",5,"ALA Y  72;GLY Y  67;LEU B 157;VAL Y  37;ILE Y  59","None","1.01A","3em4B-6az1Y:undetectable","3em4B-6az1Y:20.56"],["3F8W_A_ADNA300_1","PURINE-NUCLEOSIDE PHOSPHORYLASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"ALA F 203;GLY F 124;VAL F 116;GLY F 117;VAL F 151","None","1.04A","3f8wA-6az1F:undetectable","3f8wA-6az1F:13.89"],["3F8W_C_ADNC302_1","PURINE-NUCLEOSIDE PHOSPHORYLASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"ALA F 203;GLY F 124;VAL F 116;GLY F 117;VAL F 151","None","1.05A","3f8wC-6az1F:undetectable","3f8wC-6az1F:13.89"],["3JWQ_C_VIAC901_1","CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE CATALYTIC DOMAIN, CONE CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE SUBUNIT ALPHA CHIMERA","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"HIS I 181;GLN I  99;PHE I  65;VAL I  63","  G 1 758 ( 4.0A);  U 1 759 ( 3.5A);  G 1 760 ( 4.5A);None","1.14A","3jwqC-6az1I:undetectable","3jwqC-6az1I:12.96"],["3KP6_B_SALB3007_1","TRANSCRIPTIONAL REGULATOR TCAR","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"THR F 226;ALA F 225;LEU F 222;ALA F 178;SER F 212","None;None;None;None;  C 1   4 ( 3.7A)","1.33A","3kp6B-6az1F:undetectable","3kp6B-6az1F:19.86"],["3LD6_A_KKKA602_1","LANOSTEROL 14-ALPHA DEMETHYLASE","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",5,"GLY E 190;ALA E 177;ILE E 170;ILE E 157;MET E 121","None;None;  G 1 789 ( 4.6A);None;None","1.42A","3ld6A-6az1E:undetectable","3ld6A-6az1E:10.42"],["3NU5_B_478B401_2","PROTEASE","6az1","RIBOSOMAL PROTEIN S8E","Leishmania donovani",5,"ARG K  75;ASP K  61;GLY K  39;ALA K  40;VAL K  43","  C 1 307 ( 2.7A);None;None;None;None","1.12A","3nu5B-6az1K:undetectable","3nu5B-6az1K:23.36"],["3P73_A_ACTA275_0","MHC RFP-Y CLASS I ALPHA CHAIN","6az1","RIBOSOMAL PROTEIN S2","Leishmania donovani",3,"ILE B  68;VAL B 185;ARG B 189","None","0.61A","3p73A-6az1B:undetectable","3p73A-6az1B:19.93"],["3PCQ_B_PQNB842_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.94A","3pcqB-6az1H:undetectable","3pcqB-6az1H:7.04"],["3RET_A_SALA201_1","SALICYLATE BIOSYNTHESIS PROTEIN PCHB;SALICYLATE BIOSYNTHESIS PROTEIN PCHB","6az1","RIBOSOMAL PROTEIN S2;RIBOSOMAL PROTEIN S21E","Leishmania donovani",5,"ALA B  65;ARG B  66;VAL B  67;ILE B 162;ILE Y  82","None","1.37A","3retA-6az1B:undetectable;3retB-6az1B:undetectable","3retA-6az1B:16.04;3retB-6az1B:16.04"],["3RUK_A_AERA601_1","STEROID 17-ALPHA-HYDROXYLASE\/17,20 LYASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"ALA F 192;ILE F 223;LEU F 222;VAL F 170;VAL F 179","  U 1   3 ( 4.9A);None;None;None;None","1.05A","3rukA-6az1F:undetectable","3rukA-6az1F:10.25"],["3V3O_A_T1CA404_1","TETX2 PROTEIN","6az1","RIBOSOMAL PROTEIN S8E","Leishmania donovani",5,"THR K  95;ASN K  35;GLY K 193;ALA K  40;GLY K  39","None;None;  G 1 375 ( 3.8A);None;None","1.06A","3v3oA-6az1K:undetectable","3v3oA-6az1K:14.62"],["3V81_C_NVPC901_1","HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"LEU I  27;VAL I  64;TYR I  66;LEU I  81","None","0.98A","3v81C-6az1I:2.4","3v81C-6az1I:9.35"],["3VNS_A_DVAA602_0","NRPS ADENYLATION PROTEIN CYTC1","6az1","RIBOSOMAL PROTEIN S2","Leishmania donovani",4,"ASP B 133;GLY B 103;THR B 132;PHE B 106","None","1.12A","3vnsA-6az1B:undetectable","3vnsA-6az1B:19.12"],["4B7N_A_ZMRA601_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.08A","4b7nA-6az1D:undetectable","4b7nA-6az1D:9.59"],["4CPZ_C_ZMRC1470_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.13A","4cpzC-6az1D:undetectable","4cpzC-6az1D:11.37"],["4CPZ_E_ZMRE1471_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.14A","4cpzE-6az1D:undetectable","4cpzE-6az1D:11.37"],["4CPZ_F_ZMRF1470_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.10A","4cpzF-6az1D:undetectable","4cpzF-6az1D:11.37"],["4CPZ_G_ZMRG1471_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.10A","4cpzG-6az1D:undetectable","4cpzG-6az1D:11.37"],["4CPZ_H_ZMRH1470_2","NEURAMINIDASE","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",3,"ARG D  39;ARG D  43;TRP D  11","  A 1 643 ( 3.2A);  A 1 521 ( 3.7A);  G 1 520 ( 4.4A)","1.10A","4cpzH-6az1D:undetectable","4cpzH-6az1D:11.37"],["4CWV_B_H4BB600_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.23A","4cwvA-6az1H:undetectable;4cwvB-6az1H:undetectable","4cwvA-6az1H:8.64;4cwvB-6az1H:8.64"],["4D33_A_H4BA600_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.26A","4d33A-6az1d:undetectable;4d33B-6az1d:undetectable","4d33A-6az1d:11.42;4d33B-6az1d:11.42"],["4D33_B_H4BB600_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.24A","4d33A-6az1H:undetectable;4d33B-6az1H:undetectable","4d33A-6az1H:8.64;4d33B-6az1H:8.64"],["4FE1_B_PQNB840_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.95A","4fe1B-6az1H:undetectable","4fe1B-6az1H:7.04"],["4FU8_A_ACTA304_0","UROKINASE-TYPE PLASMINOGEN ACTIVATOR","6az1","RIBOSOMAL PROTEIN S5;RIBOSOMAL PROTEIN S21E","Leishmania donovani;Leishmania donovani",3,"ARG F 231;HIS Y  32;TYR F 228","None","1.26A","4fu8A-6az1F:undetectable","4fu8A-6az1F:20.89"],["4FU9_A_ACTA312_0","UROKINASE-TYPE PLASMINOGEN ACTIVATOR","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",3,"ARG E  74;HIS E  72;TYR E  79","  C 1 121 ( 3.0A);  C 1 121 ( 4.5A);None","1.29A","4fu9A-6az1E:undetectable","4fu9A-6az1E:20.46"],["4FU9_A_ACTA312_0","UROKINASE-TYPE PLASMINOGEN ACTIVATOR","6az1","RIBOSOMAL PROTEIN S5;RIBOSOMAL PROTEIN S21E","Leishmania donovani;Leishmania donovani",3,"ARG F 231;HIS Y  32;TYR F 228","None","1.21A","4fu9A-6az1F:undetectable","4fu9A-6az1F:20.89"],["4K6I_A_9RAA500_1","RETINOIC ACID RECEPTOR RXR-ALPHA","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",5,"ILE A 174;LEU A 189;LEU A 199;ALA A 198;VAL A 217","None","0.89A","4k6iA-6az1A:undetectable","4k6iA-6az1A:19.02"],["4OAE_A_CLMA207_0","GNAT SUPERFAMILY ACETYLTRANSFERASE PA4794","6az1","RIBOSOMAL PROTEIN S8E;RIBOSOMAL PROTEIN S17","Leishmania donovani;Leishmania donovani",5,"ALA K  68;ARG K 187;ASN U  32;GLY K 205;LEU K 208","  G 1 244 ( 3.5A);None;None;None;None","0.97A","4oaeA-6az1K:undetectable","4oaeA-6az1K:22.97"],["4Q0B_A_NVPA901_1","HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"LEU I  27;VAL I  64;TYR I  66;LEU I  81","None","1.00A","4q0bA-6az1I:2.3","4q0bA-6az1I:9.35"],["4Q0B_A_NVPA901_1","HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"LEU I  27;VAL I  94;VAL I  49;LEU I  81","None","0.96A","4q0bA-6az1I:2.3","4q0bA-6az1I:9.35"],["4Q0B_C_NVPC901_1","HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",5,"LEU I  27;VAL I  94;VAL I  49;TYR I  66;LEU I  81","None","1.45A","4q0bC-6az1I:2.4","4q0bC-6az1I:9.35"],["4R29_D_SAMD301_1","UNCHARACTERIZED PROTEIN","6az1","RIBOSOMAL PROTEIN S8E;RIBOSOMAL PROTEIN S17","Leishmania donovani;Leishmania donovani",3,"ARG K 187;GLU U  31;TYR K 211","None","0.95A","4r29D-6az1K:undetectable","4r29D-6az1K:19.92"],["4UYM_A_VORA590_1","14-ALPHA STEROL DEMETHYLASE","6az1","RIBOSOMAL PROTEIN S25E","Leishmania donovani",4,"PHE a  42;ALA a  76;ILE a  60;LEU a  83","None","0.71A","4uymA-6az1a:undetectable","4uymA-6az1a:12.41"],["4UYM_B_VORB590_1","14-ALPHA STEROL DEMETHYLASE","6az1","RIBOSOMAL PROTEIN S25E","Leishmania donovani",4,"PHE a  42;ALA a  76;ILE a  60;LEU a  83","None","0.74A","4uymB-6az1a:undetectable","4uymB-6az1a:12.41"],["4WQ5_B_ACTB404_0","TRNA N6-ADENOSINE THREONYLCARBAMOYLTRANSFERASE","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",3,"TYR H 138;ARG H 145;LYS H 142","  A 11517 ( 4.5A);None;None","1.35A","4wq5B-6az1H:undetectable","4wq5B-6az1H:20.92"],["4X1I_B_LOCB502_2","TUBULIN BETA CHAIN","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",5,"LYS A 164;LEU A 166;THR A 121;ALA A 143;VAL A 141","  U 11195 ( 3.7A);None;None;None;None","1.23A","4x1iB-6az1A:undetectable","4x1iB-6az1A:11.21"],["4X1I_B_LOCB502_2","TUBULIN BETA CHAIN","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",5,"LYS A 164;LEU A 166;THR A 145;ALA A 143;VAL A 141","  U 11195 ( 3.7A);None;None;None;None","1.27A","4x1iB-6az1A:undetectable","4x1iB-6az1A:11.21"],["4XK8_B_PQNB842_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.95A","4xk8B-6az1H:undetectable","4xk8B-6az1H:7.80"],["4Y8W_A_STRA604_1","CYTOCHROME P450 21-HYDROXYLASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"VAL F 151;ILE F 123;GLY F 124;VAL F  79;LEU F  88","None","1.05A","4y8wA-6az1F:undetectable","4y8wA-6az1F:10.40"],["4Y8W_B_STRB603_1","CYTOCHROME P450 21-HYDROXYLASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"VAL F 151;ILE F 123;GLY F 124;VAL F  79;LEU F  88","None","1.06A","4y8wB-6az1F:undetectable","4y8wB-6az1F:10.40"],["4Y8W_C_STRC603_1","CYTOCHROME P450 21-HYDROXYLASE","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",5,"VAL F 151;ILE F 123;GLY F 124;VAL F  79;LEU F  88","None","1.00A","4y8wC-6az1F:undetectable","4y8wC-6az1F:10.40"],["4ZE1_A_X2NA602_2","LANOSTEROL 14-ALPHA DEMETHYLASE","6az1","RIBOSOMAL PROTEIN S10E;RIBOSOMAL PROTEIN S12E","Leishmania donovani",4,"VAL Q  44;TYR N  45;ILE N  54;PRO N  39","None","1.12A","4ze1A-6az1Q:undetectable","4ze1A-6az1Q:12.05"],["4ZE1_A_X2NA602_2","LANOSTEROL 14-ALPHA DEMETHYLASE","6az1","RIBOSOMAL PROTEIN S10E;RIBOSOMAL PROTEIN S12E","Leishmania donovani",4,"VAL Q  44;TYR N  45;PRO N  39;THR N  34","None;None;None;  G 11569 ( 3.1A)","1.26A","4ze1A-6az1Q:undetectable","4ze1A-6az1Q:12.05"],["5ADN_B_H4BB600_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.25A","5adnA-6az1H:undetectable;5adnB-6az1H:undetectable","5adnA-6az1H:8.64;5adnB-6az1H:8.64"],["5AMI_B_EF2B151_1","CEREBLON ISOFORM 4","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"ASN I 191;PRO I 192;SER I 198;TRP I 190","None;None;  U 11361 ( 3.7A);  U 11361 ( 3.6A)","1.36A","5amiB-6az1I:undetectable","5amiB-6az1I:17.21"],["5BTG_E_LFXE101_1","DNA GYRASE SUBUNIT A;DNA GYRASE SUBUNIT B;DNA GYRASE SUBUNIT A;DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"ALA H  23;GLY d  65;THR d  33;ARG H 132","None","0.97A","5btgA-6az1H:undetectable;5btgB-6az1H:undetectable;5btgC-6az1H:undetectable","5btgA-6az1H:11.53;5btgB-6az1H:15.81;5btgC-6az1H:11.53"],["5FVY_B_H4BB600_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.21A","5fvyA-6az1H:undetectable;5fvyB-6az1H:undetectable","5fvyA-6az1H:8.64;5fvyB-6az1H:8.64"],["5J2T_C_VLBC503_2","TUBULIN ALPHA-1B CHAIN","6az1","RIBOSOMAL PROTEIN S10E","Leishmania donovani",6,"PRO N  76;VAL N  80;ILE N  54;ALA N  55;PHE N  48;VAL N  44","None","1.48A","5j2tC-6az1N:undetectable","5j2tC-6az1N:10.91"],["5JWA_H_ACTH612_0","NADH DEHYDROGENASE, PUTATIVE","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",3,"ARG A  41;PRO A 238;ASN A  97","None","1.02A","5jwaA-6az1A:undetectable;5jwaH-6az1A:undetectable","5jwaA-6az1A:19.19;5jwaH-6az1A:19.19"],["5K9D_A_ACTA407_0","DIHYDROOROTATE DEHYDROGENASE (QUINONE), MITOCHONDRIAL","6az1","RIBOSOMAL PROTEIN S17","Leishmania donovani",4,"ASP U  70;THR U  76;GLN U  26;ARG U  48","None","1.29A","5k9dA-6az1U:undetectable","5k9dA-6az1U:18.68"],["5LG3_I_Z80I401_1","GAMMA-AMINOBUTYRIC-ACID RECEPTOR SUBUNIT BETA-1","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",4,"ILE A 214;VAL A 127;THR A 125;ILE A 170","None","0.97A","5lg3I-6az1A:undetectable","5lg3I-6az1A:13.07"],["5NWW_A_ACAA18_2","SCRFP-TAG,GP41","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",3,"LYS I 154;TRP I 143;SER I 185","None","1.28A","5nwwA-6az1I:undetectable","5nwwA-6az1I:15.00"],["5ODH_G_ACTG710_0","HETERODISULFIDE REDUCTASE, SUBUNIT A","6az1","RIBOSOMAL PROTEIN S2","Leishmania donovani",4,"ARG B  83;ILE B 174;TYR B 178;ILE B  90","None","1.14A","5odhG-6az1B:undetectable","5odhG-6az1B:17.43"],["5OY0_2_PQN2843_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.92A","5oy02-6az1H:undetectable","5oy02-6az1H:21.69"],["5OY0_B_PQNB1844_1","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","0.97A","5oy0b-6az1H:2.4","5oy0b-6az1H:20.00"],["5TUD_A_ERMA2001_1","5-HYDROXYTRYPTAMINE RECEPTOR 2B,SOLUBLE CYTOCHROME B562 CHIMERA","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",5,"VAL I  94;PHE I  44;LEU I  30;LEU I  27;VAL I  46","None","0.89A","5tudA-6az1I:undetectable","5tudA-6az1I:9.77"],["5VCE_A_RITA602_2","CYTOCHROME P450 3A4","6az1","RIBOSOMAL PROTEIN S4","Leishmania donovani",4,"ARG D 131;PHE D 157;ILE D 128;THR D 141","  U 1 577 ( 2.9A);None;None;  C 1 868 ( 3.7A)","1.07A","5vceA-6az1D:undetectable","5vceA-6az1D:10.47"],["5WM2_A_ACTA605_0","SALICYLATE-AMP LIGASE","6az1","RIBOSOMAL PROTEIN S12E","Leishmania donovani",3,"THR Q  53;THR Q  58;ARG Q 124","None","1.04A","5wm2A-6az1Q:undetectable","5wm2A-6az1Q:14.34"],["5X24_A_LSNA503_1","CYTOCHROME P450 2C9","6az1","RIBOSOMAL PROTEIN S2","Leishmania donovani",4,"PHE B 111;GLY B 109;THR B 110;ASN B 113","None;  A 11673 ( 3.9A);None;  U 11645 ( 3.2A)","0.90A","5x24A-6az1B:undetectable","5x24A-6az1B:9.62"],["5ZNI_A_YMZA302_0","PURINE NUCLEOSIDE PHOSPHORYLASE","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",5,"VAL E 234;GLY E 187;VAL E 180;ASP E 101;GLY E 104","None","1.37A","5zniA-6az1E:undetectable","5zniA-6az1E:20.22"],["6AV6_C_H4BC502_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.24A","6av6C-6az1d:undetectable;6av6D-6az1d:undetectable","6av6C-6az1d:17.86;6av6D-6az1d:17.86"],["6AV7_A_H4BA502_1","NITRIC OXIDE SYNTHASE, ENDOTHELIAL;NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S5","Leishmania donovani",4,"SER F  62;VAL F  60;PHE F  67;GLU F  65","None","1.21A","6av7A-6az1F:undetectable;6av7B-6az1F:undetectable","6av7A-6az1F:20.88;6av7B-6az1F:20.88"],["6AYC_A_1YNA502_2","PROTEIN CYP51","6az1","RIBOSOMAL PROTEIN S7E","Leishmania donovani",4,"VAL I  77;LEU I   5;PHE I  28;PHE I  70","None;None;None;  G 1 991 ( 4.7A)","1.21A","6aycA-6az1I:undetectable","6aycA-6az1I:19.78"],["6CDU_I_EY4I500_0","CHIMERIC ALPHA1GABAA RECEPTOR","6az1","RIBOSOMAL PROTEIN S1E","Leishmania donovani",4,"GLN A  42;VAL A  32;PRO A 238;THR A  89","None","1.27A","6cduI-6az1A:undetectable;6cduJ-6az1A:undetectable","6cduI-6az1A:19.19;6cduJ-6az1A:19.19"],["6CIE_C_H4BC502_0","NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.22A","6cieC-6az1d:undetectable;6cieD-6az1d:undetectable","6cieC-6az1d:17.86;6cieD-6az1d:17.86"],["6CIF_A_H4BA502_0","NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.20A","6cifA-6az1d:undetectable;6cifB-6az1d:undetectable","6cifA-6az1d:17.86;6cifB-6az1d:17.86"],["6CIF_C_H4BC502_0","NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",4,"VAL d  29;ARG H  46;PHE H  47;GLU d  69","None;  G 12036 ( 3.6A);None;None","1.16A","6cifC-6az1d:undetectable;6cifD-6az1d:undetectable","6cifC-6az1d:17.86;6cifD-6az1d:17.86"],["6CIF_D_H4BD502_0","NITRIC OXIDE SYNTHASE, ENDOTHELIAL","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S28E","Leishmania donovani;Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.22A","6cifC-6az1H:undetectable;6cifD-6az1H:undetectable","6cifC-6az1H:20.22;6cifD-6az1H:20.22"],["6EXI_D_ADND502_1","ADENOSYLHOMOCYSTEINASE","6az1","RIBOSOMAL PROTEIN S5;RIBOSOMAL PROTEIN S21E","Leishmania donovani;Leishmania donovani",3,"LEU F  68;ASN Y  13;LEU F 241","None","0.64A","6exiD-6az1F:undetectable","6exiD-6az1F:20.24"],["6F7L_B_ACTB505_0","AMINE OXIDASE LKCE","6az1","RIBOSOMAL PROTEIN S4E","Leishmania donovani",3,"HIS E 231;ASN E 230;LEU E 229","None","0.90A","6f7lB-6az1E:undetectable","6f7lB-6az1E:20.76"],["6F88_B_STRB502_1","CYTOCHROME P450 CYP260A1","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"LEU H   8;ALA H  33;LEU H  79;ASN H  60","None;None;None;  A 12031 ( 3.3A)","0.93A","6f88B-6az1H:undetectable","6f88B-6az1H:24.10"],["6HQB_B_PQNB2002_0","PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A2","6az1","RIBOSOMAL PROTEIN S7","Leishmania donovani",5,"SER H 173;ILE H  86;ALA H 160;LEU H 159;ALA H 144","None","1.00A","6hqbB-6az1H:undetectable","6hqbB-6az1H:21.69"],["6MVX_A_K4DA1304_0","ION TRANSPORT PROTEIN","6az1","RIBOSOMAL PROTEIN S7;RIBOSOMAL PROTEIN S25E","Leishmania donovani;Leishmania donovani",4,"THR H  82;LEU H  83;THR a  98;LEU H  88","None","1.05A","6mvxA-6az1H:2.7;6mvxB-6az1H:2.2;6mvxC-6az1H:2.9","6mvxA-6az1H:21.72;6mvxB-6az1H:21.72;6mvxC-6az1H:21.72"],["8NSE_B_H4BB601_1","PROTEIN (NITRIC OXIDE SYNTHASE);PROTEIN (NITRIC OXIDE SYNTHASE)","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.20A","8nseA-6az1H:undetectable;8nseB-6az1H:undetectable","8nseA-6az1H:8.62;8nseB-6az1H:8.62"],["9NSE_B_H4BB601_1","PROTEIN (NITRIC OXIDE SYNTHASE);PROTEIN (NITRIC OXIDE SYNTHASE)","6az1","RIBOSOMAL PROTEIN S28E;RIBOSOMAL PROTEIN S7","Leishmania donovani",4,"PHE H  47;GLU d  69;VAL d  29;ARG H  46","None;None;None;  G 12036 ( 3.6A)","1.27A","9nseA-6az1H:undetectable;9nseB-6az1H:undetectable","9nseA-6az1H:8.62;9nseB-6az1H:8.62"]]