SIMILAR PATTERN OF AMINO ACIDS MAPPED TO '6f42'

	DrReposER ID / Desc.	Hit PDBID	Hit Macromolecule	Res. Matches	Interface	HETATM	RMSD	Dali Z-score	Seq. Identity (%)	View	Dock
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1D4F_C_ADNC603_1 (S-ADENOSYLHOMOCYSTEI NE HYDROLASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	LEU A1083 ASP A 922 ASP A1351 GLY A1093 HIS A1354	None	1.20A	1d4fC-6f42A: undetectable	1d4fC-6f42A: 12.91
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1E7C_A_HLTA4001_1 (SERUM ALBUMIN)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	4 / 5	LYS C 218 ALA C 217 ASP C 215 GLY C 213	None	1.05A	1e7cA-6f42C: undetectable	1e7cA-6f42C: 8.45
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ERR_A_CCSA381_0 (ESTROGEN RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	GLU A1072 ALA A1074 SER A 938 HIS A 941	None	1.18A	1errA-6f42A: undetectable 1errB-6f42A: undetectable	1errA-6f42A: undetectable 1errB-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1GAH_A_ACRA497_1 (GLUCOAMYLASE-471)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	TYR B 746 GLY B 976 TYR B 690 GLU B 960 TYR B1023	None	1.05A	1gahA-6f42B: undetectable	1gahA-6f42B: 9.55
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JHR_A_NIOA991_1 (NICOTINATE MONONUCLEOTIDE:5,6-D IMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.31A	1jhrA-6f42A: undetectable	1jhrA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1JHY_A_NIOA991_1 (NICOTINATE MONONUCLEOTIDE:5,6-D IMETHYLBENZIMIDAZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.28A	1jhyA-6f42A: undetectable	1jhyA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L4N_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.28A	1l4nA-6f42A: undetectable	1l4nA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5K_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.30A	1l5kA-6f42A: undetectable	1l5kA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5L_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.29A	1l5lA-6f42A: undetectable	1l5lA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L5M_A_NIOA991_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.29A	1l5mA-6f42A: undetectable	1l5mA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L7F_A_BCZA801_1 (NEURAMINIDASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	ARG B 460 ARG B 157 ARG B 720	None	1.05A	1l7fA-6f42B: undetectable	1l7fA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1L7H_A_BCZA801_1 (NEURAMINIDASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	ARG B 460 ARG B 157 ARG B 720	None	1.05A	1l7hA-6f42B: undetectable	1l7hA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1LHU_A_ESTA301_1 (SEX HORMONE-BINDING GLOBULIN)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	5 / 12	GLY C 102 SER C  77 LEU C 106 ILE C 101 LEU C 167	None	1.22A	1lhuA-6f42C: undetectable	1lhuA-6f42C: 19.37
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1MT1_C_AG2C7004_1 (PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE BETA CHAIN PYRUVOYL-DEPENDENT ARGININE DECARBOXYLASE ALPHA CHAIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	LEU A 473 GLU B1066 LEU B1062 LEU B1079	None	0.59A	1mt1D-6f42A: undetectable 1mt1E-6f42A: undetectable	1mt1D-6f42A: 20.72 1mt1E-6f42A: 20.73
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_A_BEZA502_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	ASN B 434 ASN B 188 ILE B 186 GLY B 189	None	1.10A	1oniA-6f42B: undetectable 1oniB-6f42B: undetectable	1oniA-6f42B: undetectable 1oniB-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_C_BEZC505_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC2 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	4 / 6	ILE F 130 PRO F 131 GLU F 124 PHE G  18	None	1.22A	1oniA-6f42F: undetectable 1oniC-6f42F: undetectable	1oniA-6f42F: undetectable 1oniC-6f42F: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1ONI_D_BEZD508_0 (14.5 KDA TRANSLATIONAL INHIBITOR PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	ASN B 434 ASN B 188 ILE B 186 GLY B 189	None	1.10A	1oniD-6f42B: undetectable 1oniF-6f42B: undetectable	1oniD-6f42B: undetectable 1oniF-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1PBK_A_RAPA225_1 (FKBP25)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	LEU B  47 GLY B 644 VAL B 646 ALA B 660 ILE B 659	None	0.92A	1pbkA-6f42B: undetectable	1pbkA-6f42B: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1RK3_A_VDXA500_2 (VITAMIN D3 RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 4	LEU A 896 ILE A1371 ARG A 888 TYR A1364	None	1.23A	1rk3A-6f42A: undetectable	1rk3A-6f42A: 13.70
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	1XVA_A_SAMA293_0 (GLYCINE N-METHYLTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	SER B 913 GLY B 686 ILE B 741 TYR B 746 TYR B1023	None	1.12A	1xvaA-6f42B: undetectable	1xvaA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BM9_A_SAMA301_0 (CEPHALOSPORIN HYDROXYLASE CMCI)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC2 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae; Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 12	LEU F 132 LEU G  59 GLU A 526 GLY F  95 ALA F  98	None	1.17A	2bm9A-6f42F: undetectable	2bm9A-6f42F: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2BYO_A_LNLA1216_1 (LIPOPROTEIN LPPX)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 5	ILE G   3 LEU G   4 SER G   5 ARG G  73	None	0.84A	2byoA-6f42G: undetectable	2byoA-6f42G: 16.67
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2DM6_A_IMNA1401_1 (NADP-DEPENDENT LEUKOTRIENE B4 12-HYDROXYDEHYDROGEN ASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 10	ILE B 366 ALA B 359 ILE B 205 GLU B 208 ILE B 206	None	1.11A	2dm6A-6f42B: undetectable 2dm6B-6f42B: undetectable	2dm6A-6f42B: 14.29 2dm6B-6f42B: 14.29
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F8L_A_SAMA400_1 (HYPOTHETICAL PROTEIN LMO1582)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 4	THR B 430 THR B 124 ASP B 890 ASP B 892	None	1.30A	2f8lA-6f42B: undetectable	2f8lA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2F9W_A_PAUA6001_0 (PANTOTHENATE KINASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 11	ASP B 341 ARG B 343 THR B 542 ILE B 541 THR B 336	None	1.13A	2f9wA-6f42B: undetectable 2f9wB-6f42B: undetectable	2f9wA-6f42B: undetectable 2f9wB-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2FJ1_A_CTCA222_0 (TETRACYCLINE REPRESSOR PROTEIN CLASS D)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	HIS A 941 THR A 680 VAL A 677 LEU A 613 ILE A 614	None	1.45A	2fj1A-6f42A: 3.5	2fj1A-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2GJ5_A_VD3A164_1 (BETA-LACTOGLOBULIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	ASP A 304 LEU A 303 LYS A 300 MET A 312	None	1.38A	2gj5A-6f42A: undetectable	2gj5A-6f42A: 23.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2J9C_C_ACTC1120_0 (HYPOTHETICAL NITROGEN REGULATORY PII-LIKE PROTEIN MJ0059)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	3 / 3	LYS A 837 TYR B 658 PRO A 836	None	1.48A	2j9cC-6f42A: undetectable	2j9cC-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2O01_A_PQNA5001_1 (PHOTOSYSTEM I P700 CHLOROPHYLL A APOPROTEIN A1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 8	SER B 761 ARG A 708 ALA B1015 LEU B1013	None	0.98A	2o01A-6f42B: undetectable	2o01A-6f42B: 7.43
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2OTF_A_2TNA201_1 (PHOSPHOLIPASE A2 VRV-PL-VIIIA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 5	LEU B 347 ILE B 544 SER B 564 GLY B 554	None	0.69A	2otfA-6f42B: undetectable	2otfA-6f42B: 19.38
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2Q72_A_IXXA802_1 (TRANSPORTER)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	ILE B 613 ARG B 580 ARG B 579 PHE B 637	None	1.12A	2q72A-6f42B: undetectable	2q72A-6f42B: 9.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QB4_A_DSMA802_1 (TRANSPORTER)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	ILE B 613 ARG B 580 ARG B 579 PHE B 637	None	1.12A	2qb4A-6f42B: undetectable	2qb4A-6f42B: 9.63
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QL8_A_BEZA143_0 (PUTATIVE REDOX PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	4 / 7	THR C  61 ALA C  64 ARG C  68 TYR B1005	None	0.99A	2ql8A-6f42C: 1.8 2ql8B-6f42C: undetectable	2ql8A-6f42C: undetectable 2ql8B-6f42C: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2QL8_B_BEZB143_0 (PUTATIVE REDOX PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	4 / 6	ARG C  68 TYR B1005 THR C  61 ALA C  64	None	0.97A	2ql8A-6f42C: 1.8 2ql8B-6f42C: 1.8	2ql8A-6f42C: undetectable 2ql8B-6f42C: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2RLC_A_GLYA333_0 (CHOLOYLGLYCINE HYDROLASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	ASN A 539 ASN A 540 ARG A 482	None	0.90A	2rlcA-6f42A: undetectable	2rlcA-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2TOD_A_DMOA700_1 (PROTEIN (ORNITHINE DECARBOXYLASE))	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC9 (Saccharomyces cerevisiae)	4 / 6	CYH A1446 PHE D  19 ASP G  50 TYR G  49	None	1.32A	2todA-6f42A: undetectable 2todB-6f42A: undetectable	2todA-6f42A: 11.81 2todB-6f42A: 11.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2TOD_B_DMOB700_1 (PROTEIN (ORNITHINE DECARBOXYLASE))	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC9 (Saccharomyces cerevisiae)	4 / 5	ASP G  50 TYR G  49 CYH A1446 PHE D  19	None	1.34A	2todA-6f42G: undetectable 2todB-6f42G: undetectable	2todA-6f42G: 13.32 2todB-6f42G: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2TOD_C_DMOC700_1 (PROTEIN (ORNITHINE DECARBOXYLASE))	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC9 (Saccharomyces cerevisiae)	4 / 5	CYH A1446 PHE D  19 ASP G  50 TYR G  49	None	1.33A	2todC-6f42A: undetectable 2todD-6f42A: undetectable	2todC-6f42A: 11.81 2todD-6f42A: 11.81
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2TOD_D_DMOD700_1 (PROTEIN (ORNITHINE DECARBOXYLASE))	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC9 (Saccharomyces cerevisiae)	4 / 5	ASP G  50 TYR G  49 CYH A1446 PHE D  19	None	1.33A	2todC-6f42G: undetectable 2todD-6f42G: undetectable	2todC-6f42G: 13.32 2todD-6f42G: 13.32
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V0Z_O_C41O1327_2 (RENIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 8	SER B 431 SER B 438 THR B 439 THR B 124	None	1.18A	2v0zO-6f42B: undetectable	2v0zO-6f42B: 11.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V57_A_PRLA1188_0 (TETR FAMILY TRANSCRIPTIONAL REPRESSOR LFRR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 8	SER A1422 ILE A1423 ASP A 895 ARG A1380	None	0.85A	2v57A-6f42A: undetectable	2v57A-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2V57_C_PRLC1187_0 (TETR FAMILY TRANSCRIPTIONAL REPRESSOR LFRR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 8	SER A1422 ILE A1423 ASP A 895 ARG A1380	None	0.86A	2v57C-6f42A: undetectable	2v57C-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	2ZLC_A_VDXA500_2 (VITAMIN D3 RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	LEU A 896 ILE A1371 ARG A 888 TYR A1364	None	1.23A	2zlcA-6f42A: undetectable	2zlcA-6f42A: 14.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3DZG_A_NCAA302_0 (ADP-RIBOSYL CYCLASE 1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 7	LEU G 207 GLU G 144 ASP G 141 SER G 209	None	1.49A	3dzgA-6f42G: undetectable	3dzgA-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3FPJ_A_SAMA301_0 (PUTATIVE UNCHARACTERIZED PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 12	ILE B1071 GLY B1074 VAL B1070 ALA A1088 VAL A1411	None	1.00A	3fpjA-6f42B: undetectable	3fpjA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3H52_C_486C4_2 (GLUCOCORTICOID RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	MET B1101 CYH A  77 PRO A 265	None ZN  A1501 ( 4.9A) None	1.31A	3h52C-6f42B: undetectable	3h52C-6f42B: 16.18
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3H52_C_486C4_2 (GLUCOCORTICOID RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC9 (Saccharomyces cerevisiae)	3 / 3	MET D   1 CYH G  45 PRO G  40	None	1.29A	3h52C-6f42D: undetectable	3h52C-6f42D: 18.60
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3JZ0_B_CLYB900_1 (LINCOSAMIDE NUCLEOTIDYLTRANSFERA SE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 8	GLU G 153 TYR G 194 PHE G  77 ILE G   3	None	1.02A	3jz0B-6f42G: undetectable	3jz0B-6f42G: 13.54
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3K4V_B_ROCB201_4 (HIV-1 PROTEASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 4	ARG B 227 ASP B 604 GLY B 559 THR B 336	None	1.35A	3k4vB-6f42B: undetectable	3k4vB-6f42B: 23.23
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KEE_B_30BB500_2 (GENOME POLYPROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	PHE B 678 TYR B 975 LEU A 856	None	0.72A	3keeB-6f42B: undetectable	3keeB-6f42B: 19.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3KP2_A_PNNA5001_0 (TRANSCRIPTIONAL REGULATOR TCAR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 8	ASN A 630 LEU A 669 SER A 561 ASN A 648	None	1.03A	3kp2A-6f42A: 0.1 3kp2B-6f42A: undetectable	3kp2A-6f42A: undetectable 3kp2B-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_D_PZID800_0 (GLUTAMATE RECEPTOR 2)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	SER B 222 TYR B 348 ASN B 203 LEU B 335	None	1.45A	3lslA-6f42B: undetectable 3lslD-6f42B: undetectable	3lslA-6f42B: undetectable 3lslD-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3LSL_D_PZID800_0 (GLUTAMATE RECEPTOR 2)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	SER B 223 TYR B 348 ASN B 203 LEU B 335	None	1.39A	3lslA-6f42B: undetectable 3lslD-6f42B: undetectable	3lslA-6f42B: undetectable 3lslD-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3ME6_C_CGEC501_1 (CYTOCHROME P450 2B4)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	VAL B 233 PHE B 283 ILE B 240 ALA B 350 VAL B 256	None	1.25A	3me6C-6f42B: undetectable	3me6C-6f42B: 11.44
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3N9J_B_EAAB214_1 (GLUTATHIONE S-TRANSFERASE P)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 8	PHE A 512 VAL B 921 GLY B 909 GLY A 514	None	0.65A	3n9jB-6f42A: undetectable	3n9jB-6f42A: 15.71
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3NMU_F_SAMF228_0 (FIBRILLARIN-LIKE RRNA/TRNA 2'-O-METHYLTRANSFERA SE NOP5/NOP56 RELATED PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 12	ALA C  27 PHE C  23 SER C  24 ASP A 572 ALA A 574	None	1.24A	3nmuA-6f42C: undetectable 3nmuF-6f42C: undetectable	3nmuA-6f42C: undetectable 3nmuF-6f42C: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OXV_B_478B200_2 (HIV-1 PROTEASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 10	ALA A 628 VAL A 677 ILE A 654 GLY A 662 VAL A 663	None	1.07A	3oxvB-6f42A: undetectable	3oxvB-6f42A: 23.21
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3OZW_A_KKKA413_1 (FLAVOHEMOGLOBIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 8	ILE B 541 ALA B 346 LEU B 347 LEU B 549	None	0.87A	3ozwA-6f42B: undetectable	3ozwA-6f42B: 11.41
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3P2K_A_SAMA6735_1 (16S RRNA METHYLASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	ASP A 940 GLU A 644 SER A1066	None	0.80A	3p2kA-6f42A: undetectable	3p2kA-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3RUK_D_AERD601_1 (STEROID 17-ALPHA-HYDROXYLASE /17,20 LYASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 11	ASN A 625 ILE A 624 ARG A 937 ALA A 942 THR A 946	None	1.13A	3rukD-6f42A: undetectable	3rukD-6f42A: 9.72
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3SFU_C_RBVC601_1 (RNA POLYMERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 11	LEU A1320 LEU A1300 THR A1316 GLY A1297 ASP A1277	None	1.14A	3sfuC-6f42A: undetectable	3sfuC-6f42A: 9.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3Z_B_9PLB501_1 (CYTOCHROME P450 2E1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	LEU B 661 PHE B 494 THR B 679 LEU B 612	None	1.00A	3t3zB-6f42B: undetectable	3t3zB-6f42B: 10.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3T3Z_D_9PLD501_1 (CYTOCHROME P450 2E1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	LEU B 661 PHE B 494 THR B 679 LEU B 612	None	1.00A	3t3zD-6f42B: undetectable	3t3zD-6f42B: 10.49
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3TJ7_C_ACTC610_0 (GBAA_1210 PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	ASN B 716 ALA B 714 ARG B 720	None	0.85A	3tj7C-6f42B: undetectable 3tj7D-6f42B: undetectable	3tj7C-6f42B: undetectable 3tj7D-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3UQ6_B_ADNB401_2 (ADENOSINE KINASE, PUTATIVE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 5	LEU B 961 GLY B 964 PHE B1019 ASN B 754	None	1.24A	3uq6B-6f42B: undetectable	3uq6B-6f42B: 12.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3V4T_C_ACTC502_0 (UDP-N-ACETYLGLUCOSAM INE 1-CARBOXYVINYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	3 / 3	PRO C 110 ASP C 111 GLU C 312	None	0.63A	3v4tC-6f42C: undetectable	3v4tC-6f42C: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VHU_A_SNLA1001_2 (MINERALOCORTICOID RECEPTOR)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 5	LEU B 727 LEU B 725 LEU B 461 SER B 462	None	0.88A	3vhuA-6f42B: undetectable	3vhuA-6f42B: 15.09
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VQR_A_ACTA1002_0 (PUTATIVE OXIDOREDUCTASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	ASP B 501 GLY B 682 VAL B 684 THR B 471	None	1.21A	3vqrA-6f42B: undetectable	3vqrA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VQR_B_ACTB1002_0 (PUTATIVE OXIDOREDUCTASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 5	ASP B 501 GLY B 682 VAL B 684 THR B 471	None	1.22A	3vqrB-6f42B: undetectable	3vqrB-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3VW1_D_CVID301_1 (PUTATIVE REGULATORY PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	TYR A 508 MET A 694 LEU A 541	None	0.80A	3vw1D-6f42A: undetectable	3vw1D-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_B_W9TB504_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	GLU A1084 GLY A1086 TYR A 900 GLN A 899	None	0.95A	3w9tB-6f42A: undetectable	3w9tB-6f42A: 11.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_B_W9TB513_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	4 / 6	CYH C 140 THR C 141 ASN C 158 ILE C 202	None	1.28A	3w9tB-6f42C: undetectable	3w9tB-6f42C: 11.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_D_W9TD506_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	GLU A1084 GLY A1086 TYR A 900 GLN A 899	None	1.02A	3w9tD-6f42A: undetectable	3w9tD-6f42A: 11.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_E_W9TE505_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	GLU A1084 GLY A1086 TYR A 900 GLN A 899	None	1.09A	3w9tE-6f42A: undetectable	3w9tE-6f42A: 11.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_F_W9TF512_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	THR B 439 ASN B 441 GLY B 453 ILE B 194	None	1.04A	3w9tF-6f42B: undetectable	3w9tF-6f42B: 10.87
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	3W9T_G_W9TG505_1 (HEMOLYTIC LECTIN CEL-III)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	GLU A1084 GLY A1086 TYR A 900 GLN A 899	None	1.04A	3w9tG-6f42A: undetectable	3w9tG-6f42A: 11.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4A3U_B_ACTB1358_0 (NADH:FLAVIN OXIDOREDUCTASE/NADH OXIDASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	ILE B 959 GLY B 976 VAL B 736 SER B 963	None	0.91A	4a3uB-6f42B: undetectable	4a3uB-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G0U_F_ASWF101_1 (DNA TOPOISOMERASE 2-BETA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 6	PRO A 842 GLY A 768 ALA A 734 GLN A 753	None	1.13A	4g0uA-6f42A: 3.8	4g0uA-6f42A: 6.97
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4G19_D_ACTD302_0 (GLUTATHIONE TRANSFERASE GTE1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	TYR A 884 PHE A1389 ARG A 887	None	1.22A	4g19D-6f42A: undetectable	4g19D-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4IG1_A_ACTA504_0 (FAD:PROTEIN FMN TRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 5	SER G  90 LYS G  91 LEU G 102 ASP G 106	None	1.45A	4ig1A-6f42G: undetectable	4ig1A-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4K87_A_ADNA602_1 (PROLINE--TRNA LIGASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 8	PHE B 949 GLY B 917 THR B 954 ARG B 952	None	0.96A	4k87A-6f42B: undetectable	4k87A-6f42B: 10.52
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4KQI_A_NIOA403_1 (NICOTINATE-NUCLEOTID E--DIMETHYLBENZIMIDA ZOLE PHOSPHORIBOSYLTRANSF ERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	GLY A 706 PHE A 704 LEU A 705 ARG A 703 GLY B 764	None	1.30A	4kqiA-6f42A: undetectable	4kqiA-6f42A: 12.78
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L9Q_A_9TPA601_1 (SERUM ALBUMIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	PRO A 932 ALA A1000 TYR A 916 ILE A1089 GLY A1093	None	1.13A	4l9qA-6f42A: 2.3	4l9qA-6f42A: 11.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4L9Q_B_9TPB601_1 (SERUM ALBUMIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	PRO A 932 ALA A1000 TYR A 916 ILE A1089 GLY A1093	None	1.11A	4l9qB-6f42A: undetectable	4l9qB-6f42A: 11.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4LVC_A_ADNA501_1 (S-ADENOSYL-L-HOMOCYS TEINE HYDROLASE (SAHASE))	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	LEU A1083 ASP A 922 ASP A1351 GLY A1093 HIS A1354	None	1.23A	4lvcA-6f42A: undetectable	4lvcA-6f42A: 12.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4M51_A_BEZA501_0 (AMIDOHYDROLASE FAMILY PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 6	ILE A 793 ILE A 558 SER A 561 LEU A 705	None	0.96A	4m51A-6f42A: undetectable	4m51A-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NJU_A_TPVA500_1 (PROTEASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	ALA A 628 ASP A 627 VAL A 677 ILE A 654 GLY A 662	None	1.02A	4njuA-6f42A: undetectable	4njuA-6f42A: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4NJU_C_TPVC500_1 (PROTEASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	ALA A 628 ASP A 627 VAL A 677 ILE A 654 GLY A 662	None	1.03A	4njuC-6f42A: undetectable	4njuC-6f42A: 18.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ODR_B_FK5B201_1 (PEPTIDYL-PROLYL CIS-TRANS ISOMERASE SLYD, PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP1A CHIMERA)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	5 / 11	LEU C 280 LEU C 291 ILE C 233 ILE C 239 PHE C 251	None	0.91A	4odrA-6f42C: undetectable 4odrB-6f42C: undetectable	4odrA-6f42C: 17.27 4odrB-6f42C: 17.27
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4OLT_A_GCSA306_1 (CHITOSANASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	SER A 388 ASP A 390 GLN A 688	None	0.95A	4oltA-6f42A: undetectable 4oltB-6f42A: undetectable	4oltA-6f42A: 17.89 4oltB-6f42A: 17.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4QWP_B_GCSB304_1 (CHITOSANASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	GLN A 688 SER A 388 ASP A 390	None	0.85A	4qwpA-6f42A: undetectable 4qwpB-6f42A: undetectable	4qwpA-6f42A: 17.89 4qwpB-6f42A: 17.89
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4RTR_A_SAMA301_0 (DNA ADENINE METHYLASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 11	GLY B 764 ILE A 564 SER A 565 TYR A 562 ASP A 556	None	1.45A	4rtrA-6f42B: undetectable	4rtrA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4V32_A_EF2A151_1 (CEREBLON ISOFORM 4)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	ASN B 945 PRO B 946 PHE A 710 PHE A 557	None	1.43A	4v32A-6f42B: undetectable	4v32A-6f42B: 22.02
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4WQ4_B_ACTB403_0 (TRNA N6-ADENOSINE THREONYLCARBAMOYLTRA NSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	ARG A 937 ASP A 627 ARG A 655	None	0.55A	4wq4B-6f42A: undetectable	4wq4B-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4X3M_A_ADNA301_1 (RNA 2'-O RIBOSE METHYLTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 9	LEU A 242 GLY A 243 GLU A 240 ILE A 234 SER A 236	None	1.37A	4x3mA-6f42A: undetectable	4x3mA-6f42A: 14.40
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XDT_A_ACTA406_0 (FAD:PROTEIN FMN TRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 5	SER G  90 LYS G  91 LEU G 102 ASP G 106	None	1.45A	4xdtA-6f42G: undetectable	4xdtA-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_A_AG2A505_1 (HOMOSPERMIDINE SYNTHASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	ALA B 466 PRO B 181 GLU B 191 GLU B 176 LEU B 458	None	1.33A	4xqeA-6f42B: undetectable	4xqeA-6f42B: 8.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XQE_B_AG2B504_1 (HOMOSPERMIDINE SYNTHASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	ALA B 466 PRO B 181 GLU B 191 GLU B 176 LEU B 458	None	1.33A	4xqeB-6f42B: undetectable	4xqeB-6f42B: 8.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4XRG_B_AG2B502_1 (HOMOSPERMIDINE SYNTHASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	ALA B 466 PRO B 181 GLU B 191 GLU B 176 LEU B 458	None	1.29A	4xrgB-6f42B: undetectable	4xrgB-6f42B: 8.94
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4YV5_B_SVRB207_2 (BASIC PHOSPHOLIPASE A2 HOMOLOG 2)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	4 / 7	ASN C   3 TYR C 227 LEU C  56 PHE C  54	None	1.24A	4yv5B-6f42C: undetectable	4yv5B-6f42C: 20.66
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	4ZZB_C_ACTC401_0 (PROTON-GATED ION CHANNEL)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 7	ILE G 146 PHE G 140 VAL G  99 ILE G  97	None	0.90A	4zzbC-6f42G: undetectable 4zzbD-6f42G: undetectable	4zzbC-6f42G: undetectable 4zzbD-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_E_LFXE101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCAC GTAA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	SER A1349 ARG A 482 GLY A1093 THR A1087	None	1.11A	5btiA-6f42A: undetectable 5btiB-6f42A: undetectable	5btiA-6f42A: 10.66 5btiB-6f42A: 15.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5BTI_F_LFXF101_1 (DNA GYRASE SUBUNIT A DNA GYRASE SUBUNIT B DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCAT GACC)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	SER A1349 ARG A 482 GLY A1093 THR A1087	None	1.16A	5btiC-6f42A: 6.3 5btiD-6f42A: undetectable	5btiC-6f42A: 10.66 5btiD-6f42A: 15.95
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5FXT_A_0LAA1376_1 (DNA POLYMERASE III SUBUNIT BETA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC2 (Saccharomyces cerevisiae)	4 / 7	LEU G  59 THR F  96 ILE F 130 LEU F  94	None	1.08A	5fxtA-6f42G: undetectable	5fxtA-6f42G: 12.64
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5GLM_A_ACTA613_0 (GLYCOSIDE HYDROLASE FAMILY 43)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	ASP B 804 SER B 851 TYR B 798	None	0.74A	5glmA-6f42B: undetectable	5glmA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JHD_E_EDTE301_0 (BETA-2-MICROGLOBULIN TCRBETA CHAIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 8	TYR A 685 THR A 680 ARG A 655 ILE A 654	None	0.99A	5jhdE-6f42A: undetectable 5jhdG-6f42A: undetectable	5jhdE-6f42A: undetectable 5jhdG-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5JS5_A_ASCA202_0 (CYTOCHROME C')	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	CYH A 738 LYS A 737 HIS A 736	None	1.22A	5js5A-6f42A: undetectable	5js5A-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0T_B_SAMB501_0 (PEPTIDE N-METHYLTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	6 / 12	ILE C  63 VAL C  42 ALA C  64 PHE C 300 ILE C  70 ALA C  66	None	1.48A	5n0tB-6f42C: undetectable	5n0tB-6f42C: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N0X_B_SAMB501_1 (PEPTIDE N-METHYLTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	3 / 3	SER A  19 ALA A  20 THR A 255	None	0.65A	5n0xB-6f42A: undetectable	5n0xB-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5N4T_B_BEZB306_0 (BETA-LACTAMASE VIM-2)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	3 / 3	HIS G  28 ASN G  31 ALA G  35	None	0.71A	5n4tB-6f42G: undetectable	5n4tB-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NWV_A_ACAA18_2 (SCRFP-TAG,GP41)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 7	GLN B  60 LEU B 514 ALA B 685 LEU B 687	None	1.06A	5nwvA-6f42B: undetectable	5nwvA-6f42B: 20.00
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5NZY_A_CE3A1102_1 (DNA CROSS-LINK REPAIR 1A PROTEIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 7	ARG A1125 THR A1120 ILE A1126 GLY A1122	None	0.90A	5nzyA-6f42A: undetectable	5nzyA-6f42A: 11.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5O96_F_SAMF501_0 (RIBOSOMAL RNA SMALL SUBUNIT METHYLTRANSFERASE E)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 10	GLY A 423 GLY A 429 VAL A 462 LEU A 433 ARG A 441	None	1.18A	5o96E-6f42A: undetectable 5o96F-6f42A: undetectable	5o96E-6f42A: undetectable 5o96F-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OF1_A_SALA301_1 (SPORE COAT-ASSOCIATED PROTEIN N)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	4 / 5	ALA C  98 VAL C  96 PHE C  85 ILE C  92	None	0.95A	5of1A-6f42C: undetectable	5of1A-6f42C: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OF1_B_SALB301_1 (SPORE COAT-ASSOCIATED PROTEIN N)	6f42	DNA-DIRECTED RNA POLYMERASES I AND III SUBUNIT RPAC1 (Saccharomyces cerevisiae)	4 / 5	ALA C  98 VAL C  96 PHE C  85 ILE C  92	None	0.95A	5of1B-6f42C: undetectable	5of1B-6f42C: 20.99
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5OG9_A_TESA504_1 (-)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 8	VAL A 266 GLU A  31 ALA A  68 THR A  69	None None None ZN  A1501 (-3.2A)	0.76A	5og9A-6f42A: undetectable	5og9A-6f42A: 10.11
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5TIX_B_OQRB302_0 (SULFOTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC2 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 10	ILE G  13 LEU G  59 LEU F  99 ASP G  16 PHE G  18	None	1.41A	5tixB-6f42G: undetectable	5tixB-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5UTU_H_ADNH503_1 (ADENOSYLHOMOCYSTEINA SE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	LEU A 832 HIS A 834 GLU A 860 LEU B 661 PHE A 863	None	1.49A	5utuH-6f42A: undetectable	5utuH-6f42A: 9.76
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	5X80_A_SALA201_1 (UNCHARACTERIZED HTH-TYPE TRANSCRIPTIONAL REGULATOR RV2887)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	4 / 5	VAL A 266 ARG A 269 PRO A 264 GLY A  82	None	1.45A	5x80A-6f42A: undetectable 5x80B-6f42A: undetectable	5x80A-6f42A: 20.75 5x80B-6f42A: 20.75
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6AJI_A_AY6A1001_0 (DRUG EXPORTERS OF THE RND SUPERFAMILY-LIKE PROTEIN,ENDOLYSIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 12	ILE A1202 ILE A1193 VAL A1169 VAL A1207 ALA A1208	None	1.01A	6ajiA-6f42A: undetectable	6ajiA-6f42A: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6BPL_B_PA1B605_1 (LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	ARG B 904 ARG B1054 ARG A 496	None	0.97A	6bplA-6f42B: undetectable 6bplB-6f42B: undetectable	6bplA-6f42B: 22.22 6bplB-6f42B: 22.22
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6DJZ_A_GMJA301_1 (SIGMA NON-OPIOID INTRACELLULAR RECEPTOR 1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	SER B 963 TYR B 690 ASP B 986 THR B 977	None	1.42A	6djzA-6f42B: undetectable	6djzA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EF6_A_BEZA401_0 (AMINOGLYCOSIDE PHOSPHOTRANSFERASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 9	LEU B 497 THR B 518 ILE B 608 ARG B 610 VAL B 372	None	1.15A	6ef6A-6f42B: undetectable	6ef6A-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6EKU_A_ZMRA901_1 (SIALIDASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	5 / 12	ILE B 186 ASN B 716 GLU B 191 ARG B 460 TYR B 184	None	1.47A	6ekuA-6f42B: undetectable	6ekuA-6f42B: 6.92
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6FGD_A_ACTA826_0 (GEPHYRIN)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	3 / 3	HIS B 672 ARG B 580 ILE B 614	None	0.67A	6fgdA-6f42B: undetectable	6fgdA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HD6_A_STIA603_1 (TYROSINE-PROTEIN KINASE ABL1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 5	LEU B1004 ILE B 767 MET B 931 GLY B1007	None	1.03A	6hd6A-6f42B: undetectable	6hd6A-6f42B: 24.42
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6HU9_Q_PCFQ202_0 (CYTOCHROME C OXIDASE POLYPEPTIDE 5A, MITOCHONDRIAL CYTOCHROME C OXIDASE SUBUNIT 1)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae)	4 / 6	TYR B 279 ILE B 282 ALA B 359 MET B 365	None	1.13A	6hu9m-6f42B: undetectable 6hu9q-6f42B: undetectable	6hu9m-6f42B: undetectable 6hu9q-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MHT_D_SAMD328_0 (CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 12	GLY B 764 GLY A 706 ILE B 925 ASN B 945 SER B 761	None	1.07A	6mhtA-6f42B: undetectable	6mhtA-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6MN4_F_AM2F301_0 (AMINOGLYCOSIDE N(3)-ACETYLTRANSFERA SE, AAC(3)-IVA)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC8 (Saccharomyces cerevisiae)	4 / 7	TRP G 210 GLU G 144 ASP G 141 GLU G 125	None	0.93A	6mn4F-6f42G: undetectable	6mn4F-6f42G: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6NM4_B_SAMB402_0 (HISTONE-LYSINE N-METHYLTRANSFERASE PRDM9)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC2 (Saccharomyces cerevisiae; Saccharomyces cerevisiae)	5 / 9	ILE B1071 ALA A1091 GLY A1090 GLY A1098 CYH B1069	None	1.26A	6nm4B-6f42B: undetectable	6nm4B-6f42B: undetectable
Potential target for repurposing, i.e. matched protein structure has less than 30% sequence identity to known drug target, and may potentially interact with the same drug molecule based on local structural similarity of binding site.	6R2E_G_FFOG403_0 (THYMIDYLATE SYNTHASE)	6f42	DNA-DIRECTED RNA POLYMERASE III SUBUNIT RPC1 (Saccharomyces cerevisiae)	5 / 11	ILE A 653 ASP A 649 GLY A 650 PHE A 651 ASN A 630	None	1.31A	6r2eG-6f42A: undetectable	6r2eG-6f42A: undetectable